PDA

View Full Version : Central Asian R1b Exists



DMXX
07-04-2013, 08:15 AM
I've recently gotten a hold of some Y-STR data from a very old paper concerning Central Asian Y-DNA from a listed source for contact. Of the 16 STR's, fortunately, 14 were compatible with Urasin's Y-Predictor. Approximately 410 samples are present.

I'm in the middle of processing the data as we speak, but I cannot accurately express my surprise at seeing the persisting presence of predicted R1b-M269 across many of the populations in the region. Many of these predictions exceed 70% probability. A preliminary count shows approximately 10. Bearing in mind it was only a couple of years ago when a few R1b-L23* was discovered in north Afghanistan, it's quite a find. A lot of it seems to sit with the Turkmen, Uyghurs and Uzbeks.

As the data is not open-access I unfortunately cannot share it publicly in its' entirety. However, it will be featured fairly heavily in an upcoming blog entry revisiting the aforementioned paper. There was some rudimentary SNP testing, which I'll be using to cross-check the R1b predictions. If any R1b experts are interested in viewing the haplotypes please message me.

[Edit @ 14/07/2013]: To view the blog entry, view post 8.

Mikewww
07-04-2013, 02:05 PM
I've recently gotten a hold of some Y-STR data from a very old paper concerning Central Asian Y-DNA from a listed source for contact. Of the 16 STR's, fortunately, 14 were compatible with Urasin's Y-Predictor. Approximately 410 samples are present.

I'm in the middle of processing the data as we speak, but I cannot accurately express my surprise at seeing the persisting presence of predicted R1b-M269 across many of the populations in the region. Many of these predictions exceed 70% probability. A preliminary count shows approximately 10. Bearing in mind it was only a couple of years ago when a few R1b-L23* was discovered in north Afghanistan, it's quite a find. A lot of it seems to sit with the Turkmen, Uyghurs and Uzbeks.

As the data is not open-access I unfortunately cannot share it publicly in its' entirety. However, it will be featured fairly heavily in an upcoming blog entry revisiting the aforementioned paper. There was some rudimentary SNP testing, which I'll be using to cross-check the R1b predictions. If any R1b experts are interested in viewing the haplotypes please message me.

Thank you for your investigation. I think your findings point out the problems of modern population frequency analysis by national boundaries. We can't really expect an even mix of peoples across our modern political geographies. It's important to get down into the details of the various ethnic groups and specific sub-regions.

What Y STRs do they record? Is DYS426 there?

DMXX
07-04-2013, 11:33 PM
Thank you for your investigation. I think your findings point out the problems of modern population frequency analysis by national boundaries. We can't really expect an even mix of peoples across our modern political geographies. It's important to get down into the details of the various ethnic groups and specific sub-regions.

What Y STRs do they record? Is DYS426 there?

I agree - In addition, I think we as a community must constantly appraise assertions made based on a handful of papers against the rest without falling into the trap of "locking down" on circulating ideas. How often have we read online that Y-DNA R1b's presence in Central Asia is practically non-existent?

Before sharing the STR's, I can also now confirm the data will be made public after clarifying the issue with the listed source (Dr. Tyler-Smith). All R1b enthusiasts can take a good hard look at the raw numbers shortly.

These were the STR's I used (14). I had to leave out DYS434+5 due to Urasin's Y-Predictor.



DYS19 DYS388 DYS389I DYS389II DYS390 DYS391 DYS392 DYS393 DYS425 DYS426 DYS436 DYS437 DYS438 DYS439

Rathna
07-05-2013, 02:35 AM
How often have we read online that Y-DNA R1b's in Central Asia is practically non-existent?


Probably someone said that R1b in Central Asia was not existent in ancient DNA and this is difficulty deniable. I'll be glad to look at these haplotypes. About their origin we'll see. There are Indo-European peoples there and probably you know that I don't think that Indo-European languages came from India.

newtoboard
07-05-2013, 11:23 AM
Interesting. Would have thought for sure it would have been concentrated in Tajiks. Then again Turkmenistan had the strongest Neolithic links with West Asia compared to the other states.

Mikewww
07-05-2013, 01:58 PM
I agree - In addition, I think we as a community must constantly appraise assertions made based on a handful of papers against the rest without falling into the trap of "locking down" on circulating ideas. How often have we read online that Y-DNA R1b's presence in Central Asia is practically non-existent?

I think this is an area that Alan will agree or has commented on.

My perspective on a vast area like the Eurasian Steppes is a little bit like a kitchen countertop or a chef's workspace. There has been so many ingredients sliced, diced, mixed and washed away that looking at the open space of the countertop today may not tell us much. Now, we might a few crumbs of something old in the corner or behind the spice rack that were lost (safely) in the shuffle.

:) Go figure, I guess was helping out in the kitchen too much yesterday for our July 4th celebrations.

This is why I am not so optimistic on ancient DNA findings. I don't think we'll ever get an adequate survey of the full territories we want to with the time depths we want. We might miss the important pocket or ethnic group and of course how do we know which remnants are important versus red herrings? It is clearly a complex puzzle.

alan
07-10-2013, 11:03 AM
I agree - In addition, I think we as a community must constantly appraise assertions made based on a handful of papers against the rest without falling into the trap of "locking down" on circulating ideas. How often have we read online that Y-DNA R1b's presence in Central Asia is practically non-existent?

Before sharing the STR's, I can also now confirm the data will be made public after clarifying the issue with the listed source (Dr. Tyler-Smith). All R1b enthusiasts can take a good hard look at the raw numbers shortly.

These were the STR's I used (14). I had to leave out DYS434+5 due to Urasin's Y-Predictor.



DYS19 DYS388 DYS389I DYS389II DYS390 DYS391 DYS392 DYS393 DYS425 DYS426 DYS436 DYS437 DYS438 DYS439


It will be very interesting to hear the results of your work on this. I think its already been shown that both M73 and L23* have been encorporated in a somewhat patchy way into Turkic groups. I personally think that the way R1b shows all across the steppes and as far east as Uygurs in Altai etc suggests to me that it had spread well to the east by the time of the Turkic expansion. You could read that is a couple of ways - either it was mainly far to the east and absorbed and swept west by the Turks or it was spread from Ukraine to Chine and the Turks just so happened to follow the same route in reverse. I think the latter is most likely because Klyosov has shown that while these central Asian turkic groups tend to have relatively recent common ancestry, the common ancestor between M73 in these central Asian groups is very old. Anatole massively inflated this due to some multicopy error (see thread on this linking to old rootsweb thread involving Anatole, Vince V etc) but even when corrected this came in about 5000BC. I think that tends to suggest a sequence of local absorbing of M73* across the steppe from China to west Ukraine rather than a single sweeping up of it far to the east and pushing west by the Turks. Also, we know M73 dates to about 5000BC and has a common ancestor with M269 about 9000BC (plus or minus 1000 years). There is not any plausible evidence for a group of P297* heading deep into central Asia from the west in the period 9000-4000BC and the altenative of R1b heading west from central Asia in that timeframe doesnt seem to be held by anyone other than Anatole based on a miscalculation of the age of M73. There is no archaeological evidence of such a move from the east in that timeframe and there is also no archaeological evidence I am aware of of a move of Europeans or SW Asians into central Asia before Afansievo. So I think that we can rule out a position for P297* or M73* or M269 east of the Urals prior to Afansievo. Indeed the latter two had only just come into existence shortly before (c. 4-5000BC) and actual P297* doesnt exist today as far as I am aware. So, I think there is a strong logic to saying early R1b on this branch c. 9000BC-4000BC (P297* lines) was north of the early farming areas of SW Asia and east of the Urals before 4000BC. I would also rule out the early Neolithic European peoples on the basis of it being too early for the surviving branches of R1b there and on its absence in ancient DNA. I think R1b lurked somewhere in the arc from the Bosphoros, the west and north shores of the Black Sea, the Caucasus and NW Iran, all areas which fit to some degree the timeframes of the main R1b branches. It is slighly easier to see M73 as being on the stretch between the NW corner of the Black Sea and the north Caucasus though.

I have already posted many times that the Ural Bashkirs owned the Cargaly Bronze Age mining area before selling to the Russian state. I suspect they absorbed their R1b from people around that area although its a guess. Many metallurgical experts believe that the mining and metallurgy must have been brought from the Caucasus although the metal source they found was pure copper and not as good for copper tools. They must have had some relationship with the Yamnaya or immediate pre-Yamnaya groups who dominated the area. As the pure copper network covered a different area of the steppes from the Caucasian metal (in the south-west steppes) it probably essentially meant a small Maykop type group of specialists were absorbed into a far larger Yamnaya population in the area. I am tempted to see R1b in areas like the Urals as a remnant of this small metallurgical group although that is beyond proof. The age of M73* (and indeed the age of M269 overall) are pretty compatible with the timing of such a spread from the earlier Maykop zone into the steppes.

DMXX
07-14-2013, 03:32 AM
As promised, my fellow genealogists. Looking forward to everyone's thoughts.

A Hidden Gem in Central Asia: Previously Unknown Y-DNA R1b Haplotype (http://vaedhya.blogspot.com/2013/07/a-hidden-gem-in-central-asia-previously.html)



Central Asian Y-DNA diversity has been an area of constant intrigue in the genetics community. Wells et
al.'s The Eurasian Heartland: A continental perspective on Y-chromosome diversity paved the way, with several others following in their regard. Members of the same team (including Dr. Wells) produced another paper - A Genetic Landscape Reshaped by Recent Events: Y-Chromosomal Insights into Central Asia - on the same topic in the following year, this time headed by Dr. Tatania Zerjal. I noted a greater emphasis on East-Central Asian populations as well as a mentioning of Y-STR analysis in the study itself. However, none of this data was supplied, with only Y-SNP information included (shown sporadically in this entry). The age of this paper is apparent through the nomenclature used (see Method section).

...


As readers will see, the Central Asian R1b's in this study all belong to the same haplotype, but its' GD with other samples makes things a bit more interesting.

One possible interpretation I'll post here rather than in my work (I prefer remaining completely objective on my blog); the better matching in the Caucasus of the Central Asian haplotype rather than among Iranians or Kurds supports it coming around the Caspian in a clockwise (above the Caspian) rather than anticlockwise (below the Caspian). Of course, this compliments Jean's hypothesis of R1b-M269 arriving with some early Indo-Europeans quite well, but I'd personally want to see and compare with data from the Yakut and Xinjiang before hedging my bets. Might investigate that as an addendum at some point.

