PDA

View Full Version : From R-L150 to R-CTS7822



Pages : [1] 2

kostop
07-11-2013, 12:20 PM
Hi everyone

Last year I got my FTDNA deep clade results: R-L150 and I tested negative for L584.

A few days ago I received results from Geno2 and I am a bit confused.
Apparently I am now R-CTS7822 and on the results page my "branch" does not go beyond L278, not even mentioning R-M269...

Is this just a new classification system, or does this mean I do not belong to Ht 35 anymore?
Apologies if my question sounds silly, but I am not an expert in this field, in fact I have only recently started researching into the subject.
If anyone could point out any sources where I could find out more about R-CTS7822 it would be greatly appreciated.


PS I just realised that there is a "Personal Genetics" page, which seems more appropriate for such queries. Tried to move the post but it does not seem possible.

Rathna
07-11-2013, 02:36 PM
I am seeing you are a Greek. CTS7822 is the same as Z2110, then you are R-L23/Z2110, like the Italian Varipapa, but I have demonstrated he is an Arberesh, thus he comes from the Balkans.
About M269 you should know that it isn't tested by Geno 2.0, but it tests two SNPs on the same level: S3 and S10. I bet that you are positive for these two SNPs.

Anyway, as I am the theorist of the Italian Refugium of hg. R1b1 and subclade, I could say that yours is a subclade of mine: I am R-L23/Z2105+, L227-, L584-, and I suppose Z2110-.

Welcome here.

kostop
07-11-2013, 06:41 PM
I am seeing you are a Greek. CTS7822 is the same as Z2110, then you are R-L23/Z2110, like the Italian Varipapa, but I have demonstrated he is an Arberesh, thus he comes from the Balkans.
About M269 you should know that it isn't tested by Geno 2.0, but it tests two SNPs on the same level: S3 and S10. I bet that you are positive for these two SNPs.

Anyway, as I am the theorist of the Italian Refugium of hg. R1b1 and subclade, I could say that yours is a subclade of mine: I am R-L23/Z2105+, L227-, L584-, and I suppose Z2110-.

Welcome here.

Hi Rathna

Thanks a lot for your response and for the information. It makes sense now.
Today I transferred my results to FTDNA, they should normally be visible tomorrow.

Rathna
07-12-2013, 08:54 PM
Hi Rathna

Thanks a lot for your response and for the information. It makes sense now.
Today I transferred my results to FTDNA, they should normally be visible tomorrow.

Beyond you and Varipapa this SNPs has been tested also in 257843, whose name is now withheld, but I think he comes from Armenia. Then this subclade would be present in the Balkans till Armenia, and this could be interesting. Of course many will think that Balkan people came from Armenia, I, for what I have always supported, the other way around. Anyway this is a subclade of subclades of R-L23*, thus very far from the origin. My subclade (R-L23/Z2105+/L277-/L584-) is closer. Of course only the test of all the SNPs from Z2103 to Z2110 (and others to come) will respond our questions.

Joe B
07-16-2013, 02:03 AM
Today I transferred my results to FTDNA, they should normally be visible tomorrow.

Hi Kostop,
Are you the same as kit #N98739 with the unique DYS393=11 and has tested L584-?

I think we are up to six CTS7822+ kits.
257843 Jewish DNA Project ungrouped
247019 R1b1a2 (P312- U106-) DNA Project
N29277 Italy Project
N114393 White Surname Project STRs?
N115176 Greek Arcadia Project STRs?
N115142 German Project STRs?

Anybody know if and when FTDNA will offer this as a SNP test? Ratha, should we be thinking about taking that test?

Mike, this is a good thread with a great title. Could you move it to to the R1b Early Subclades sub-forum so we don't loose it?

Rathna
07-16-2013, 06:06 AM
Hi Kostop,
Are you the same as kit #N98739 with the unique DYS393=11 and has tested L584-?

I think we are up to six CTS7822+ kits.
257843 Jewish DNA Project ungrouped
247019 R1b1a2 (P312- U106-) DNA Project
N29277 Italy Project
N114393 White Surname Project STRs?
N115176 Greek Arcadia Project STRs?
N115142 German Project STRs?

Anybody know if and when FTDNA will offer this as a SNP test? Rathna, should we be thinking about taking that test?

Mike, this is a good thread with a great title. Could you move it to to the R1b Early Subclades sub-forum so we don't loose it?

I have searched so long who was 257843, and I explored the Jewish pool, but his name is withheld. Unfortunately many people hide their origin, and this is the worst thing for our research. We don't know if he is a Jew or if he claims to be, but to find this SNP amongst them isn't unexpected, but often these Jewish R1b are oriented to the Balkans like an origin.
You ask me if we should do this test. Of course, because only excluding that we are positive, we may continue to think that these haplotypes are derived from ours. I'd say that we should do all the SNPs from Z2106 to Z2110 and others that will come out next.

Rathna
07-16-2013, 07:05 AM
About 257843, if I said he is probably from Armenia, it is because I understood his surname, of course I withhold for not doing polemics. He is already a subclade of R-Z2110, having the mutation CTS9219+. Then we could say that he is R-CTS9219+ .
Of course it would be important for my theory that the more we go Eastwards from Italy and the more we find subclades of subclades.

kostop
07-16-2013, 08:56 AM
Hi Kostop,
Are you the same as kit #N98739 with the unique DYS393=11 and has tested L584-?

I think we are up to six CTS7822+ kits.
257843 Jewish DNA Project ungrouped
247019 R1b1a2 (P312- U106-) DNA Project
N29277 Italy Project
N114393 White Surname Project STRs?
N115176 Greek Arcadia Project STRs?
N115142 German Project STRs?

Anybody know if and when FTDNA will offer this as a SNP test? Ratha, should we be thinking about taking that test?

Mike, this is a good thread with a great title. Could you move it to to the R1b Early Subclades sub-forum so we don't loose it?

Hi Joe B

Yes, that's me. My DYS393=11 makes it quite difficult to find any matches.. :-)
N98739 was my kit number when I ordered a deep clade test last year.
I was recently assigned a new kit number when I transferred my Geno2 results to FTDNA (I don't have the number handy atm). This may have created some duplicate values. I have emailed FTDNA about this.

Rathna
07-29-2013, 03:02 PM
Now we know from the last results of Geno 2.0 (and see the Morley's spreadsheet) that CTS7822, i.e. Z2110, is an autonomous subclade of R-L23*, on the same plane of Z2103/Z2105, then not a subclade of it.
It's distribution is above all in Eastern Europe (considering Varipapa of Arberesh origin), but we have also a German now: Stoltz. But also Ware is CTS7822+, and he has been put in this subclade of the presumed R-L23/L150-, where not all are -: Ware is L150+. Then this should be a subclade of R-CTS7822+. Which form a cluster of these haplotypes is above all DYS434=10 (only one has 9), whereas all the other R-L23 have 9 and R-L584+ has 8. This is a very slow mutating marker.
We don't understand the formation of this subclade: if for a presumed L150- (actually only Romitti and Seymour have it), or for the CTS7822+. I made the hypothesis that for their surnames they could be of Gypsy origin. Of course a R-L23 introgressed in them and not original from India.
We know that 257843, 282121, N114224, N92413 are a subclade of R-CTS7822 for their CTS9219+.

