Two new Spaniards with U152 haplogroup in 23andMe

[Ravai]

Hello,

I am a member of a Facebook group of Iberia Genealogía-Genetics. There are two members who entered not too long ago. They did the test with 23andMe, and have obtained as results R-PF6570, ie, R-U152.

I have read that for 23andMe, the position rs2566671 if equals:

Rs2566671 Y 5755550 --

It belongs to the haplogroup L2.

For now, one of them has confirmed me (rs2566671 and 5755550 --). He lives in Catalunya, the Spanish community closest to Liguria.

The other person will shortly confirm me if you get the same result. His grandfather was from Murcia, a community where I found Rabai families from Genoa. Currently lives in Barcelona.

The question is. How is the company 23andMe to advance with the paternal line? What advice can you give me so that you can advance in this paternal line? I am very interested in the likelihood that these two people will descend from Ligures. Are 23andMe and YFULL compatible? Do you recommend me to look at other positions of your raw data?

Thanks

Regards

[Ravai]

I already have the result of the other person (ancestors of Murcia):

rs2566671 Y 5755550 T

As indicated by ArmandoR1b in this thread (http://www.anthrogenica.com/archive/index.php/t-3403.html)

"If they have a no call for rs2566671 then they can. If they have T at rs2566671 they are positive for L2. If they have C then they are negative for L2."

Looks like it's L2.

:D

Regards

[ArmandoR1b]

Hello Ravai. ¿Que tal?

That is correct. rs2566671 Y 5755550 T means positive for L2. You can see the ancestral allele (negative) of C and the derived allele (positive) of T by putting L2 in the search box at http://ybrowse.org/gb2/gbrowse/chrY/? then clicking on the L2 in the graph. You'll see a screen with the following info -


L2 Details
Name: L2
Type: snp
Source: point
Position: ChrY:5755550..5755550 (+ strand)
Length: 1
allele_anc: C
allele_der: T
comment: aka S139
count_derived: 1041
count_tested: 4195
isogg_haplogroup: R1b1a1a2a1a2b1
load_id: L2
mutation: C to T
primer_f: L2_F GTCTTCTCAATCCAGGGAGATG
primer_r: L2_R GCTCACATCTCATAGAGGATCAG
ref: Thomas Krahn (FTDNA)
ycc_haplogroup: R1b1a2a1a1b3c
primary_id: 216064
gbrowse_dbid: chrY:database


>L2 class=Sequence position=ChrY:5755550..5755550 (+ strand)
T

Rs2566671 Y 5755550 -- means no call for L2 so that person from Catalunya needs to be tested for L2 to determine if he is positive for negative for L2.

YFull does not use the results from 23andme. YFull only used BAM files from NGS (Like BigY or YElite) and I assume WGS (like YSEQ WGS or FGC WGS).

If you want to know if they have a recent common ancestor and from about which century then they need an NGS or WGS test. If they get the $59 YDNA12 with FTDNA by ordering it through the U152 project page at https://www.familytreedna.com/group-join.aspx?Group=R1b-U152 then they can get the BigY test. FTDNA has been providing results within about 5 weeks. The BigY test is $575.

The Yseq WGS (https://www.yseq.net/product_info.php?cPath=29&products_id=42468) test is $899 but it includes some features that are not available with BigY including Full mtDNA sequencing and up to 10 novel mutations be verified with your sample by Sanger sequencing. So the price of the test is comparable to FTDNA Y-DNA12 + Full mtDNA + BigY.

[kw5368]

Here is a quick tool if you want to extract Y SNPs from 23andme data:

http://www.y-str.org/2014/04/23andme-to-ysnps.html

The output is a text file that can then be searched for SNPs that are found to be either negative or positive. I was able to find I was L2 before having any Y DNA testing done.