I should note that some of the R1b's I'd previously reported in the first post ended up being R1b-M343. You can view those (any many other) haplotypes through my blog entry.

alan
07-14-2013, 10:23 AM
As promised, my fellow genealogists. Looking forward to everyone's thoughts.

A Hidden Gem in Central Asia: Previously Unknown Y-DNA R1b Haplotype (http://vaedhya.blogspot.com/2013/07/a-hidden-gem-in-central-asia-previously.html)



As readers will see, the Central Asian R1b's in this study all belong to the same haplotype, but its' GD with other samples makes things a bit more interesting.

One possible interpretation I'll post here rather than in my work (I prefer remaining completely objective on my blog); the better matching in the Caucasus of the Central Asian haplotype rather than among Iranians or Kurds supports it coming around the Caspian in a clockwise (above the Caspian) rather than anticlockwise (below the Caspian). Of course, this compliments Jean's hypothesis of R1b-M269 arriving with some early Indo-Europeans quite well, but I'd personally want to see and compare with data from the Yakut and Xinjiang before hedging my bets. Might investigate that as an addendum at some point.

I should note that some of the R1b's I'd previously reported in the first post ended up being R1b-M343. You can view those (any many other) haplotypes through my blog entry.

I take it that this central Asian haplogroup is an L23XL51 one? I think the idea that the eastern leg of L23 moved clockwise north of the Caspian from somewhere nearer the Caucasus on its eastern travels makes a lot of sense. When you consider the date of L23* and M269* usually suggested that places it in the 4000-3500BC timeframe. A lot happened in the western steppes in that era. It started just after period c. 4500-4000BC of heavy influence by farmers and mutual mixing followed by farming collapse and the movement of the first steppe groups west. L23XL51 is possibly too young for that phase and only M269* might have been old enough for that westward move. It is found in Kosovar/Albanian today, a people whose language indicates were likely once located further east. So its possible that M269* but not L23* could have been an element among those groups like Suvorovo.

Then there seems to have been a period of remoulding and of influence from Maykop culture/CMP centred in the Kuban region into the southern steppes c. 3500BC. The age of L23XL51 fits best this phase. This was also the period when CMP metallurgy and mining reached the south Urals, Yamnaya gained its wheels etc and Afanasievo may have headed east. I think the combination of factors and the role of Maykop/CMP influences in this may well suggest that L23* was mixed among R1a folks in the Afanasievo movement into central Asia. The archaeological evidence is very much compatible with a near-Caucasus group having at least had a minor human input with the immediate acestors of Yamnaya. So for me Afanasievo is the most likely source of L23XL51 heading east as a fellow travellor with R1a. If I had to guess I think the L23XL51 lineages may have been the metallurgical element.

If this is all true then the big question remains of the larger impact of the westwards movement of L23XL51. Well if the starting point was indeed the steppe-Caucasus interface zone then L23XL51 could have been carried west in any of the waves from 3500BC onwards. Or perhaps the dating of L23 is a little later than reality and it was carried both east and west a few centuries earlier. I have suggested that L23 was a possible fellow travelor with R1a in Afansievo. Its date is debated, having a few years ago been thought to be c. 3700BC and well pre-Yamnaya but hauled back to something more like 3400-3500BC. It has also been suggested that L23 could have been the main player among the Anatolians too and it does seem to be the main R1 player among some of the pre-Slavic Balkans peoples. Its all a bit unclear but it does make a position around the Caucasus-steppe interface zone at some point in the period 4000-3500BC the most plausible centre point for taking part in both movements east with Afanasievo and west into the Balkans.

I have pushed the Maykop angle but its also fair to say that the Skelya cultures around the Dnieper-Azov area c. 4500-4000BC (ancestral to Suvorovo-Anatolian?) was also a complex phenomenon which included likely Cuc-Tryp elements (cranial evidence of males, Carpatho-Balkan metal network, pressure flaking knowledge transfer). Now I better understand that, it opens up a number of possibilities for R1b's location and role and the issue of languages. Actually just more questions really lol

DMXX
07-14-2013, 10:27 AM
I cannot speak on the archaeological portions of your posts as I'm not well-versed enough to have a competent opinion (continue to read your messages with enthusiasm however), so I'll address the genetic question:


I take it that this central Asian haplogroup is an L23XL51 one?

Presumably so, yes, since most M269+ in Asia is indeed L23+ as well (perhaps Mikewww or Rich R. could chime in on this), but it'd be impossible to say based on 14 STR's. If they resemble L23xL51 on an STR basis from one of the experts' opinions, that could serve as a surrogate answer.

alan
07-14-2013, 10:39 AM
I cannot speak on the archaeological portions of your posts as I'm not well-versed enough to have a competent opinion (continue to read your messages with enthusiasm however), so I'll address the genetic question:



Presumably so, yes, since most M269+ in Asia is indeed L23+ as well (perhaps Mikewww or Rich R. could chime in on this), but it'd be impossible to say based on 14 STR's. If they resemble L23xL51 on an STR basis from one of the experts' opinions, that could serve as a surrogate answer.

Seems very unlikely it could be anything else - it would cause a big stir if it was M269* or the like though.

One thing I do not want to lose in my big post above is the simple point that there is no evidence in the copper age of a movement west FROM central Asia.

There were however a couple of impulses into it. The first (much less well known) is the likely extension of pressure flaking knowledge from the west into the western parts of Central Asia around 4500 or so. This seems to have passed from the Cuc-Typ farmers through Skelya groups east as far as the Urals along with metallurgical products but the pressure flaking knowledge passed further east still into central Asia. I wouldnt say its a very strong smoking gun for L23 and it seems significantly too early for that clade anyway. The second is of course Afanasievo. The latter is by far the most likely explanation for L23 spreading east IMO although I think it was a minority element in a population with more R1a.

DMXX
07-14-2013, 10:42 AM
Then there is, of course, the movement of early neolithic farmers from NW Iran/the South Caucasus along the Caspian coastline before settling around Central Oases to form the BMAC. Another west-to-east movement to take into consideration. I had previously suggested any R1b in South-Central Asia should be attributed to them; however, the apparent worse matching in Iran and among the Kurds doesn't help that theory as we/they lie directly on that trajectory to Central Asia from West Asia. I was surprised to have inferred that conclusion, but this field is full of enriching surprises.

alan
07-14-2013, 11:03 AM
i would also add (as per my thread) that L23XL51 appears from a recent paper to be found in much higher frequencies on the northern side of the Caucasus (albeit patchy) than the south with the exception of the Armenians. That would also fit the clockwise northern passage around the Caspian Sea.

A southern route into central Asia would mean passing through some really extremely hostile environments compared to a northern route. I wouldnt rule out some very deep time presence of R1b in northern Iran as there is a higher proportion of P297 negative R1b there than anywhere else but that is potentially back in the ice age, a period with an entirely different environment and unrelated to the L23 period in the copper age.

Iran has a complex history and R1b could have arrived there from elsewhere. Northern Iran to the east of the Zagros was avoided until very late in the Neolithic too so its not the best area to see as a source population. Indeed, the earliest Kuragns in Iran (in the NW of the country) are thought by some archaeologists to derive from Maykop peoples rather than the other way round. Of course NW Iran would be easily reached from the northern side of the Caucasus (as is suggested for trade contacts c. 4000-3500BC with Maykop) but the real point is that a migration east of iran from the Caucasus-steppe zone is unattested and environmentally unlikely.

DMXX
07-14-2013, 11:19 AM
A southern route into central Asia would mean passing through some really extremely hostile environments compared to a northern route. ...

Don't know about prehistoric times but this isn't the case today. Around the entire Iranian side of the Caspian, all the land within 20km of the coastline is extremely fertile (and not hostile). Nobody could seriously look at a map of Iran and presume the country was completely devoid of movements simply because of two well-demarcated mountain ranges and two centralised deserts.

This is likely the path taken by early West Iranians and most certainly the way taken by the Oghuz Turks after them.

Rathna
07-14-2013, 11:20 AM
First of all, from SMGF you can see the STRs of these two questioned markers:
DYS437
DYS437 (CEPH 1451-01)Example Sequence:

GACTATGGGCGTGAGTGCATGCCCATCCGG/TCTA/TCTA/TCTA/TCTA/T

CTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTG/TCTA/TCTA/TCTA/TCT

A/TCATCTATCATCTGGGAATGATGTCTATCTACTTATCTATGAATGATATT

TATCTGTGGTTATCTATCTATCTATATCATCTGTGAATGACAGGGTCTC
15 repeats 189 bp (TCTA)9 (TCTG)2 (TCTA)4
You can see that the usual value of 15 repeats has made if we count the first 9 TCTA plus the intermediate 2 TCTG and the other 4 TCTA. If we count only the first sequence and the mutation happened in it, it is clear that our usual 15 is counted like 9. This are probably the values of your data.
The same for DYS389I:
DYS389I (CEPH 1329-01)Example:
CCAACTCTCATCTGTATTATCTATGTA/TCTG/TCTG/TCTG/TCTA/TCTA/TCT

A/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCCCTCCCTCTATCAATCTATCTA

TTTATCTAGCAGTCCATCATCTATCTATGACATTCTTCTACTACTCAGGG ATAAC
12 repeats 154 bp (TCTG)3 (TCTA)9

If we count only the STR TCTA without the first 3 TCTG it is clear that DYS389I is under three as to our usual values.
The your haplotypes should be these:

DYS19 DYS388 DYS389I DYS389II DYS390 DYS391 DYS392 DYS393 DYS425 DYS426 DYS436 DYS437 DYS438 DYS439 Haplogroup Probability
.
arm12 14 12 13 29 24 10 13 12 12 12 12 15 12 12 R1b1b2-M269 97%
arm47 14 11 12 28 24 10 14 12 12 12 12 15 13 11 R1b1b2-M269 95%
arm5 14 12 13 28 24 10 14 12 12 12 12 15 12 12 R1b1b2-M269 93%
arm42 14 12 12 27 23 10 14 12 12 12 12 15 12 11 R1b1b2-M269 74%
arm31 14 12 13 28 24 11 15 12 12 12 12 15 12 13 R1b1b2-M269 67%
arm43 14 12 13 29 23 11 13 12 12 12 12 14 12 11 R1b-M343 50%
az48 14 12 13 29 24 11 13 12 12 12 13 15 12 12 R1b1b2-M269 80%
az34 14 12 12 28 24 11 14 12 12 12 12 15 13 12 R1b1b2-M269 66%
krd29 14 12 13 30 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 86%
krd30 14 12 13 30 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 86%
krd41 14 12 13 29 24 11 13 12 12 12 12 14 12 13 R1b1b2-M269 73%
krd6 14 12 14 31 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 57%
kzb39 13 12 13 29 25 10 13 12 12 12 12 15 12 14 R1b1b2-M269 56%
ost18 14 12 14 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 93%
trk2 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk22 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk4 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk1 14 12 13 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 85%
trk7 14 12 13 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 85%
uz-s110 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%
D75 14 12 13 30 24 11 13 12 12 12 12 15 12 13 R1b1b2-M269 69%
T29 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
T32 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%

DMXX
07-14-2013, 11:22 AM
This is useful, thank you Rathna. I'll make the necessary amendments some point soon and see if that effects the matching with Iranians and Afghans.