TigerMW
07-29-2013, 05:52 PM
Now we know from the last results of Geno 2.0 (and see the Morley's spreadsheet) that CTS7822, i.e. Z2110, is an autonomous subclade of R-L23*, on the same plane of Z2103/Z2105, then not a subclade of it.
It's distribution is above all in Eastern Europe (considering Varipapa of Arberesh origin), but we have also a German now: Stoltz. But also Ware is CTS7822+, and he has been put in this subclade of the presumed R-L23/L150-, where not all are -: Ware is L150+. Then this should be a subclade of R-CTS7822+. Which form a cluster of these haplotypes is above all DYS434=10 (only one has 9), whereas all the other R-L23 have 9 and R-L584+ has 8. This is a very slow mutating marker.
We don't understand the formation of this subclade: if for a presumed L150- (actually only Romitti and Seymour have it), or for the CTS7822+. I made the hypothesis that for their surnames they could be of Gypsy origin. Of course a R-L23 introgressed in them and not original from India.
We know that 257843, 282121, N114224, N92413 are a subclade of R-CTS7822 for their CTS9219+.

I posted about L23+ Z2103- Z2105- L51- on another thread and Rathna responded, but further discussion on SNP specifics would be off-topic for that thread so I'm quoting the response over here.


This isn't true. See the last Morley's spreadsheet:
No L23* so far, but because it doesn't exist probably. Why? Because also L23* had its mutations. Now we have:

1) Z2103/Z2105
its subclades: L277
L150- (probably not true. If there is Ware, he is L150+ and Z2110+ (=CTS7822+))
CTS7763/CTS8966
CTS1848/PF3449/PF7580
subclade L584 (and other SNPs of Silver etc.)

2) CTS7822
subclade CTS9219
...

Certainly, or at least ultimately, L23* doesn't exist as no paragroup exists permanently except by definition. Sooner or later SNPs will be found to break down the paragroup.

However, increased knowledge of early branching is still helpful.

What kit #s are CTS7822 found in? Do we know those are Z2103- Z2105- or were they just no calls at those locations?

I see that 257843, 282121, N114224, N92413 are their CTS9219+. Do we know what the result was at CTS7822? Were they no-calls? I assume so if you think CTS9219 is a subclade of CTS7822.

P.S. I cut-off the final bit of Rathna's quote because that should probably be taken up in the general category thread on "Rathna's assessment on genetic materials".

R.Rocca
07-29-2013, 06:49 PM
Z2110 is 3 levels down from Z2103/Z2105. Unfortunately Geno 2.0 doesn't test for the two levels between them, so it won't show on Morley's spreadsheet.

Rathna
07-29-2013, 07:05 PM
Unfortunately these people haven't sent their data to Itai Perez and I am not able to enter Genographic database not having had Geno 2.0, but even though it doesn't test Z2103 and Z2105 it tests the equivalent CTS1083 and it is very unlikely that all these people have had a no call, then I think that the tree is this.

Rathna
07-29-2013, 07:36 PM
Unfortunately Itai Perez has two spreadsheets. One gives results for CTS1083 and the other not:

https://www.dropbox.com/s/zv0khjlk6gv6x2m/genorawcompare_view.zip

https://www.dropbox.com/s/725ctjlxg4xcjig/genorawresults_view.zip

Rathna
07-29-2013, 07:55 PM
Romitti and Seymour are certainly Z2103/Z2105+ and cannot be in the same subclade of Ware, who is CTS7822+ and by the Morley's spreadsheet should be in a subclade parallel to Z2103/Z2105.

Rathna
07-29-2013, 08:05 PM
Of course for me (and my theory) that CTS7822 were a subclade of Z2103/Z2105 would be better.

R.Rocca
07-29-2013, 08:24 PM
Unfortunately these people haven't sent their data to Itai Perez and I am not able to enter Genographic database not having had Geno 2.0, but even though it doesn't test Z2103 and Z2105 it tests the equivalent CTS1083 and it is very unlikely that all these people have had a no call, then I think that the tree is this.

CTS1083 is not equivalent to Z2103 or Z2105 and it is found in haplogroup C. Are you sure you typed it correctly?

Joe B
07-29-2013, 08:54 PM
What kit #s are CTS7822 found in?
This is what I have for CTS7822/Z2110, a total of seven kits.

257843 Shomo Shomo Jewish DNA Project ungrouped Unknown R1b1a2a1 CTS7822+, Geno2.0
12 24 14 12 11-14 12 12 12 13 13 29
247019 Ware Peter Ware, b. abt. 1821 (N. Carolina) and d. 1891 Ware Surname Project North Carolina R1b1a2a1 CTS7822+, Geno2.0
12 24 14 11 11-15 12 12 12 13 13 29
N29277 Varipapa Andolino Casimiro Varipapa, b.~1883, Casimiro, IT 39.29, 16.97 Italy DNA Project Italy R1b1a2a1 CTS7822+, Geno2.0
12 24 14 11 11-14 12 12 13 13 13 29
N115176/N98739 Drakopoulos Constantinos Drakopoulos, 1825-1900 see #N98739 Greek Project Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-
11 24 15 11 11-14 12 12 12 13 12 29
N115142 Solt Hanse Casper Soltz, b. 1657 German DNA Project Germany? R1b1a2a1 CTS7822+, Geno2.0 strs?
N114393 White? White Surname Project Unknown R1b1a2a2 CTS7822+, Geno2.0 strs?
N112689 Ilinov No STRs Russia DNA Project R1b1a2a1 CTS7822+, Geno2.0 strs?
Kotsop confirmed that N115176 and N98739 are the same kit and has tested L150+, L23+, L51-, L584-, M269+, P312-, U106-

Joe B
07-29-2013, 09:01 PM
CTS1083 is not equivalent to Z2103 or Z2105 and it is found in haplogroup C. Are you sure you typed it correctly?
I wrote Alice at ISOGG a few weeks back and she kindly removed CTS1083 from the tree. Many are still using CTS1083 on their phylogenetic trees because of that old ISOGG error.
Looking forward to the new snp primers you are working on.

TigerMW
07-31-2013, 01:01 PM
This is what I have for CTS7822/Z2110, a total of seven kits.

257843 Shomo Shomo Jewish DNA Project ungrouped Unknown R1b1a2a1 CTS7822+, Geno2.0
12 24 14 12 11-14 12 12 12 13 13 29
247019 Ware Peter Ware, b. abt. 1821 (N. Carolina) and d. 1891 Ware Surname Project North Carolina R1b1a2a1 CTS7822+, Geno2.0
12 24 14 11 11-15 12 12 12 13 13 29
N29277 Varipapa Andolino Casimiro Varipapa, b.~1883, Casimiro, IT 39.29, 16.97 Italy DNA Project Italy R1b1a2a1 CTS7822+, Geno2.0
12 24 14 11 11-14 12 12 13 13 13 29
N115176/N98739 Drakopoulos Constantinos Drakopoulos, 1825-1900 see #N98739 Greek Project Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-
11 24 15 11 11-14 12 12 12 13 12 29
N115142 Solt Hanse Casper Soltz, b. 1657 German DNA Project Germany? R1b1a2a1 CTS7822+, Geno2.0 strs?
N114393 White? White Surname Project Unknown R1b1a2a2 CTS7822+, Geno2.0 strs?
N112689 Ilinov No STRs Russia DNA Project R1b1a2a1 CTS7822+, Geno2.0 strs?
Kotsop confirmed that N115176 and N98739 are the same kit and has tested L150+, L23+, L51-, L584-, M269+, P312-, U106-

Are one of the R1b-ht35new project administrators gathering and comparing the raw results on these people?

If this is a CTS7822+, it appears quite scattered.

seferhabahir
08-05-2013, 05:52 PM
I see that 257843, 282121, N114224, N92413 are their CTS9219+. Do we know what the result was at CTS7822? Were they no-calls? I assume so if you think CTS9219 is a subclade of CTS7822.

P.S. I cut-off the final bit of Rathna's quote because that should probably be taken up in the general category thread on "Rathna's assessment on genetic materials".

Kit N114224 is not CTS7822+ nor is it CTS9219+ (this is one of the M269xL23 kits and I don't see that any of those are CTS7822+ or CTS9219+ ).

theo
08-28-2013, 02:52 AM
Hi everyone

Last year I got my FTDNA deep clade results: R-L150 and I tested negative for L584.

A few days ago I received results from Geno2 and I am a bit confused.
Apparently I am now R-CTS7822 and on the results page my "branch" does not go beyond L278, not even mentioning R-M269...

Is this just a new classification system, or does this mean I do not belong to Ht 35 anymore?
Apologies if my question sounds silly, but I am not an expert in this field, in fact I have only recently started researching into the subject.
If anyone could point out any sources where I could find out more about R-CTS7822 it would be greatly appreciated.


PS I just realised that there is a "Personal Genetics" page, which seems more appropriate for such queries. Tried to move the post but it does not seem possible.

I am new to this, but I see you are from Greece, possibly from Peloponnese. I too was found to be R-CTS7822 and my family is also from the Peloponnese. I was told that our original last name may have been Markellos (Greek for Marcello). I wonder if our origin is Venetian (when Peloponnese was occupied by the Venetians).

Silesian
08-28-2013, 05:14 AM
I am new to this, but I see you are from Greece, possibly from Peloponnese. I too was found to be R-CTS7822 and my family is also from the Peloponnese. I was told that our original last name may have been Markellos (Greek for Marcello). I wonder if our origin is Venetian (when Peloponnese was occupied by the Venetians).

Here is Greek project. Scroll down to R1b, 2 come from Acadia and 1 from Sparta.
http://www.familytreedna.com/public/Greece/default.aspx?section=yresults

Joe B
08-28-2013, 05:49 PM
I am new to this, but I see you are from Greece, possibly from Peloponnese. I too was found to be R-CTS7822 and my family is also from the Peloponnese. I was told that our original last name may have been Markellos (Greek for Marcello). I wonder if our origin is Venetian (when Peloponnese was occupied by the Venetians).
Welcome Theo!
I'm sure Kostop or others can answer your question.
Have you transfered your Geno2.0 results to FTDNA? If you have, joining the Greek project that Silesian recommended is the way to go. I would just add joining the R1b and Subclades Gateway Project (http://www.familytreedna.com/public/r1b/default.aspx) and the R1b1a2 (P312- U106-) DNA Project (http://www.familytreedna.com/public/ht35new/) would really help you and the project managers do the research.
As was noted by Mike in this thread, CTS7822 is geographically scattered.

kostop
08-29-2013, 05:25 PM
I am new to this, but I see you are from Greece, possibly from Peloponnese. I too was found to be R-CTS7822 and my family is also from the Peloponnese. I was told that our original last name may have been Markellos (Greek for Marcello). I wonder if our origin is Venetian (when Peloponnese was occupied by the Venetians).

Hi Theo and welcome to the R-CTS7822 club :)
Yes, my paternal origin is from Peloponnese as well, specifically from south-east Arcadia. If the stories are true, one of my distant paternal ancestors (circa 1700) lived in a place called Chranoi (Χράνοι) before moving to Leontari and settling there. I have never heard about any Venetian origin in my family. Arcadia is a mountainous area and as far as I understand the Venetians preferred to settle in coastal regions. Besides, most R1b "imported" from Venice shouldn't normally be ofthe Ht35 variety (R-L150 like ours), which is mostly found in Greece, Naples, Calabria, Armenia, Anatolia, etc. Then again you never know...!

ADW_1981
08-30-2013, 03:04 PM
Hi Theo and welcome to the R-CTS7822 club :)
Yes, my paternal origin is from Peloponnese as well, specifically from south-east Arcadia. If the stories are true, one of my distant paternal ancestors (circa 1700) lived in a place called Chranoi (Χράνοι) before moving to Leontari and settling there. I have never heard about any Venetian origin in my family. Arcadia is a mountainous area and as far as I understand the Venetians preferred to settle in coastal regions. Besides, most R1b "imported" from Venice shouldn't normally be ofthe Ht35 variety (R-L150 like ours), which is mostly found in Greece, Naples, Calabria, Armenia, Anatolia, etc. Then again you never know...!

If you examine the FTDNA project, R1b is numerous enough in Greece to not have foreign origins. One could make the same 'foreign' argument for J2b, J2a, or E-V13 for that matter. Why is R1b always the foreigner immigrant from the west, but easterners never move around?

R1b is heavy in southern Greece and former Greek states in western Anatolia.

Silesian
08-30-2013, 05:43 PM
If you examine the FTDNA project, R1b is numerous enough in Greece to not have foreign origins. One could make the same 'foreign' argument for J2b, J2a, or E-V13 for that matter. Why is R1b always the foreigner immigrant from the west, but easterners never move around?

R1b is heavy in southern Greece and former Greek states in western Anatolia.

We just don't have all the results. For example King Tut's results have never been made official; after 3 years? Perhaps his results will never be made official for whatever reason.However there must be some on the team of scientists who are aware what branch of ydna he clusters in.
http://jama.jamanetwork.com/article.aspx?articleid=185393

Eastern R1b did move around. It would be interesting to compare snp's Greek/Dorian/Albanian- R1b with Ossetian/North West Iranian/Balkarians and Jászság, Hungary samples.
http://www.familytreedna.com/public/Ossetian/
http://www.familytreedna.com/public/Jaszsag/default.aspx?section=yresults

kostop
08-30-2013, 07:08 PM
If you examine the FTDNA project, R1b is numerous enough in Greece to not have foreign origins. One could make the same 'foreign' argument for J2b, J2a, or E-V13 for that matter. Why is R1b always the foreigner immigrant from the west, but easterners never move around?