Rathna
07-14-2013, 11:26 AM
It seems they are all R-L23 and only one is R1b1:

uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%

I'll let you know next my opinion.

alan
07-14-2013, 11:29 AM
Then there is, of course, the movement of early neolithic farmers from NW Iran/the South Caucasus along the Caspian coastline before settling around Central Oases to form the BMAC. Another west-to-east movement to take into consideration. I had previously suggested any R1b in South-Central Asia should be attributed to them; however, the apparent worse matching in Iran and among the Kurds doesn't help that theory as we/they lie directly on that trajectory to Central Asia from West Asia. I was surprised to have inferred that conclusion, but this field is full of enriching surprises.

The issue with the Neolithic farmers is that east of the Zagros Mountains, the hostile northern Iran plateau was only settled at the very end of the Neolithic period, apparently impossible until irrigation knowledge developed in Mesopotamia allowed settlement of the alluvial fans. There are a lot of links and pastes from papers and a thesis on this on another thread I posted. Irrigation was probably a requirement and metal was probably the main attraction. These people do not really have any links with the rest of the L23XL51 world though so its hard to see a common thread between these Iranian late Neolithic/copper age peoples and the rest. The only connection I can think of that links Iran is the recent Maykop paper's suggestion of links c. 4000BC although this would appear to be trade as there is very little in common between settlement patterns, burial form etc in the pre-Maykop and Maykop Caucasus and Iran. That said trade could have meant some gene flow in both directions. I certainly find the idea of a Maykop-NW Iran link for R1b more plausible than other southern links to Uruk expansion, the south Caucasus (Kura-Araxes is later than Maykop anyway) etc.

I think in general a position on the north Caucasus-steppe interface makes most geographical sense for explaining the distribution of L23, particularly if M73 is also taken into account. M73 essentially dies off sharply at the edges of where farming existed at the time of its coming into existence c. 5000BC. It seems not to have spilled into the farming world either towards the Balkans or through the Caucasus (only known in Turkic groups in the northern part of the Caucasus). Possibly more to the point it NEVER penetrated that barrier. That suggests it was not positioned where it would have been swept west with steppe movements into the Balkans (M73 dies off at the Ukraine-Moldova border). That to me is evidence that M73 was located a little east of M269 or took a turning in that direction. I suspect its presence at low levels as far as the Ukraine west border may be due to later sweeping west by one of the many later prehistoric to Medieval waves. I reiterate that it must have been tucked east at the time of the great earlier steppes movements west c. 4200-3000BC or its absence in the Balkans even today would be impossible to explain. On the other hand it does share an ancestor no later than 9000BC with M269 and it seems to have been allergic to the farming world. It seems very likely it was somewhere on the western steppe's eastern zone among people who didnt make the move west but did make a move east. That again sounds very like encorporation into Afanasievo to me.

DMXX
07-14-2013, 11:36 AM
It seems they are all R-L23 and only one is R1b1:

uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%

I'll let you know next my opinion.

Yes, uz-s92 was not included in the main investigation for this reason. It did not resemble the other haplotypes very much.

alan
07-14-2013, 11:39 AM
Don't know about prehistoric times but this isn't the case today. Around the entire Iranian side of the Caspian, all the land within 20km of the coastline is extremely fertile (and not hostile). Nobody could seriously look at a map of Iran and presume the country was completely devoid of movements simply because of two well-demarcated mountain ranges and two centralised deserts.

This is likely the path taken by early West Iranians and most certainly the way taken by the Oghuz Turks after them.

That is true but for some reason (I think it was heavily forrested/sub-tropical etc) it was not settled until the end of the Neolithic. From memory I think I read that hunter-gatherers held the area very late as it was a bit of a paradise for that economy. its amazing in Iran that the west and south were Neolithicised about 3 or 4000 years earlier than the northen fringe and north-central plateau. That is based on recent reviews of the dating evidence in papers and a thesis I have linked and pasted in other recent threads. Anyway, the main issue I was thinking of was the environment of the route to the east of Iran into central Asia. I imagine that would need major adaption and major push-pull factors to move along that route.

alan
07-14-2013, 12:01 PM
I suppose the main point I am making is that the period 4500BC-3500BC saw an enrichment of the steppes population through linkages first with the Balko-Carpathian network driven by the Skelya groups (for whom cranial analysis incicates a mixture of steppe and Cuc-Typ elements among the males) and then by the Circumpontic Metallurgical network whose roots were in Maykop. The influence of both clearly to some degree covered the entire western steppes. So I envisage a mixed bag (with the mix varying by geography) across the entire western steppes c. 4500-3000BC.

Rathna
07-14-2013, 06:09 PM
The R1b1 haplotype is interesting:

uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%

but it seems it matches closely that of Raza, whose we know its Geno 2.0, even though it has been tested only for 12 markers.
Anyway they match in
DYS393=13
DYS19=15
DYS389I/II=14-30
DYS390=24
DYS391=11
DYS426=12
and differ in
DYS388=13 Raza, 12 uz-s92
DYS439=11 Raza, 12 uz-s92

Then if this R1b1 were of the same subclade of Raza, it would be very far from the ancestor of the European subclades from R-V88+ to R-L389+.

Palisto
07-15-2013, 04:58 AM
First of all, from SMGF you can see the STRs of these two questioned markers:
DYS437
DYS437 (CEPH 1451-01)Example Sequence:

GACTATGGGCGTGAGTGCATGCCCATCCGG/TCTA/TCTA/TCTA/TCTA/T

CTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTG/TCTA/TCTA/TCTA/TCT

A/TCATCTATCATCTGGGAATGATGTCTATCTACTTATCTATGAATGATATT

TATCTGTGGTTATCTATCTATCTATATCATCTGTGAATGACAGGGTCTC
15 repeats 189 bp (TCTA)9 (TCTG)2 (TCTA)4
You can see that the usual value of 15 repeats has made if we count the first 9 TCTA plus the intermediate 2 TCTG and the other 4 TCTA. If we count only the first sequence and the mutation happened in it, it is clear that our usual 15 is counted like 9. This are probably the values of your data.
The same for DYS389I:
DYS389I (CEPH 1329-01)Example:
CCAACTCTCATCTGTATTATCTATGTA/TCTG/TCTG/TCTG/TCTA/TCTA/TCT

A/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCCCTCCCTCTATCAATCTATCTA

TTTATCTAGCAGTCCATCATCTATCTATGACATTCTTCTACTACTCAGGG ATAAC
12 repeats 154 bp (TCTG)3 (TCTA)9

If we count only the STR TCTA without the first 3 TCTG it is clear that DYS389I is under three as to our usual values.
The your haplotypes should be these:

DYS19 DYS388 DYS389I DYS389II DYS390 DYS391 DYS392 DYS393 DYS425 DYS426 DYS436 DYS437 DYS438 DYS439 Haplogroup Probability
.
arm12 14 12 13 29 24 10 13 12 12 12 12 15 12 12 R1b1b2-M269 97%
arm47 14 11 12 28 24 10 14 12 12 12 12 15 13 11 R1b1b2-M269 95%
arm5 14 12 13 28 24 10 14 12 12 12 12 15 12 12 R1b1b2-M269 93%
arm42 14 12 12 27 23 10 14 12 12 12 12 15 12 11 R1b1b2-M269 74%
arm31 14 12 13 28 24 11 15 12 12 12 12 15 12 13 R1b1b2-M269 67%
arm43 14 12 13 29 23 11 13 12 12 12 12 14 12 11 R1b-M343 50%
az48 14 12 13 29 24 11 13 12 12 12 13 15 12 12 R1b1b2-M269 80%
az34 14 12 12 28 24 11 14 12 12 12 12 15 13 12 R1b1b2-M269 66%
krd29 14 12 13 30 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 86%
krd30 14 12 13 30 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 86%
krd41 14 12 13 29 24 11 13 12 12 12 12 14 12 13 R1b1b2-M269 73%
krd6 14 12 14 31 24 10 13 12 12 12 12 15 12 13 R1b1b2-M269 57%
kzb39 13 12 13 29 25 10 13 12 12 12 12 15 12 14 R1b1b2-M269 56%
ost18 14 12 14 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 93%
trk2 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk22 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk4 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
trk1 14 12 13 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 85%
trk7 14 12 13 30 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 85%
uz-s110 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%
D75 14 12 13 30 24 11 13 12 12 12 12 15 12 13 R1b1b2-M269 69%
T29 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%
T32 14 12 13 29 24 11 13 12 12 12 12 15 12 12 R1b1b2-M269 86%

DMXX just informed me on his blog about your comment, Rathna, I have not seen it before. Without looking at the raw data I came to the same conclusion, +6 for DYS437, +3 for DYS389I DYS389II:
http://vaedhya.blogspot.com/2013/07/a-hidden-gem-in-central-asia-previously.html#comment-form

I looked up the TOP20 matches using all available STR values (16), this is why I could only use people with STR111 data.
https://docs.google.com/spreadsheet/ccc?key=0AgVZU9mN1R6ldE5DVUVJUF9lN242Yk5IbEduWnFDV UE&usp=sharing

I think that the European matches can be ignored for now, I highlighted the matches from Asia in red in the spreadsheet, most of them are Armenian.