R1b is heavy in southern Greece and former Greek states in western Anatolia.

I never claimed that all R1b in Greece has foreign origins. What I said is that the specific R1b that the Venetians brought to Greece is more likely to be Ht15 rather than Ht35.

kostop
09-07-2013, 07:10 AM
I just came across this site: http://www.semargl.me/en/dna/ydna/haplotypes/table-color/588/ which includes a table highlighting the common DYS values shared among a number of CTS7822 individuals.

Joe B
11-13-2013, 12:22 AM
What information is needed for a project manager to push the SNP request button for CTS7822/Z2110?

A total of ten kits have tested CTS7822+ and seven of those ten tested CTS9219+.

CTS7822*
247019 CTS7822+ N. Carolina, USA str111
N29277 CTS7822+ Italy
N115176/N98739 CTS7822+, L584- Greece**

CTS7822>CTS9219*
257843 CTS7822+, CTS9219+, Z2103+, Z2105+ Unknown/Jewish Project str111
N115142 CTS7822+, CTS9219+ Germany
N114393 CTS7822+, CTS9219+ Unknown/White Surname Project
N112689 CTS7822+, CTS9219+ Russia
N115870 CTS7822+, CTS9219+ France
N116170 CTS7822+, CTS9219+ Greece
278024 CTS7822+, CTS9219+ Poland

12 STR Modal
MIN 11 24 14 10 11-13 12 12 12 12 12 28
MAX 13 25 15 12 11-15 12 12 13 13 13 30
MODE 12 24 14 11 11-14 12 12 12 13 13 29

Page 38 of the Chris Morley experimental computer-generated Y-chromosomal phylogeny (http://ytree.morleydna.com/experimental-phylogeny) clearly shows that CTS7822 could be as important as L584 or L277 to our subclade. That should not be a surprise since Geno 2.0 has identified these kits as CTS7822 from the beginning. The L150 label is from FTDNA.

CTS9219 may be an important SNP under CTS7822 that should be considered too.

A SNP request for our subclade may be buried under an avalanche of SNP requests from our R1b downstream cousins. Ftdna has indicated limited space for new SNPs so it is important submit our request with good justification and early. SNP CTS7822 is showing up in roughly 1/3 or the R1b-L23xL51 Geno 2.0 test kits posted to FTDNA. Hopefully that is a big enough market for SNPs CTS7822 and CTS9219 to add them to the a la carte snp list.

** N115176/N98739 is the same individual as per kostop.

smal
11-17-2013, 02:34 PM
The interesting data have appeared. One of the Geno 2.0 tested CTS7822+ kits, N112689 Ilinov, was earlear tested by Ancestry.com (Ysearch GF8K9). His STR values are close enough to the well known East European cluster of Z2103.

928

So I think the East European cluster of Z2103 belong to belongs to the Z2103+ CTS7822+ CTS9219+ branch.

Rathna
11-17-2013, 02:47 PM
The interesting data have appeared. One of the Geno 2.0 tested CTS7822+ kits, N112689 Ilinov, was earlear tested by Ancestry.com (Ysearch GF8K9). His STR values are close enough to the well known East European cluster of Z2103.

928

So I think the East European cluster of Z2103 belong to belongs to the Z2103+ CTS7822+ CTS9219+ branch.

It is exactly what I am saying from so long. Then R-Z2105+ EE CLuster is a subclade of a subclade of R-Z2105*.

Joe B
11-18-2013, 11:19 PM
The interesting data have appeared. One of the Geno 2.0 tested CTS7822+ kits, N112689 Ilinov, was earlear tested by Ancestry.com (Ysearch GF8K9). His STR values are close enough to the well known East European cluster of Z2103.

928

So I think the East European cluster of Z2103 belong to belongs to the Z2103+ CTS7822+ CTS9219+ branch.

Thank you for this very useful information!
The 12 str values from Ysearch GF8K9.
12 24 15 11 11-14 12 13 8 13 13 30 with DYS388=13 and DYS439=8 expanding the modal. Could that DYS439=8 be due to something with Ancestry.com values?

NOTE: Found this chart from YHRD.org and DYS439=8 seems rather rare.
http://www.yhrd.org/DYS439http://www.yhrd.org/DYS439;;i/show_allele_distribution?r=45&locus=dys439&mode=mp_relative_2

smal
11-19-2013, 06:15 AM
Could that DYS439=8 be due to something with Ancestry.com values?


This man was tested 2 times independently by Ancestry.com and SMGF. The results were identical.
His STR values from Ancestry.com:
19a 15; 385a 11; 385b 14; 388 13; 389I 13; 389II 30; 390 24; 391 11; 392 13; 393 12; 426 12; 437 15; 438 12; 439 8; 441 15; 442 17; 444 12;
445 12; 446 14; 447 25; 448 19; 449 32; 452 30; 454 11; 455 11; 456 16; 458 15; 459a 9; 459b 10; 460 11; 461 11; 462 11; 463 24; 464a 14; 464b 15; 464c 16; 464d 18; GGAT1B07 10; YCAII2A 19; YCAII2B 23; Y-GATA-A10 15; 635 23; Y-GATA-H4 12

I think there are no needs to convert DYS439 from the Ancestry to Ysearch format. The DYS439=8 is unique, but the other STRs are quite common.

Rathna
11-19-2013, 06:45 AM
I think there are no needs to convert DYS439 from the Ancestry to Ysearch format. The DYS439=8 is unique, but the other STRs are quite common.

Smal, this is just the point. What is important is his SNPs test, which put him amongst the R-Z2110+ people. This mutation is only a multistep one which isn't worth at the phylogeny level.

Joe B
11-19-2013, 07:46 AM
This man was tested 2 times independently by Ancestry.com and SMGF. The results were identical.
His STR values from Ancestry.com:
19a 15; 385a 11; 385b 14; 388 13; 389I 13; 389II 30; 390 24; 391 11; 392 13; 393 12; 426 12; 437 15; 438 12; 439 8; 441 15; 442 17; 444 12;
445 12; 446 14; 447 25; 448 19; 449 32; 452 30; 454 11; 455 11; 456 16; 458 15; 459a 9; 459b 10; 460 11; 461 11; 462 11; 463 24; 464a 14; 464b 15; 464c 16; 464d 18; GGAT1B07 10; YCAII2A 19; YCAII2B 23; Y-GATA-A10 15; 635 23; Y-GATA-H4 12

I think there are no needs to convert DYS439 from the Ancestry to Ysearch format. The DYS439=8 is unique, but the other STRs are quite common.We are fortunate to have this man so dedicated to testing. Please thank him. Having one or two wierd markers seems to be a hallmark of R1b-Z2103. Let's just say that DYS439=8 is his personal unique marker.
smal, good to have your help!

Joe B
11-19-2013, 07:57 AM
I will be sending an email request to the R1b and Subclades Gateway and R1b1a2 (P312- U106-) DNA project administrators very soon to request the addition of CTS7822 and CTS9219 to the a la carte snp list. That should help get the snp testing needed for the phylogeny level placement of CTS7822 and CTS9219.