Armenian arm12: good matches with other Armenians (11%)
Armenian arm47: very big differences with all tested R1b people, I doubt this individual is R1b; if yes then extreme outlier (best Asian match 119%)
Armenian arm5: good matches with other Armenians (0-11%)
Armenian arm42: big differences with other Armenians (38-49%)
Armenian arm31: big differences with other Armenians (53-68%)
Azeri az48: big differences with Armenians (51%)
Azeri az34: very big differences with Armenians (78-90%)
Kurd (Turkmen.) krd29: Top20 exclusively very close matches with Europeans (best European match 9%); best Asian match (#94) is 222572 from Iran (26%)
Kurd (Turkmen.) krd30: good match with Armenian (17%)
Kurd (Turkmen.) krd41: no good matches in Asia; "best" match is 235305 alzuwaimel from Saudi-Arabia (42%)
Kurd (Turkmen.) krd6: moderate match with Armenian (26%)
Georgian kzb39: big differences with Armenians (40%)
Ossetian ost18: perfect matches with Armenians (0%) and with Europe (0%) indicates that it is close to the ancestral R1b haplotype (Modal)
Turkmen trk6: moderate match with Armenian (27%)
Turkmen trk2: perfect matches with Armenians (0%) and with Europe (0%) indicates that it is close to the ancestral R1b haplotype (Modal)
Turkmen trk22: same as trk2
Turkmen trk4: same as trk2
Turkmen trk1: good matches with Armenians (9%)
Turkmen trk7: same as trk1
Uzbek uz-s110: same as trk2
Turkmen T29: no good matches in Europe and Asia, only one good match (15%) 174417 from England; "best" Asian match is 235305 alzuwaimel from Saudi-Arabia (57%)
Turkmen T32: good match with Armenian (9%)

rockman
07-15-2013, 06:47 AM
The R1b1 haplotype is interesting:

uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%

but it seems it matches closely that of Raza, whose we know its Geno 2.0, even though it has been tested only for 12 markers.
Anyway they match in
DYS393=13
DYS19=15
DYS389I/II=14-30
DYS390=24
DYS391=11
DYS426=12
and differ in
DYS388=13 Raza, 12 uz-s92
DYS439=11 Raza, 12 uz-s92

Then if this R1b1 were of the same subclade of Raza, it would be very far from the ancestor of the European subclades from R-V88+ to R-L389+.

So I am the "Raza" that is mentioned in Rathna's post. Thought I might chime in and and hopefully be able to produce some useful info.

So basically my paternal ancestry is said to be a mix of Iranian/Central Asian. Apparently it is claimed my paternal grandfathers ancestors might have come to India from Central Asia but I am not completely sure.

Hopes this helps in some way.

Rathna
07-15-2013, 08:07 AM
So I am the "Raza" that is mentioned in Rathna's post. Thought I might chime in and and hopefully be able to produce some useful info.

So basically my paternal ancestry is said to be a mix of Iranian/Central Asian. Apparently it is claimed my paternal grandfathers ancestors might have come to India from Central Asia but I am not completely sure.

Hopes this helps in some way.

Rockman, I asked you to test for P25, because this should have helped us to understand its collocation. You should do it without expense, because many, me included, would be glad to pay for this test.
Anyway these data probably demonstrate that your Y is linked with this from Uzbekistan, even though it is tested for so few markers, and we would need much more for being sure.
Anyway, as you see, nothing personal. Only to understand better our science.

Rathna
07-15-2013, 09:17 AM
I think that the European matches can be ignored for now, I highlighted the matches from Asia in red in the spreadsheet, most of them are Armenian.

And this should be a great result, because we did already know that R-L23 (and R1b1*) are linked above all with Armenians. Of course I have always supported that Armenians are Indo-Europeans and came probably from the Balkans. Also the R1b1 I examined is linked with the Armenian ones of the R1b1 FTDNA Project, and it would be of course important to test them for the SNPs found (and not found) in Raza, who is linked probably to Central Asia but perhaps before more than to Iran to Caucasus and Armenia.

newtoboard
07-15-2013, 11:57 AM
I'm curious as to how anyone can link this to Afanasievo. From the above information it appears its distribution in Central Asia is Western. And its the eastern part of Central Asia (the Tarim) and the adjacent Indo-Iranian land (Tajikistan, Afghanistan, Pakistan, NW/N India) ,which received movements from the Tarim during the Kushan Empire, that would be most likely to carry Afanasievo R1b (if there is such a thing as Afanasievo R1b). And if you're going to suggest some Afanasievo R1b moved south to the vicinity of the BMAC instead of east on the road to Siberia then why didn't it expand with later IE people from that area?

DMXX
07-15-2013, 12:24 PM
It's a fair point, newtoboard.

On the one hand, we have evidence of R1b-M269 among the Yakuts of Siberia (http://1.bp.blogspot.com/-oY4fK-jmNFk/UcSML696wfI/AAAAAAAAI7I/l4CwlrbhsUc/s1600/yakut.jpg). (4/375, 1.1%).

On the other, Dulik et al. found no R1b-M269 whatsoever among Altaians (http://www.sciencedirect.com/science/article/pii/S0002929711005490) (they instead had R1b-M73, plenty of R1a-M17 and even some R2a-M124). The trajectory from Yamnaya to Afanasievo crosses directly above the Altai; if the proto-Tocharians associated with Afanasievo per the P-C theory carried Y-DNA R1b-M269, you'd expect at least one individual carrying it to exist.

One could even argue the presence of R1b-M269 among the Yakuts was in fact part of the Russian admixture the authors cited in explaining the other West Eurasian haplogroups, such as R1a-M458.

Mikewww
07-15-2013, 07:42 PM
It's a fair point, newtoboard.

On the one hand, we have evidence of R1b-M269 among the Yakuts of Siberia (http://1.bp.blogspot.com/-oY4fK-jmNFk/UcSML696wfI/AAAAAAAAI7I/l4CwlrbhsUc/s1600/yakut.jpg). (4/375, 1.1%).

On the other, Dulik et al. found no R1b-M269 whatsoever among Altaians (http://www.sciencedirect.com/science/article/pii/S0002929711005490) (they instead had R1b-M73, plenty of R1a-M17 and even some R2a-M124). The trajectory from Yamnaya to Afanasievo crosses directly above the Altai; if the proto-Tocharians associated with Afanasievo per the P-C theory carried Y-DNA R1b-M269, you'd expect at least one individual carrying it to exist.

One could even argue the presence of R1b-M269 among the Yakuts was in fact part of the Russian admixture the authors cited in explaining the other West Eurasian haplogroups, such as R1a-M458.

When looking for remnants at this light of frequency over broad territories, I don't think we can say absence of evidence is evidence of absence. If we find it we know its there, but if don't find it we just may not have looked hard enough or it moved. We don't know.

I downloaded your data stored under "Zerjal et al. Raw Data" and resorted the STR columns and haplotypes to compare with the R1b-M343xU106xP312 file I have.

I'd be surprised if all of the Zerjal et al predicted M269 or M343 were not R1b-L23xL51. They look like the rest of L23xL51. I don't think there is much reason to say these guys dropped in from Western or Central Europe. I don't know which direction they came from but apparently not any further west than Eastern Europe.

I didn't see anything that I thought was M343xM269 either among this particular data set. M343xM269xV88 is just not that easy to find, which leads me back to Vizachero's perspective on the geographic branching of early R1b subclades.

BTW, this really is great work pulling together this data.:)

Rathna
07-15-2013, 11:15 PM
When looking for remnants at this light of frequency over broad territories, I don't think we can say absence of evidence is evidence of absence. If we find it we know its there, but if don't find it we just may not have looked hard enough or it moved. We don't know.

I downloaded your data stored under "Zerjal et al. Raw Data" and resorted the STR columns and haplotypes to compare with the R1b-M343xU106xP312 file I have.

I'd be surprised if all of the Zerjal et al predicted M269 or M343 were not R1b-L23xL51. They look like the rest of L23xL51. I don't think there is much reason to say these guys dropped in from Western or Central Europe. I don't know which direction they came from but apparently not any further west than Eastern Europe.

I didn't see anything that I thought was M343xM269 either among this particular data set. M343xM269xV88 is just not that easy to find, which leads me back to Vizachero's perspective on the geographic branching of early R1b subclades.

BTW, this really is great work pulling together this data.:)

I think having already answered your questions. See #17

It seems they are all R-L23 and only one is R1b1:
uz-s92 15 13 14 30 24 11 13 13 13 12 12 14 11 12 R1b-M343 52%
I'll let you know next my opinion.

and #22 and #26.

Palisto
07-15-2013, 11:16 PM
I further looked into the raw data of Zerjal et al. and compared with STR raw data from other publications. I focused on perfect matches for all comparable STR values.

Armenian arm12 matches with E22 individual from Gokcumen et al., 2011 (10/10 STR values). E22 is R1b and from village Eskikoy* (pre-Ottoman Karaman ancestry claimed, Central Anatolia/Turkey)
Armenian arm12 matches with with Afg66 individual (Lacau et al., 2012) (10/10). Afg66 is from Jalalabad/South Afghanistan, has R1b1a2a ((L23).
Armenian arm12 matches with #86 individual from Sternersen et al., 2004 (8/8 STR values). #86 is Iraqi Kurd.

Armenian arm5 matches with #94 individual from Sternersen et al., 2004 (8/8 STR values). #94 is Iraqi Kurd.

Armenian arm31 matches with #424 individual from Cinnioglu et al., 2004 (9/9 STR values). #424 is R1b3-M269 from Turkey Region8=West-Turkey

Azeri az34 matches with #96 individual from Sternersen et al., 2004 (8/8 STR values). #96 is Iraqi Kurd.

Turkmen trk2, Turkmen trk22, Turkmen trk4, Turkmen T29, Turkmen T32, Uzbek uz-s110, and Azeri az48 match with 7 individuals (7x#380) from Cinnioglu et al., 2004 (9/9 STR values). They are all R1b3-M269 from Turkey: 3x Region4=East-Anatolia; 2x Region7=Central Anatolia; 1x Region6=South-Turkey; 1x Region1=Northwest-Turkey.

Kurd (Turkmenistan) krd41 matches with 5 individuals (2x#384,#408,#410,#412) from Cinnioglu et al., 2004 (9/9 STR values). They are all R1b3-M269 from Turkey: 3x Region4=East-Anatolia; 1x Region2=Western Black Sea Coast; 1x Region1=Northwest-Turkey.

No perfect matches with R1b1*-P25 from Nepal (Gayden et al., 2011). DYS439 is always 11 in R1b1*-P25 from Nepal. All 7 individuals from Nepal (Newar) are perfect matches of each other (17/17 STR values), founder effect?