Rathna
11-19-2013, 08:17 AM
The case of Ilynov (i.e. one who probably belongs to the R-L23 EE cluster and has resulted Z2110 from his Geno 2.0, then presupposing that all this cluster is so) puts some problems also to me. These are some haplotypes: that of Ilynov, of Bartoszewski (a normalized EE cluster) and some linked to me. There isn't mine, because I am tested for 111 markers and it was clearer to show them in the SMGF format. HFXBJ is the modal amongst me (KV7Y2), my relative Giancarlo Tognoni (XG6HX), MRCA during the 15th century, and an Anonymous Brazilian (N92C5) I wasn't able to contact, but for me very closely linked to my family.
GF8K9 Ilinov Kursk, Russia
12 24 15 11 11 14 12 13 8 13 13 30 15 9 10 11 11 25 15 19 32 14 15 16 18 11 11 19 23 16 12 12 11 11 13 23 10 14 12 12 14 30 24
DDHPK Bartoszewski Poland
12 24 14 11 11 14 12 12 12 13 13 30 16 9 10 11 11 25 15 19 32 14 15 16 16 11 11 19 23 16 12 12 11 11 13 23 10 14 12 12 14 30 24
HFXBJ Del Badia Castelfiorentino, Italy
12 24 15 10 11 14 12 12 12 13 13 29 16 9 10 11 11 25 15 19 29 14 14 16 17 10 11 19 23 15 12 12 11 11 13 23 10 14 12 12 13 30 24
N92C5 Tognoni Italy
12 24 15 10 11 14 12 12 13 13 13 29 16 9 10 11 11 25 15 19 29 14 14 16 17 10 11 19 23 15 12 12 11 11 13 23 10 14 12 12 13 30 24
XG6HX Tognoni Castelfiorentino, Italy
12 24 15 10 11 14 12 12 12 13 13 29 16 9 10 11 11 25 15 19 28 14 14 16 17 10 11 19 23 16 12 12 11 11 14 23 10 14 13 12 13 30 24
Which is the problem?
I have received only yesterday the Geno 2.0 kit I ordered 1 month ago (it actually arrived on 23 October but lied for 25 days in the wrong post office!). Having done Chromo 2 (from 2 October, thus results should be next), I ordered Geno 2.0 to test my acquired relative Fabrizio Federighi, tested with SMGF and resulted R-M269* with DYS462=12, i.e. what is the Jewish cluster of R-M269, now 150+, PF7558/PF7562/PF7563+, to see if he belongs to this haplotype too. But, as we don't know which SNPs tests Chromo2 and if this test will answer my questions about above all Z2110 and also PF7580, I am going to wait for my results before deciding whether to test Federighi or to use the test for me. Why?
Because it is now important for me to know my position as to Z2110 (and also PF7580). I am Z2105+ (tested by FTDNA), L277- and L584- (tested by 23andMe), but I don't know my position as to Z2110 and PF7580.
Of course if we all were tested for the Full Y everything would be clear, but also with the coming tests I could answer some questions.
There is a close link between my haplotype and the EE cluster? I could result Z2110+ too, but if not, I could belong to the intermediate haplotypes between Z2105+ and Z2110+: we know that there are two SNPs (at least) between them: Richard Rocca spoke of them and sent the primers (of at least one) to FTDNA. I could belong to an intermediate haplotype like probably Carnevali with his PF7580 belongs to the ancestor haplotype of L584+. Of course this would bring grist to my own mill of the Italian Refugium. Why there could be a link between my haplotype and the EE cluster? Just for my DYS19=15, owned also by Ilynov, and I have always thought the ancestral value and not a mutation from 14, and for DYS464. The values of the EE cluster, 14-15-16-18, could presuppose 14-15-16-17, seen that Bartoszewski has 14-15-16-16, and my line (14-14-16-17) could have had the mutation of DYS464b from 15 to 14. We all have DYS441=14.
This would be an aimed test and not done by chance.

Joe B
11-20-2013, 06:13 PM
What information is needed for a project manager to push the SNP request button for CTS7822/Z2110 and CTS9219?

A SNP request for our subclade may be buried under an avalanche of SNP requests from our R1b downstream cousins. Ftdna has indicated limited space for new SNPs so it is important submit our request with good justification and early. SNP CTS7822 is showing up in roughly 1/3 or the R1b-L23xL51 Geno 2.0 test kits posted to FTDNA. Hopefully that is a large enough market for SNPs CTS7822 and CTS9219 to add them to the a la carte snp list.

SNP Request Form.... It's not fair to the project managers that we make them look up all the information that FTDNA requires for adding SNPs CTS7822 and CTS9219 to the Advanced SNP order list.

This list (http://forums.familytreedna.com/showthread.php?p=373497#post373497) is from the FTDNA forum.

The following fields are requested:

SNP Name:*
Hg19 Chromosomal Position (or rs#):*
Ancestral or Derived State:*
Approximate Haplogroup:*
Rationale for Offering SNP:*
Where was the SNP Discovered?*
Submitted By:*


How does this look?
Source: ISOGG SNP Compendium (https://www.dropbox.com/s/kp0tdk3tno480ci/ISOGG%20SNP%20Compendium.xlsx), David Reynolds Compendium Last updated 18 Dec 2012

SNP Name:* CTS7822 Z2110
Hg19 Chromosomal Position (or rs#):* 17402575 GRCh37 Y-Pos (hg19)
Ancestral or Derived State:* A->T
Approximate Haplogroup:* R1b1a2a2 R-Z2103 R-M269>L23>L150>Z2103/Z2105>CTS7822*
Rationale for Offering SNP:* May form a subclade of R-Z2103. Should encourage more testing.
Where was the SNP Discovered?* Chris Tyler-Smith
Submitted By:*


SNP Name:* CTS9219
Hg19 Chromosomal Position (or rs#):* 18755279 GRCh37 Y-Pos (hg19)
Ancestral or Derived State:* G->A
Approximate Haplogroup:* R1b1a2a2 R-Z2103 R-M269>L23>L150>Z2103/Z2105>CTS7822>CTS9219*
Rationale for Offering SNP:* May form a subclade of R-CTS7822. Should encourage more testing.
Where was the SNP Discovered?* Chris Tyler-Smith
Submitted By:*

Rathna
11-20-2013, 09:35 PM
Not CTS7288 but CTS7822.

Joe B
11-20-2013, 10:50 PM
@Rathna Thank you. I have sent a corrected request with the SNP typo mistakes fixed. Don't know what I'm doing, lack the proper acumen and appreciate the help. It is CTS7822 GRCh37 Y-Pos (hg19) 17402575!

Rathna
11-21-2013, 06:09 AM
S136 L50

S351 L150
Z2100
Z2102
Z2103 CTS1078
Z2105
Z2109 CTS1843
Z2110 CTS7822
Z2113
Z2118 PF7589
Z212
Z2123

Good news from Chromo 2: they have many SNPs of the series Z close to R-Z2105, of R-L51, and also S136, but like L50 whereas just EthnoAncestry said that my S136 was a deletion of 9 bp in that region. We'll see my results what say.

Rathna
11-21-2013, 08:38 AM
S136 L50

S351 L150
Z2100
Z2102
Z2103 CTS1078
Z2105
Z2109 CTS1843
Z2110 CTS7822
Z2113
Z2118 PF7589
Z212
Z2123

Good news from Chromo 2: they have many SNPs of the series Z close to R-Z2105, of R-L51, and also S136, but like L50 whereas just EthnoAncestry said that my S136 was a deletion of 9 bp in that region. We'll see my results what say.

Add these SNPs of the DF series and also Z2115. All the SNPs released are 14449:


S1157 CTS5981 Z2115
S11987 DF99
S1687 DF93
S1809 DF96
S191 DF5
S192 DF21
S193 DF23
S21484 DF95
S232 DF19
S250 DF27
S253 DF25
S4298 DF88
S438 DF29
S470 Z251
S474 DF49
S524 CTS6581 DF41
S675 DF85
S923 DF73

Rathna
11-21-2013, 09:19 AM
Very good: there is also CTS9219 under CTS7822/Z2110.

There aren't L277 nor L584, but L943 and L946 under L584 (the Silver's SNPs) but not L944 and L945 (except they are under another name).

Rathna
11-21-2013, 09:42 AM
There is also PF7580: wonderful!

Also PF7558 and PF7562 (I don't see PF7563, except it is under another name): this is good for R-M269*.

P.S. There are also these SNPs under R-Z2105:

CTS1848
CTS7763
CTS8966

Rathna
11-21-2013, 10:11 AM
At this point I solve my doubt: it is completely useless for me to do Geno 2.0. I'll use my kit for Fabrizio Federighi, who will be able to see his position as to R-M269*.

Rathna
11-21-2013, 03:13 PM
Very good: there is also CTS9219 under CTS7822/Z2110.

There aren't L277 nor L584, but L943 and L946 under L584 (the Silver's SNPs) but not L944 and L945 (except they are under another name).

In fact L277 is signed S334. Not found so far L584.

Joe B
11-27-2013, 05:37 AM
SNP Request Form

How does this look?
Source: ISOGG SNP Compendium (https://www.dropbox.com/s/kp0tdk3tno480ci/ISOGG%20SNP%20Compendium.xlsx), David Reynolds Compendium Last updated 18 Dec 2012

SNP Name:* CTS7822 Z2110
Hg19 Chromosomal Position (or rs#):* 17402575 GRCh37 Y-Pos (hg19)
Ancestral or Derived State:* A->T
Approximate Haplogroup:* R1b1a2a2 R-Z2103 R-M269>L23>L150>Z2103/Z2105>CTS7822*
Rationale for Offering SNP:* May form a subclade of R-Z2103. Should encourage more testing.
Where was the SNP Discovered?* Chris Tyler-Smith
Submitted By:*


SNP Name:* CTS9219
Hg19 Chromosomal Position (or rs#):* 18755279 GRCh37 Y-Pos (hg19)
Ancestral or Derived State:* G->A
Approximate Haplogroup:* R1b1a2a2 R-Z2103 R-M269>L23>L150>Z2103/Z2105>CTS7822>CTS9219*
Rationale for Offering SNP:* May form a subclade of R-CTS7822. Should encourage more testing.
Where was the SNP Discovered?* Chris Tyler-Smith
Submitted By:*
Just wanted to say thanks to Vince T. and Mike for responding to our Z2110/CTS7822 request. They responded promptly last week. Project Managers do matter.
Hopefully it is not out of school to say that Vince mentioned some issues with the Z2110 region and Sanger sequencing when it was looked at last year. Thanks for sharing that.
Vince also mentioned something about Z2106-Z2110 being near or around L277.1 and wouldn't we like to find out. Let's hope these SNPs become a routine part of the next round of SNP array testing. It looks like Chromo 2 test for them now.
Whatever the outcome of your inquiries with FTDNA thanks looking at Z2110.

Rathna
11-27-2013, 08:27 AM
It looks like Chromo 2 test for them now.


Actually I found only Z2109 (beyond Z2102, Z2103, Z2105 and Z2110) amongst the SNPs of Chromo2. It is likely that amongst Z2106, Z2107 and Z2108 there are the two SNPs upstream Z2110 Richard Rocca spoke about (he sent the primers to FTDNA at the times of Thomas Krahn).
I'll be able to say something more when my results arrive.

Joe B
11-27-2013, 07:20 PM
Z2110/CTS7822 just got more interesting. A L150.2! L150-, L23+ person just Geno 2.0 tested CTS7822+ and presumed CTS9219-. 108347 is very well tested by Deep Clade and Geno 2.0. So L150 is negative by SNP array and Sanger testing methods.
108347 Seymour R1b1a2a R-L23 CTS7822+,L150-, L23+, Z2103+, Z2105+, L277-, L584-,111 STRs.


108347 thanks for testing.
Caught this first on the Itai Perez spreadsheet (thanks Rathna) and confirmed with the R1b1a2 (P312- U106-) DNA Project (http://www.familytreedna.com/public/ht35new/default.aspx?section=ysnp).

Rathna
12-14-2013, 11:31 AM
Another R-CTS7822/Z2110+ has appeared on the "ht 35 FTDNA project":
N24004 James F. Sands, b. 1817 and d. 1887 Unknown Origin R1b1a2a1
unfortunately tested for only 12 markers:
12 23 14 11 11-11 12 12 12 13 13 29
The closest on YHRD is this:
1 14 13 29 23 11 13 12 11,11 12 13 15 19 15 16 23 13 -1 -1 -1 -1 -1 -1 -
1 of 216 Alicante, Spain [Spanish] Eurasian - European - Western European Europe

Amongst the others, not believable this Chinese, who, with DYS438=10, is most likely, if hg. R, R1a rather than R1b:
15 13 29 23 11 13 12 11,11 1 >>
1 15 13 29 23 11 13 12 11,11 10 11 15 18 16 18 23 11 -1 -1 -1 -1 -1 -1 -
1 of 4451 Zhejiang, China [Han] East Asian - Sino-Tibetan - Chinese Asia.

The others:
14 13 30 23 11 13 12 11,11 1 >>
1 14 13 30 23 11 13 12 11,11 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1
1 of 109 Kahramanmaras, Turkey [Turkish] Eurasian - Altaic Asia
14 13 29 23 10 13 12 11,11 1 >>
1 14 13 29 23 10 13 12 11,11 12 12 15 19 17 16 23 13 19 21 13 12 17 10 -
1 of 129 Illinois, United States [European American] Eurasian - European North America
14 13 29 23 11 13 11 11,11 1 >>
1 14 13 29 23 11 13 11 11,11 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -
1 of 74 Reunion [Kaf] Admixed Africa

kostop
12-15-2013, 08:21 AM
Just got my L277 results from FTDNA and it's .......(drum roll).......negative.