Rathna
07-15-2013, 11:24 PM
No perfect matches with R1b1*-P25 from Nepal (Gayden et al., 2011). DYS439 is always 11 in R1b1*-P25 from Nepal. All 7 individuals from Nepal (Newar) are perfect matches of each other (17/17 STR values), founder effect?
It will be interesting to see their YSC224 now that Raza will be tested for P25 and, if he will be positive, these Asian R-M343 will belong to a different line as to the Western European one.

Rathna
07-15-2013, 11:55 PM
It would be interesting also to see the YCAII of Raza. If it were 21-23 or 23-23 or closer values, my theory would be demonstrated.

(For not knowledgeable people: the lack of YSC224 and the other 2 SNPs would be the witness of the division between Western European R1b1 and Eastern one.

alan
07-16-2013, 12:21 AM
In a couple of other threads I have pointed out that upper palaeolithic modern human remains are apparently absent until the end of that period (epi-palaeolithic) in the central and east Caucasus, northern Iran and central Asia and the likely cause of this was the expansion of the Caspian and the connecting of the Caspian and Black Sea for some of the period 15000-9000BC. So those areas on present evidence would be all but ruled out as the R1b refugia (or indeed thay of any yline). I believe Karafet made R1 date to 16500BC or the like. So it seems to me that early R1a and R1b could well have been boxed in together by this phenomenon. At the LGM we are really looking for an R1refuge not a separate R1a and R1b one. This barrier together with very hostile environments to the north and glaciated mountains in the Caucasus and north Iran would seem to have effectively boxed in the Ukraine area and left only the route west open for a chunk of that time. That fits in with epi-Gravettain groups that seem to have run along the entire north and west coast of the Black Sea. Anthony points out that the division in cultural groups around the Urals has its roots very deep in time with the Caspian transgression c. 15000BC and basically remained one for over 10000 years forming what must have been a profound genetic and cultural barrier. So, I certainly think R1b and R1a in its earliest stages were together on the western side of that barrier and to the immediate . The opportunity to move south or east was simply not there (except by the west side of the Black Sea) in part of the early R1b ad R1a periods and only appears to have been possible again from c. 10000BC. That is the sort of time P297* came into existence. It is possible at that stage P297 negative or P297* lines could have spilled south but not IMO very far south. As I have often pointed out, R1b does not have any of the characteristics of being in the early farming areas and doesnt really do much until 5000BC by which time M73 comes into existence. Its the oldet surviving P297 line but is basically unknow in the old farming zone. It seems likely to me that it was located either on the east Ukraine/south Russia steppe, the north Caucasus or the fringes of north Iran, all areas where the arrival of farming skills dates to around the time of its coming into existence. Its brother clade M269 is a little younger still and most of that is really L23. The date of the latter c. 3500BC is very similar to that of Maykop as well as some other steppe cultures. I think both remained relatively close together. M73 IMO though could not have been any further west than the Caucasus-east Ukraine area as its absence in the Balkans show it was lacking in steppe groups who moved that way c. 4200BC onwards. I think this is very strong indirect evidence that M73 was at that time still in the north Caucasus or east of Azov etc on the steppes. However, we also know that there was a 10000 year long cultural watershed around the Urals before it was breached until the 4th millenium. M73 also could not have headed east before its existence c. 5000BC. So, Afanasievo c. 3400BC as the first west-east thrust into central Asia seems to me to have been at just the right date to carry newly formed L23 and M73 elements east.

The archaeological evidence that this is possible is the cauldron of mixing in the western steppes after 4000BC, the late Maykop expansion into the east Ukraine and south Russian steppe, the hybrid groups like Konstatinovka, the sudden appearance of Maykop type CMP metallurgical and mining knowledge in the south Urals at Kargaly etc. The spread of the wheel, the idea off mega Kurgans, possibly wooly sheep, metallurgy etc that appeared first in Maykop before it was taken up by Yamnaya etc. This could have involved M73 and L23 or perhaps they were really steppe groups themselves. I particularly think M73 was involved in Afanasievo albeit as a minority player among mainly R1a groups. If I had to guess I think M73 and L23 elements were involved at Kargaly c. 3500BC and a section of them may have headed east from the Urals eastwards, especially M73.

M269 on the other had seems to have headed largely west although not exclusively. Its harder to pinpoint in exactly what cultural guise though because the western steppes in particular was a real melting pot of cultures and probaby of peoples of multiple origins (steppe, farmers, Maykop). However its age and its good showing in the Balkans (both M269 and L23) is bang on the time when steppe cultures were arriving there. Steppe elements were the only fresh groups in the Balkans at the period when M269 and L23 (the main R1b clades there) are dated to. It almost seems crazy not to correlate brand new clades c. 4000-3500BC in age (with no older local older forms) arriving in the Balkans at exactly the same date as archaeology shows the sudden intrusion of steppe groups into an area where farmers had been located for thousands of years. I just see no other option. The real problem is that before this era M269 and L23 did not exist anywhere before 4000BC so looking for a trail before that is pointless. It is even possible that their very coming into existence (expanding to a level where they formed surviving branches) is related to the slight improvement in climate after 3800BC and/or their arrival in the Balkans. In the period prior to this the M269 and L23 SNPs had not occurred and their pre-4000BC ancestors would have been P297* across the entire period from 9000BC until 4000BC and no remnanats of that phase exist anywhere in the world today. That last fact is testament to a background outside the sophisticated expanding farming cultures until 4000BC.

alan
07-16-2013, 12:40 AM
I think the main point that I dont want lost in my long post is that M269 and L23 are clades of c. 4000-3500BC and appear in the Balkans at a time when steppe intrusions date to that very period. Both R1b and steppe intrusions appear in the Balkans at the same time. Neither has ancestors there - there is virtually nothing above M269 in the Balkans. This is significant in the Balkans given that they were settled by massively expansive farming groups for 2000 years before that. So, it seems clear that M269 and L23 were new arrivals from somewhere a lot less condusive to major growth and expansion. The match is very striking with the steppe movements. People may ask where is the trail but those clades had only come into existence around the very time of the steppe movements so they wont have left much of those clades behind. The ancestor P297* which was M269's ancestor from 9000BC to 4000BC doesnt exist anywhere so there is no pre-4000BC trail for this lineage or its pre-SNP ancesors anywhere on earth. Surely a steppe location is a far better fit for a lineage that struggled just to replicate itself from 9000-4000BC than in the bustling farming societies of the Balkans or SW Asia.

Palisto
07-16-2013, 08:48 AM
It will be interesting to see their YSC224 now that Raza will be tested for P25 and, if he will be positive, these Asian R-M343 will belong to a different line as to the Western European one.

What do think what these two individuals from East-Kazakhstan are (Tarlykov et al., 2013)?
http://www.ncbi.nlm.nih.gov/pubmed/23444242


R1b?
DYS393 DYS390 DYS19 DYS391 DYS385a DYS385b DYS439 DYS389i DYS392 DYS389ii DYS458 DYS437 DYS448 Y-GATA-H4 DYS456 DYS438 DYS635

9 23 14 11 11 14 12 12 12 30 14 15 19 10 13 15 24 (Prediction: R1b1b2-M269 88%)
10 23 14 11 11 14 12 12 12 30 14 15 19 12 16 12 24 (Prediction: R1b1b2-M269 97%)

The DYS393 values seem to to be odd, never seen so low values for it.

DMXX
07-16-2013, 10:42 AM
DYS393=9/10 isn't particularly strange - Uncommon, but not strange. DYS393's range is shown to be from 8-17.

Regardless, both of these samples are most likely R1b. I've covered their data in an unpublished blog entry already. There are some interesting uncommon subclades among the eastern Kazakh.

newtoboard
07-16-2013, 11:43 AM
Once again connecting this R1b to Afanasievo is based on wishful thinking. It doesn't mirror Afanasievo for the reasons mentioned above. Its distribution in Central Asia is Western, isn't really found in the vicinity of Afanasievo as DMXX mentioned and hasn't been found in any Afanasievo samples. Nor is it found in NW south Asia which is what you would expect if it has anything to do with Afanasievo. Writing long posts about archeology and climate doesn't change any of that.

Rathna
07-16-2013, 01:28 PM
R1b?

DYS393 DYS390 DYS19 DYS391 DYS385a DYS385b DYS439 DYS389i DYS392 DYS389ii DYS458 DYS437 DYS448 Y-GATA-H4 DYS456 DYS438 DYS635
9 23 14 11 11 14 12 12 12 30 14 15 19 10 13 15 24 (Prediction: R1b1b2-M269 88%)
10 23 14 11 11 14 12 12 12 30 14 15 19 12 16 12 24 (Prediction: R1b1b2-M269 97%)

My response:
1) We use SNPs just for being sure what we are speaking about and to recognize the true outliers. Now we are operating with Geno 2.0 and next with the Full Y.
2) These haplotypes are strange and the prediction increases its percentage of R1b in the second haplotype because it is closer to the usual values as to the former: DYS393=10 instead of 9 is closer to 13 (or better to 12) and DYS438=12 (the modal) is closer than 15.
3) It is strange that these haplotypes coincide in many values and differ in very slow mutators like just DYS438. We should think to multistep mutations rather than mutations one-step, but these should have happened many times, also for DYS393 from 13 (or better from 12) to 10 and DYS456 etc.
4) They could be R1b-subclade, but also many other linked haplogroups. Of course it would be interesting a SNP test.

Palisto
07-16-2013, 01:36 PM
DYS393=9/10 isn't particularly strange - Uncommon, but not strange. DYS393's range is shown to be from 8-17.

Regardless, both of these samples are most likely R1b. I've covered their data in an unpublished blog entry already. There are some interesting uncommon subclades among the eastern Kazakh.

Let me rephrase it: The low DYS393=9,10 values don't exist in FTDNA R1b individuals (95% of them with European ancestry), I have never seen such low values for DYS393 in the entire FTDNA R1b database (more than 5000 individuals). Thus, a paternal European ancestry can be excluded for R1b individuals with DYS393=9,10; there must be some non-European R1b subclades in Asia assuming these two individuals from East-Kazakhstan are indeed R1b.

Rathna
07-16-2013, 02:06 PM
Let me rephrase it: The low DYS393=9,10 values don't exist in FTDNA R1b individuals (95% of them with European ancestry), I have never seen such low values for DYS393 in the entire FTDNA R1b database (more than 5000 individuals). Thus, a paternal European ancestry can be excluded for R1b individuals with DYS393=9,10; there must be some non-European R1b subclades in Asia assuming these two individuals from East-Kazakhstan are indeed R1b.

Do you want to know my idea? These are the two lines of descent of a very old and powerful R-L23 (probably of Caucasian descent) who liked, also in his 90th, to do those things!

jdean
07-16-2013, 02:41 PM
Let me rephrase it: The low DYS393=9,10 values don't exist in FTDNA R1b individuals (95% of them with European ancestry), I have never seen such low values for DYS393 in the entire FTDNA R1b database (more than 5000 individuals). Thus, a paternal European ancestry can be excluded for R1b individuals with DYS393=9,10; there must be some non-European R1b subclades in Asia assuming these two individuals from East-Kazakhstan are indeed R1b.

5000 STR results isn't very many really, FTDNA have almost 1/5 a million : )

After a quick scout about I found one DYS393=9 in the U152 project and a 10 in the Cumberland Gap project.

Palisto
07-16-2013, 03:54 PM
5000 STR results isn't very many really, FTDNA have almost 1/5 a million : )

After a quick scout about I found one DYS393=9 in the U152 project and a 10 in the Cumberland Gap project.

So, assuming that only 10% (this is an obvious underestimation) of all tested FTDNA individuals are R1b, you found 2 out of 20,000 with DYS393=9,10, so the current frequency of R1b DYS393=9,10 at FTDNA is 2/20,000=0.01%. Would you agree that this frequency is basically zero?

Contrary, in East-Kazakhstan the frequency of R1b DYS393=9,10 seems to be 2 out 2, so the current frequency in East-Kazakhastan is 100%.

The two individuals from Europe that you found are:
Eu01: 10 24 15 10 11 14 13 13 13 30 (N63450 Maynard Unknown Origin R1b1a2)
Eu02: 09 23 14 11 11 16 14 13 13 29 17 15 19 11 15 12 (E8003 Jean Quiclet, b. 1633, Versailles France R1b1a2a1a1b3)

The two individuals from East-Kazakhstan:
As01: 09 23 14 11 11 14 12 12 12 30 14 15 19 10 13 15 24
As02: 10 23 14 11 11 14 12 12 12 30 14 15 19 12 16 12 24

I don't see any big similarities between these European and Asian haplotypes.
Eu01 vs As01: 7/10 (=70%)
Eu01 vs As02: 6/10 (=60%)
Eu02 vs As01: 9/16 (=56%)
Eu02 vs As02: 9/16 (=56%)

Eu01 vs Eu02: 7/10 (=70%)
As01 vs As02: 4/17 (=24%)

Given the current frequencies, in Europe DYS393=9,10 seems to be a characteristic of extreme outliers of R1b; in East-Kazakhstan it seems to be a characteristic of a new branch of R1b.

jdean
07-16-2013, 04:28 PM
So, assuming that only 10% (this is an obvious underestimation) of all tested FTDNA individuals are R1b, you found 2 out of 20,000 with DYS393=9,10, so the current frequency of R1b DYS393=9,10 at FTDNA is 2/20,000=0.01%. Would you agree that this frequency is basically zero?

Contrary, in East-Kazakhstan the frequency of R1b DYS393=9,10 seems to be 2 out 2, so the current frequency in East-Kazakhastan is 100%.

The two individuals from Europe that you found are:
Eu01: 10 24 15 10 11 14 13 13 13 30 (N63450 Maynard Unknown Origin R1b1a2)
Eu02: 09 23 14 11 11 16 14 13 13 29 17 15 19 11 15 12 (E8003 Jean Quiclet, b. 1633, Versailles France R1b1a2a1a1b3)

The two individuals from East-Kazakhstan:
As01: 09 23 14 11 11 14 12 12 12 30 14 15 19 10 13 15 24
As02: 10 23 14 11 11 14 12 12 12 30 14 15 19 12 16 12 24

I don't see any big similarities between these European and Asian haplotypes.
Eu01 vs As01: 7/10 (=70%)
Eu01 vs As02: 6/10 (=60%)
Eu02 vs As01: 9/16 (=56%)
Eu02 vs As02: 9/16 (=56%)

Eu01 vs Eu02: 7/10 (=70%)
As01 vs As02: 4/17 (=24%)

Given the current frequencies, in Europe DYS393=9,10 seems to be a characteristic of extreme outliers of R1b; in East-Kazakhstan it seems to be a characteristic of a new branch of R1b.

To be honest I only brought it up to show these weren't impossible low figures for R1b, I'm not one for trying to prove commonality based on one or two shared values, we can safely leave that to others : )

Nor do I think it likely this could explained by a back migration of a secret European cluster !!

alan
07-16-2013, 04:41 PM
Once again connecting this R1b to Afanasievo is based on wishful thinking. It doesn't mirror Afanasievo for the reasons mentioned above. Its distribution in Central Asia is Western, isn't really found in the vicinity of Afanasievo as DMXX mentioned and hasn't been found in any Afanasievo samples. Nor is it found in NW south Asia which is what you would expect if it has anything to do with Afanasievo. Writing long posts about archeology and climate doesn't change any of that.

Well to simplify, the two P297 M73 and M269 are no older than 4-5000BC. The oldest clade is M73 basically runs from the Dniester to central Asia and is even today absent in the early farming zone as SW Asia and the Balkans. In the Caucasus it is only known on the northern side among turkic peoples. M269 (mainly L23) expanded about 4000 later than the farming expansion that effected SW Asia and eastern Anatolia and 2000 years later than Balkans farmers. These clades appear fresh in the Balkans with no upstream forms pre-dating 4000BC. There is not a single person on the P297* line that filled the period from 9000BC to 4 or 5000BC. The position of P297 must have been very marginal and in a zone of very late access to developed farming etc.

I am not commited to any particular culture or exact spot. I have just speculated about Maykop as it is a good fit. I also dont want to get bogged down in the Afanasievo idea. I could just as easily say that the main target of these peoples was the ural copper sources c. 3500BC. There are a lot of options and I dont want to lose my main point by plumping for detail that cannot be obtained.

My main point is that there were a myriad of cultures who recieved farming tentatively and late between the Danube mouth and the Urals between 9000BC and 4-5000BC. That zone contains by far the largest block of cultures where farming took off late. We see new cultures suddenly expand into the Balkans at the very same age as clades like M269 and L23 c. 4000-3500BC. The only other area where the dates might fit is north Iran.
I think you are underestimating the enormous myriad of cultures in the huge zone between the Dniester, the Urals and the Caucasus/NW Iran.

I think too that one lineage might turn left, another right etc and any sort of pattern is possible. We must not lose sight of the fact that much R1b and R1a is descended from just a few men living in the period 5000-3000BC. Virtually all European men other than M73 folks are descended from just one man living around 4000BC according to variance calculations and indeed 90-odd % if them of them are descended from one Mr L23 man living a few centuries later. As far as I can see from the posted tree, the same if true of R1a. We are just talking about a few men in that era. There is virtually no remnants left of the history of those clades pre-4 or 5000BC. So we have no evidence of distribution before that. A few men c. 4000BC could be in any culture and there is no way of ever finding them in ancient DNA without the most crazy luck.

The only solid clue really is the expansion date. Both R1a and R1b overwhelmingly relate to a few lucky men of the core period where both haplogroups seem to have risen from virtually nothing. I really cannot understand how anyone can look at the ages of main R1b clades and not see the strong similarity to R1a and massive mismatch that these dates have with a more southerly location in the early farming world.

When you boil it down to most R1a and R1b folks being descendants of just a few men in the age of the early big steppe migrations then it can be readily understood why modern distribution is bordering on meaningless except perhaps on a very macro-scale. A few men could randomly end up virtually anywhere.

newtoboard
07-23-2013, 12:57 PM
Is there any chance of a migration from the West Caspian explaining why these lineages seem closer to Caucasian R1b than Iranian/Kurdish R1b?

Mikewww
07-23-2013, 10:56 PM
Is there any chance of a migration from the West Caspian explaining why these lineages seem closer to Caucasian R1b than Iranian/Kurdish R1b?

On post #29, I commented that these (Zerjal ht's) looked like R1b-L23xL51 which is what we find around the Caucasus and in Anatolia and in the Balkans. This is in contrast to the rarer R1b M269- as well as L23- that we can find in Iran.

... I downloaded your data stored under "Zerjal et al. Raw Data" and resorted the STR columns and haplotypes to compare with the R1b-M343xU106xP312 file I have.

I'd be surprised if all of the Zerjal et al predicted M269 or M343 were not R1b-L23xL51. They look like the rest of L23xL51. ...
I don't know which direction they came from but apparently not any further west than Eastern Europe

I really don't know how the probable L23 got there but DMXX and Alan have as plausible an answer as any.

Back on post #8 and the vicinity.

One possible interpretation I'll post here rather than in my work (I prefer remaining completely objective on my blog); the better matching in the Caucasus of the Central Asian haplotype rather than among Iranians or Kurds supports it coming around the Caspian in a clockwise (above the Caspian) rather than anticlockwise (below the Caspian). Of course, this compliments Jean's hypothesis of R1b-M269 arriving with some early Indo-Europeans quite well, but I'd personally want to see and compare with data from the Yakut and Xinjiang before hedging my bets....


I take it that this central Asian haplogroup is an L23XL51 one? I think the idea that the eastern leg of L23 moved clockwise north of the Caspian from somewhere nearer the Caucasus on its eastern travels makes a lot of sense.
...
i would also add (as per my thread) that L23XL51 appears from a recent paper to be found in much higher frequencies on the northern side of the Caucasus (albeit patchy) than the south with the exception of the Armenians. That would also fit the clockwise northern passage around the Caspian Sea.