Not sure where to go from here. I wonder if there is any point in testing for Z2103 or Z2105 until their position on the tree has been confirmed.
I guess I could always upgrade to further STRs, although with some rather unusual known STR values, chances of finding close matches are very slim.

Rathna
12-15-2013, 10:03 AM
Just got my L277 results from FTDNA and it's .......(drum roll).......negative.

Not sure where to go from here. I wonder if there is any point in testing for Z2103 or Z2105 until their position on the tree has been confirmed.
I guess I could always upgrade to further STRs, although with some rather unusual known STR values, chances of finding close matches are very slim.

kostop, why did you test yourself for L277? If you are R-CTS7822/Z2110+, of course you aren't L277+ nor L584+.
If you look at the tree of smal it is clear that you are positive for:
L23/L478/PF6404
Z2103/Z2105
Z2104/Z2106/Z2107
Z2108/Z2109
CTS7822/Z2110.
If you did Geno 2.0 you are negative for the downstream SNPs known so far:
CTS9219 and F672.
You should compare you with 247019, N29277, HG01277.
You have arrived in a goal. What could give something more to you is only the Full Y, but let's wait that it is less expensive and more reliable. What do you want to know more about you? You are a Greek, a subclade of people who came from the Italian Refugium (that of course is my thinking) but many thousands of years ago and the most part belong to the subclade with CTS9219. You probably descends from an ancestor of them. What do you want more? Probably your ancestors are living in the Balkans from thousands of years, seen that so far R-Z2110+ hasn't been found in Italy and the only one (Varipapa from Calabria) is clearly a descendant of an Arbereshe come from the Balkans.

N98739/N115176 Drakopoulos? circa 1700, Leontari, Greece Greece R1b1a2a1 R-L150
L150+, L23+, M269+, L51-, L584-, P312-, U106-
11 24 15 11 11-14 12 12 12 13 12 29 14 9-10 11 11 25 15 20 29 15-15-16-17

This is Varipapa you could compare with:
N29277 Andolino Casimiro Varipapa, b.~1883, Casimiro, IT Unknown Origin R1b1a2a1
12 24 14 11 11-14 12 12 13 13 13 29 16 9-10 11 11 25 15 19 30 14-15-15-18 11 12 23-23 15 16 16 18 36-36 11 12 11 7 15-16 8 10 10 8 10 12 12 22-22 16 10 12 12 15 8 12 22 20 15 12 11 13 11 11 12 12
of course thousands of years of separation that a Full Y could quantify. If you look at his series:
8 10 10 8 10 12
11 13 11 11 12 12
with a mutation in DYS511 from 11 to 12 we could be in the range of 4,000/6,000 years of separation from my R-Z2105+ if my Chromo2 won't demonstrate some SNPs downstream (but so far the unique Tuscan tested by 1KGP (NA 20532) has resulted positive also for Z2104/Z2106 and Z2107).

Rathna
12-15-2013, 10:25 AM
I make you note, kostop, that the other person you could compare is that Ware (247019), comprised in the wrong clade of R-L150- in the "ht 35 FTDNA Project". He and Seymour belong to the same cluster, clear also from the two series:
8 11 10 8 10 11
11 13 12 11 12 12
with two other mutations in
DYS537 from 10 to 11 and
DYS572 from 11 to 12.
Thus a separation from yours that could be of many thousands of years.
Of course we didn't know the STRs values of the person tested by the 1KGP: HG01277.

kostop
12-15-2013, 11:38 AM
Thanks Rathna

It was suggested to me in the past to test for L277 and until now I had not realised that was pointless. Next time I will ask for advice first, it could save me $49 :)
I have no specific goal at this point (such as locating relatives, etc) apart from broadening my knowledge and contributing to this research as much as I can. I heard about the Full Y test, but it is far too expensive for me at them moment, I may consider it in the future if the price goes down.

Joe B
12-15-2013, 06:27 PM
It was suggested to me in the past to test for L277 and until now I had not realised that was pointless. Next time I will ask for advice first, it could save me $49 :)
I have no specific goal at this point (such as locating relatives, etc) apart from broadening my knowledge and contributing to this research as much as I can. I heard about the Full Y test, but it is far too expensive for me at them moment, I may consider it in the future if the price goes down.
Kostop,
Thank you for ordering L277. At the time you ordered it may have looked like a good idea. The fault may lie with me and this post http://www.anthrogenica.com/showthread.php?527-Geno-2-0-and-R-L23-and-R-L51&p=17716&viewfull=1#post17716 on Oct.28th. Little did we know that so much of the Geno 2.0 connections to our subclade phylogeny would become clear in just the last few weeks.
Have you had any response from FTDNA about fixing the duel kit problem?
N115176/N98739 Drakopoulos Constantinos Drakopoulos, 1825-1900 see #N98739 Greek Project Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-, L277-
It would be a shame to have such good and complete data discombobulated. Rebekah Canada at FTDNA forums has been responsive to issues like this.
Have you considered going to 67 or 111 STRs? I'm in the same boat as you, not looking for long lost relatives unless they are rich. Yet 67 STRs have been essential and 111 STRs are starting to be useful too.
You are a great asset to the team. Looks like your expertise is needed in the Balkans or Anatolia R1b-Z2103 debate.
Thanks,
Joe

kostop
12-16-2013, 05:03 PM
Kostop,
Thank you for ordering L277. At the time you ordered it may have looked like a good idea. The fault may lie with me and this post http://www.anthrogenica.com/showthread.php?527-Geno-2-0-and-R-L23-and-R-L51&p=17716&viewfull=1#post17716 on Oct.28th. Little did we know that so much of the Geno 2.0 connections to our subclade phylogeny would become clear in just the last few weeks.
Have you had any response from FTDNA about fixing the duel kit problem?
N115176/N98739 Drakopoulos Constantinos Drakopoulos, 1825-1900 see #N98739 Greek Project Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-, L277-
It would be a shame to have such good and complete data discombobulated. Rebekah Canada at FTDNA forums has been responsive to issues like this.
Have you considered going to 67 or 111 STRs? I'm in the same boat as you, not looking for long lost relatives unless they are rich. Yet 67 STRs have been essential and 111 STRs are starting to be useful too.
You are a great asset to the team. Looks like your expertise is needed in the Balkans or Anatolia R1b-Z2103 debate.
Thanks,
Joe

Hi Joe

Not your fault at all, I was thinking about ordering L277 since I tested for L584 almost 1 1/2 years ago but at that point I was told that it wasn't 100% reliable. I just forgot to check the latest updates to the tree, to see that Z2110 rules out L277.
Regarding the the dual kit issue I did send an email to FTDNA, but have't followed up since. Will do so shortly.
I have been considering to upgrade to 67STRs, and at the moment it seems to be the right next step.
As for lost billionaire relatives...they are welcome from anywhere across the universe :biggrin1:

Joe B
01-04-2014, 09:36 PM
CTS7822 has been added to the YSEQ DNA (http://shop.yseq.net/index.php?manufacturers_id=34) catalog list.