If instead you are inquiring about the rarer, earlier branching forms of R1b in Iran then my only speculation is that maybe Vince Vizachero's Hg R dispersion chart is right (as it relates to the very early branching of R1b.)

alan
07-27-2013, 01:03 PM
This is an old study but R1b (known as haplogroup 1 in this study) does have a presence throught central asia although it varies

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC419996/

The most useful items are the table and map

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC419996/figure/FG2/

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC419996/table/TB3/

Very small samples pre group though.

newtoboard
07-27-2013, 03:31 PM
I believe in the discussion of Central Asian R1b on the old Dnaforums.org Jewish ancestry was raised as a possibility. The highest STR matching with Caucasians seems to rule that out. I think it is unlikely that Central Asian R1b has a Neolithic origin though. So what else could account for it? I doubt any migrations from the North were involved. Maybe the Silk Road has something to do with it.

alan
07-27-2013, 05:14 PM
I believe in the discussion of Central Asian R1b on the old Dnaforums.org Jewish ancestry was raised as a possibility. The highest STR matching with Caucasians seems to rule that out. I think it is unlikely that Central Asian R1b has a Neolithic origin though. So what else could account for it? I doubt any migrations from the North were involved. Maybe the Silk Road has something to do with it.

i do not see how that follows. I dont understand why it needs interpreted that way. M73 is only known on the north part of the Caucasus in a recent study and is all but unknown in Iran according to another recent study. It also is virtually unknown is SW Asia and old Europe west of the Ukraine. Yet it is known from the Ukraine to China across the steppe and is strong around the Urals in pre-Russian populations and has clearly been absorbed in Turkic populations as far east as the fringes of China. It dates from around 5000BC shares an ancestor with M269 back in 9000BC which would need explained. I think the most parsimonious explanation is that it was within a group in or close to the east end of the western steppe or north Caucasus and expanded east as far as China only to be absorbed and moved about by some Turkic groups. That sounds like Afansievo to me, given that it is not linked to Iranic groups on the whole.

I think the evidence best fits central Asian R1b flowing from a clockwise move from the north Caucasus and adjacent steppe. M73 is particularly early, the earliest known significant R1 clade largely found in the zone between the western steppe and China. A move east from that sort of area c. 3500BC could easily be accomodated by the archaeological evidence. We known CMP metallurgical and mining methods had reached the Urals around that time so it was in a good position for elements to be absorbed into the Afanasievo culture. Even today it is particulary strong in the Urals and the Bashkirs even owned the Kargaly early mine site until relatively recent times.

newtoboard
07-27-2013, 05:36 PM
i do not see how that follows. I dont understand why it needs interpreted that way. M73 is only known on the north part of the Caucasus in a recent study and is all but unknown in Iran according to another recent study. It also is virtually unknown is SW Asia and old Europe west of the Ukraine. Yet it is known from the Ukraine to China across the steppe and is strong around the Urals in pre-Russian populations and has clearly been absorbed in Turkic populations as far east as the fringes of China. It dates from around 5000BC shares an ancestor with M269 back in 9000BC which would need explained. I think the most parsimonious explanation is that it was within a group in or close to the east end of the western steppe or north Caucasus and expanded east as far as China only to be absorbed and moved about by some Turkic groups. That sounds like Afansievo to me, given that it is not linked to Iranic groups on the whole.

I think the evidence best fits central Asian R1b flowing from a clockwise move from the north Caucasus and adjacent steppe. M73 is particularly early, the earliest known significant R1 clade largely found in the zone between the western steppe and China. A move east from that sort of area c. 3500BC could easily be accomodated by the archaeological evidence. We known CMP metallurgical and mining methods had reached the Urals around that time so it was in a good position for elements to be absorbed into the Afanasievo culture. Even today it is particulary strong in the Urals and the Bashkirs even owned the Kargaly early mine site until relatively recent times.

I was referring to the M269 not the M73. Its unlikely the M269 came from North prior to Indo-Iranians (who didn't bring R1b either) since none of this Central Asian R1b expanded into South Asia. The Indo-Aryans had more native Central Asian elements than Iranian speakers probably because they migrated first. It seems clear from that this M269 in Central Asia is not older than the Indo-Aryan migration.

I'm still not buying the Afansievo explanation for M73. The few Afansieveo and Tarim Basin samples have been R1a. Nor is M73 found in South Asia, Afghanistan, or Tajikistan (except in Turkic groups) which is where you would expect some given the expansions from the Tarim into these areas (the Kushan empire is a good example).

Silesian
07-27-2013, 06:22 PM
i do not see how that follows. I dont understand why it needs interpreted that way. M73 is only known on the north part of the Caucasus in a recent study and is all but unknown in Iran according to another recent study. It also is virtually unknown is SW Asia and old Europe west of the Ukraine. Yet it is known from the Ukraine to China across the steppe and is strong around the Urals in pre-Russian populations and has clearly been absorbed in Turkic populations as far east as the fringes of China. It dates from around 5000BC shares an ancestor with M269 back in 9000BC which would need explained. I think the most parsimonious explanation is that it was within a group in or close to the east end of the western steppe or north Caucasus and expanded east as far as China only to be absorbed and moved about by some Turkic groups. That sounds like Afansievo to me, given that it is not linked to Iranic groups on the whole.

I think the evidence best fits central Asian R1b flowing from a clockwise move from the north Caucasus and adjacent steppe. M73 is particularly early, the earliest known significant R1 clade largely found in the zone between the western steppe and China. A move east from that sort of area c. 3500BC could easily be accomodated by the archaeological evidence. We known CMP metallurgical and mining methods had reached the Urals around that time so it was in a good position for elements to be absorbed into the Afanasievo culture. Even today it is particulary strong in the Urals and the Bashkirs even owned the Kargaly early mine site until relatively recent times.


I wonder if the samples R1b L23x51 showing up in Pakistan and India Bengal, are connected with the Bashkirs? It would be nice to now at least what snps they were tested for.

Bashkirs DNA & Suyun projects
http://www.familytreedna.com/public/Bashqort_Clans/default.aspx?section=yresults
India subcontinent DNA Project (incl. India, Pakistan,Bangladesh,Nepal,Bhutan) - Y-DNA Classic Chart
http://www.familytreedna.com/public/India/default.aspx?section=yresults

I also find intriguing the study of Volga Bulgars who are situated adjacent the Bashkirs.
https://upload.wikimedia.org/wikipedia/commons/d/da/Bulgaria_800ad.jpg

The Bulgars (also Bolgars, Bulghars, Proto-Bulgarians,[1] Huno-Bulgars[2]) were a semi-nomadic people who flourished in the Pontic Steppe and the Volga basin in the 7th century. Ethnically, the Bulgars are thought to have been Oghur Turkic,[3][4][5][6][7][8][9][10][11][12][13] with Scytho-Sarmatian[14][15] and Sarmatian-Alan[16][17] elements.

http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0056779

Razgrad, [J1-0%]-[J2-4.8%]-[R-M58-9.5%]-[R-L23*-14.3%]

Ragrad was built upon the ruins of the Ancient Roman town of Abritus on the banks of the Beli Lom river. Abritus was built on a Thracian settlement of the 4th-5th century BC with unknown name.

Another interesting element is the Assyrian sample in the Grugni survey showing 10.8% R1a1a* and the 15.4 %R1b-M269* in the Tehran Zoroasterian sample.

alan
07-27-2013, 07:01 PM
I was referring to the M269 not the M73. Its unlikely the M269 came from North prior to Indo-Iranians (who didn't bring R1b either) since none of this Central Asian R1b expanded into South Asia. The Indo-Aryans had more native Central Asian elements than Iranian speakers probably because they migrated first. It seems clear from that this M269 in Central Asia is not older than the Indo-Aryan migration.

I'm still not buying the Afansievo explanation for M73. The few Afansieveo and Tarim Basin samples have been R1a. Nor is M73 found in South Asia, Afghanistan, or Tajikistan (except in Turkic groups) which is where you would expect some given the expansions from the Tarim into these areas (the Kushan empire is a good example).
s
There are no actual Afanasievo samples, just later Tarmin groups. They are also from just a couple of cemeteries and in this period they tend to be family ones. So, on that basis I wouldnt rule M73 out. The fact it is Turkic groups all the way to China and back to the Caucasus tells us it had reached very far east before peoples started reverse movements back west. i dont think its lack in Indo-Iranian groups is significant as noone is claiming involvement in this so its going to end up in Turkic groups almost by default. If its absent in the south Caucasus, Iran, SW Asia, Old Europe, south Asia, Afghanistan etc I dont really see how a southern route fits at all. I am by no means saying it has to have been in Afanasievo but I think it took a similar route. As I have outlined in detail in the R general thread on R1, a lot went on in the Caspian area in the early days of R1a and b from 150000-10000BC so we shouldnt expect one story to fit all clades of R1b and even the ancestors of M73 and M269 may have put some distance between them.

newtoboard
07-27-2013, 09:42 PM
s
There are no actual Afanasievo samples, just later Tarmin groups. They are also from just a couple of cemeteries and in this period they tend to be family ones. So, on that basis I wouldnt rule M73 out. The fact it is Turkic groups all the way to China and back to the Caucasus tells us it had reached very far east before peoples started reverse movements back west. i dont think its lack in Indo-Iranian groups is significant as noone is claiming involvement in this so its going to end up in Turkic groups almost by default. If its absent in the south Caucasus, Iran, SW Asia, Old Europe, south Asia, Afghanistan etc I dont really see how a southern route fits at all. I am by no means saying it has to have been in Afanasievo but I think it took a similar route. As I have outlined in detail in the R general thread on R1, a lot went on in the Caspian area in the early days of R1a and b from 150000-10000BC so we shouldnt expect one story to fit all clades of R1b and even the ancestors of M73 and M269 may have put some distance between them.

I was talking more about my doubts on M269 in Central Asia having a Northern route (if it does have a Northern route it likely the same as M73). I agree with you M73 did not have a southern route. I don't agree with its Afanasievo connection because of Afansievo-->Tarim--> South Central Asia + India path of migration doesn't support it R1b M73 playing a major part in Afanasievo nor do the Tarim Y-DNA results showing the presence of R1a. M73 could have been a minor lineage that ended up in the Altai/Western Mongolia while having nothing to do with Tocharians and then expanded with Turks. In fact that seems very likely.

Humanist
07-27-2013, 10:49 PM
Another interesting element is the Assyrian sample in the Grugni survey showing 10.8% R1a1a* and the 15.4 %R1b-M269* in the Tehran Zoroasterian sample.

Our overall frequency of R1a is very low (~2%). There is a possibility that these are Iranian converts to the church. Before the Islamic Revolution (and even after!), this occasionally occurred.

Edit:


5/31/2013

Iranian authorities continue to pressure churches of Armenian or Assyrian heritage to cancel all services in the Farsi language, or face permanent closure.

Pastor Robert Asseriyan was arrested on May 21, two days after the church refused to voluntarily terminate its Farsi services. He is being held in Tehran’s notorious Evin prison.

Source: http://www.charismanews.com/world/39695-after-pastor-s-arrest-iranian-authorities-threaten-to-close-pentecostal-church

Joe B
07-27-2013, 11:36 PM
I wonder if the samples R1b L23x51 showing up in Pakistan and India Bengal, are connected with the Bashkirs? It would be nice to now at least what snps they were tested for.
India subcontinent DNA Project (incl. India, Pakistan,Bangladesh,Nepal,Bhutan) - Y-DNA Classic Chart
http://www.familytreedna.com/public/India/default.aspx?section=yresults

So many possibilities for L23x51. Just look at Kolkata and you can find Armenian and Baghdad Jewish communities not to mention Greek and Parsi too. Ethnic communities in Kolkata (http://en.wikipedia.org/wiki/Ethnic_communities_in_Kolkata) according to wikipedia has a list.
I'm not disagreeing that Bashkirs could be part of it, just our clade has many funky layers.
More SNPs:beerchug:

alan
07-28-2013, 12:22 AM
I wonder if the samples R1b L23x51 showing up in Pakistan and India Bengal, are connected with the Bashkirs? It would be nice to now at least what snps they were tested for.

Bashkirs DNA & Suyun projects
http://www.familytreedna.com/public/Bashqort_Clans/default.aspx?section=yresults
India subcontinent DNA Project (incl. India, Pakistan,Bangladesh,Nepal,Bhutan) - Y-DNA Classic Chart
http://www.familytreedna.com/public/India/default.aspx?section=yresults

I also find intriguing the study of Volga Bulgars who are situated adjacent the Bashkirs.
https://upload.wikimedia.org/wikipedia/commons/d/da/Bulgaria_800ad.jpg


http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0056779

Razgrad, [J1-0%]-[J2-4.8%]-[R-M58-9.5%]-[R-L23*-14.3%]


Another interesting element is the Assyrian sample in the Grugni survey showing 10.8% R1a1a* and the 15.4 %R1b-M269* in the Tehran Zoroasterian sample.

I didnt notice that M269 frequency. Very interesting.

newtoboard
01-16-2014, 03:24 AM
Hopefully we can get some more information on these samples with the Yamnaya study coming out soon. My hunch is these R1b's might be IE in origin but are definitely not related to the spread of IE language to South Central Asia.

RCO
01-16-2014, 03:39 PM
Lippold
Supplementary Information
Human paternal and maternal demographic histories:
insights from high-resolution Y chromosome and mtDNA sequences
HGDP tree
(Fig 13)
Hazara R1b1b1
Uyq1299 R1b1
Sar1067 R1b1
Moz1261 R1b1
Moz1271 R1b1

http://biorxiv.org/content/biorxiv/suppl/2014/01/13/001792.DC1/001792-1.pdf

newtoboard
01-17-2014, 02:00 AM
Lippold
Supplementary Information
Human paternal and maternal demographic histories:
insights from high-resolution Y chromosome and mtDNA sequences
HGDP tree
(Fig 13)
Hazara R1b1b1
Uyq1299 R1b1
Sar1067 R1b1
Moz1261 R1b1
Moz1271 R1b1

http://biorxiv.org/content/biorxiv/suppl/2014/01/13/001792.DC1/001792-1.pdf


Were you able to draw any conclusions based on this?

RCO
01-17-2014, 04:26 AM
The R1b (or R* R2) basal branches still can be found almost exclusively in Central Asia and the European group is just a portion/subset of the tree, so Central Asian R1b preexists as the title of the thread !.

alan
01-17-2014, 07:04 AM
I dont have the answer but somehow the contrasting distribution of M269 and M73 needs explained as they are by far the closest R1b branches phylogenically to each other. Its not easy to explain this in a truly convincing way although there are many options. The fact M73 is rare in Europe, SW Asia, Iran etc IMO forces us to look towards the steppes or west-central Asia to understand this fairly close brother of M269. On the other hand M269 is most common in Europe and SW Asia. They clearly distanced themselves from each other at some point in their shared P297* period perhaps c. 10000-5000BC give or take a millenia or two but no trace of that phases exists.

I think the lack of P297* and the contrasting distributions of M73 and M269 are a clue that this distancing could be old and the location somewhat peripheral to the first 2000 years or so of farming. I dont really see evidence of a move east from the steppes INTO west central Asia prior to Afanasievo (and I have gone off pushing a link with that culture). That just does not seem to have happened. I considered the whole Jeitun culture angle but I cannot make it fit either. It probably is linked to badly dated similar sites in Caspian Iran but I cannot see how the source for M73 can be placed where there isnt any in Iran.

So, at present, based on the suggestion of older dates by the SNP counting method and also based on the somewhat mysterious distribution, I suspect M73 is a relict of the Mesolithic microblade spread west and probably came into being around the south Urals or nearby as microblade cultures passed west. It is possible even, dependent on age, that its distribution could be related to the barrier of the expanded Caspian c. 12000BC which could have forced a movement west to halt or detour and split.

alan
01-17-2014, 09:49 AM
It would also be legitimate to ask if R1a was effected by the swollen Caspian. Did it block its way or cause a detour north to the south Urals to avoid it? Did R1a head west early and therefore take a route no further south than the south Urals because the Caspian lay in the way? Is the ANE in Swedish and NE Europe partly a relic of an early R1a move at a time when the Caspian or other environmental consideration pushed it a little north? Did R1b move later along the shore of the Caspian/Black Sea when this issue had resolved itself - the microblade groups of Ukraine are a little later and seem to follow that sort of trajectory. It would explain a lot if the basic pattern of contrast for R1b and R1a and perhaps even the future contrast between M73 and M269 commenced in the Mesolithic because it is very hard to explain it in later times. It would explain why it has remained rather obscure and resistant to interpretation. It is certainly much easier to understand M73 as actually arising in south Urals and west central Asia after an east to west movement in the Mesolithic than to try and look for a movement west to east or south to north to explain its distribution.

newtoboard
01-17-2014, 02:18 PM
I still believe my pet theory of M73 being the lineage of Pre IE Kazakh Hunter Gatherers will turn out to be correct. Hopefully someone will test Keltiminar or Botai samples one day.

I still see Jeitun as a possibility if P297 arose in the South Caspian and migrated into Central Asia with M73 arising in Turkmenistan and M269 either arising in Europe. But it also might be possible the P297 lineage that stayed in Southwest Asia gave rise to M269.

Rathna
01-17-2014, 02:50 PM
I still believe my pet theory of M73 being the lineage of Pre IE Kazakh Hunter Gatherers will turn out to be correct. Hopefully someone will test Keltiminar or Botai samples one day.

I still see Jeitun as a possibility if P297 arose in the South Caspian and migrated into Central Asia with M73 arising in Turkmenistan and M269 either arising in Europe. But it also might be possible the P297 lineage that stayed in Southwest Asia gave rise to M269.

As no R-P297* has been found so far (and probably it won't be), we should test the previous subclades, and to find amongst the Caucasian R1b1* not only P25+, but also L388/L389+. Indian guys are L25+ but L388/L389-.
Nobody has tested so far any Caucasian, who are registered c/o "R1b1 FTDNA Project" like L389+ but are tested only for P25.
I am saying from many years that R-L389+ have YCAII= 18-22 or 18-23 (present both only in Italy), whereas the Caucasian ones have 21-23 or 23-23.

AJL
01-17-2014, 04:42 PM
It would also be legitimate to ask if R1a was effected by the swollen Caspian. Did it block its way or cause a detour north to the south Urals to avoid it?

The Caspian is almost certainly a key piece of the puzzle. While it swells at times at other times its levels have been quite low, and parts can be walked across in winter.

alan
01-18-2014, 12:44 AM
I think only one or the other of those theories could be true because Jeitun is probably someway related to farmers who arrived via Iran while Botai and Keltiminar are probably derived from central Asian hunters who had ancestors in central Asia since the end of the Palaeolithic. They probably share no common link for 10s of thousands of years back.

You are more likely to be right on the Botai or Keltiminar ideas than Jeitun IMO. I suspect the SNP dating is going to push M73 back into the terminal Palaeolithic period long before Jeitun existed and in that case the lack of M73 in Iran makes it virtually impossible that there is a link to Jeitun. Its far simpler to just see M73 as something that had been in the north-west central Asia/south Urals since the end of the Palaeolithic/Mesolithic and maybe part of a general spread of R1 through central Asia and into the steppe.

One thing I am also beginning to feel is that with SNP dating pushing things back a little in date (although nothing like the Zhiv 3 times fudge) it will emerge that it was geographical position and level of economic development (i.e. late hunting instead of farming) rather than date per se that meant that R1 appears to have contributed little if anything to the early farmers who moved into Europe. I think it will emerge that M73, M269 etc are old enough to have moved with the early farmers c. 6000BC but they simply were not in the correct geography to do so and had not yet adopted farming.



I still believe my pet theory of M73 being the lineage of Pre IE Kazakh Hunter Gatherers will turn out to be correct. Hopefully someone will test Keltiminar or Botai samples one day.

I still see Jeitun as a possibility if P297 arose in the South Caspian and migrated into Central Asia with M73 arising in Turkmenistan and M269 either arising in Europe. But it also might be possible the P297 lineage that stayed in Southwest Asia gave rise to M269.

newtoboard
01-18-2014, 01:35 AM
I was just leaving Jeitun open as a remote possibility. Keltiminar and Botai are more likely IMO. Jeitun is also related with the BMAC and Hissar which would leave us with the problem of why this clade didn't end up in Iran and India when Andronovo tribes started migrating out of Central Asia. Having it in Keltiminar and Botai gets rid of this problem because M73, which probably had low population densities due to its hunter gatherer heritage, could have been pushed off the steppe by Andronovo nomads who probably had a military advantage since chariots seem to have been invented in Sintashta. Of course M73 could represent Tocharians but it's paucity in Europe makes it unlikely IMO. After all there is no reason to assume steppe tribes in a certain region were free of influence from other steppe tribes even though one element was dominant among them. Z93(xZ94) is a minor lineage in the Mediterranean region and among Armenians even though R1b was likely the dominant lineage among those IE speakers. Since Z94 is estimated to have arose very close after Z93 I don't buy the reasoning that this lineage represents Scythian ancestry who come into the picture much later. I expect Poltavka and Abashevo groups to have been dominant in R1a but their Cimmerian descendants likely carried R1B-L23 and I2a-DIN as well. Point is IE groups exerted influence on each other. So I can't explain why M73 didn't end up as a minority lineage among neighboring groups.

newtoboard
01-18-2014, 03:22 AM
It does make sense to see M73 as the Paleolithic/Mesolithic lineage of North Central Asia and R2 as the Paleolithic lineage of South Central Asia and South Asia.