HG19 Position: ChrY:17684699..17684699
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a (not listed)
Comments: Downstream L23
Forward Primer: CTS7822_F GGGAGGGATAGCATTAGGAGTTATAG
Reverse Primer: CTS7822_R TAATTCCTGACATACTTGTGGGG
Nothing in the FTDNA catolog as of today.

smal
01-22-2014, 08:49 AM
The Geno 2.0 results of 300134 Järvinen have appeared. He has CTS7822+ CTS9219+ haplotype. He is also CTS8749+. CTS8749 is strange, it is available in different haplogroups.

Rathna
01-22-2014, 09:22 AM
The Geno 2.0 results of 300134 Järvinen have appeared. He has CTS7822+ CTS9219+ haplotype. He is also CTS8749+. CTS8749 is strange, it is available in different haplogroups.

I thank you for the information. The surname is from Finland, thus it is confirmed that Central, Eastern and Western European R-Z2110+ are also CTS9219+, whereas I from Italy am CTS9219-, and this may let me think that the expansion happened from Italy as in my theory of the Italian Refugium. I wouldn't give any importance to CTS8749, as recurrent mutation.

Rathna
01-22-2014, 09:35 AM
I thank you for the information. The surname is from Finland, thus it is confirmed that Central, Eastern and Western European R-Z2110+ are also CTS9219+, whereas I from Italy am CTS9219-, and this may let me think that the expansion happened from Italy as in my theory of the Italian Refugium. I wouldn't give any importance to CTS8749, as recurrent mutation.

Anyway from my Chromo2 I am negative:

CTS8749 GG negative

It is possible that this mutation, even though recurrent, has some importance like a subclade of CTS9219+.

Rathna
01-22-2014, 10:16 AM
Of course also Moiseev would merit to be tested for Geno 2.0. Probably they belong to the same haplotype, but with many mutations which could demonstrate a long separation:

300134 Järvinen Leo Nikolai, familyname unknown b.1917 and d.1999 Finland R1b1a2a1
12 25 14 10 11-15 12 12 13 14 13 30 15 10-10 11 11 25 15 19 32 14-15-16-19 11 11 19-23 15 16 18 17 37-37 12 12 11 9 15-16 8 10 10 8 10 11 12 23-25 17 10 12 12 16 8 12 21 20 14 12 11 13 11 11 12 12
279840 Moiseev Unknown Origin R1b1a2
12 25 14 11 11-14 12 12 13 14 13 30 15 9-10 11 11 25 15 19 30 14-16-16-17 10 11 20-22 15 16 19 16 36-37 12 13 11 9 15-16 8 10 10 8 10 11 12 23-23 17 10 12 12 15 8 11 22 20 13 12 11 14 11 11 12 12 34 15 9 16 12 27 26 18 12 11 13 12 10 9 12 12 10 11 11 31 12 13 24 14 10 10 20 15 19 14 24 18 12 15 24 12 23 18 10 15 17 9 12 11

279840 Moiseev R1b1a2 R-M269 Z2103+

Joe B
01-22-2014, 10:42 PM
The Geno 2.0 results of 300134 Järvinen have appeared. He has CTS7822+ CTS9219+ haplotype. He is also CTS8749+. CTS8749 is strange, it is available in different haplogroups.

Thanks smal
Here's what I have for CTS7822/Z2110 from FTDNA projects, Semargl (http://www.semargl.me/en/dna/ydna/haplotypes/table/588/) and smal's Z2103 tree (http://www.anthrogenica.com/showthread.php?1727-R1b-phylogeny&p=26401&viewfull=1#post26401)
#N115176/N98739 Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-
#247019 Ware Surname Project North Carolina R1b1a2a1 CTS7822+, Geno2.0
#N29277 Italy DNA Project Italy R1b1a2a1 CTS7822+, Geno2.0
#272057 Ireland Project Ireland? R1b1a2a1 CTS7822+, Geno2.0
#H1614 Italy Project Italy R1b1a2 CTS7822+, Chromo 2
#H1621 Italy Project Italy R1b1a2 CTS7822+, Predicted
#108347 R1b1a2 (P312- U106-) DNA Project England R1b1a2a CTS7822+, F672, Geno2.0, L150-, L23+, Z2103+, Z2105+, L277-, L584-
#N24004 R1b1a2 (P312- U106-) DNA Project USA W. Virginia R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
#257843 Jewish DNA Project ungrouped Unknown R1b1a2a1 CTS7822+, CTS9219+, Z2103+, Z2105+, Geno2.0
#N115142 German DNA Project Germany R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
#N112689 Russia DNA Project Russian Federation R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
#300134 JewishGen Scandinavia SIG DNA Project Finland R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
#278024 Polish Project Poland R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
#N114393 White Surname Project Unknown R1b1a2a2 CTS7822+, CTS9219+, Geno2.0 strs?
#N115870 French Heritage Project R1b1a2a1 CTS7822+, CTS9219+, Geno2.0 strs?
#N116170 Arcadia Project Greece R1b1a2a1 CTS7822+, CTS9219+, Geno2.0 strs?
#HGO1515 1000 Genomes Spain CTS7822+, CTS9219+, CTS7959+, CTS9230+, CTS11767+
#HGO1277 1000 Genomes Columbia CTS7822+, CTS699+

JärvinenT
01-26-2014, 10:56 AM
Hi everyone
I am 300134 Järvinen Leo Nikolai, familyname unknown b.1917 and d.1999 Finland R1b1a2a1.
These things are pretty new to me. I try to discover my paternal line, cause I know only of a little bit of the roots of my father - line. My brother take the test. My paternal line history end`s my granfather Leo Nikolai. I know he`s father was Russian Tzar officer, who name we don`t know. My granfather born in Finland (first paternal line member in Finland) 1917 just before Finland`s independency and civil war and time Russian`s revolution. Granfather never knew he`s parent`s and crow up as an orphan. He`s paternal line seem to come fron Russia. He got the familyname Koskinen (a modified Abelson name in the beginning 1900) to he`s mother. Who died when he was small child. He`s father was most likely Jew, cause some thing`s coul not explain other wise. Many Russian officer`s were Jews.

My Geno 2.0 and FTDNA answers are confusing. I dont understand my answers, maby cause there isn`t lot about information these mutations. Imformation I only have from National Geographic says
"Branch L278, Age: To Be Determined,Location of Origin: West Asia
While some from this group traveled west into Central Asia, others moved south toward the Levant region. Today, they are present in trace frequencies of less than 1 percent in Italy, the Ukraine, and the region of the Pannonian Basin. Note: This branch is not accompanied by a major movement on the map, and research on this branch is continuing.
Those who belong to this lineage but do not belong to a descendant branch are rare."

But you must of known this already. I have been told that Z2103+ is not downstream from R-P312+ or R-U106+.

Rathna
01-26-2014, 11:47 AM
Hi Jaervinen, thanks for joining this forum. Of course you may contribute to our research. I'll try to answer some of your questions:
1) If you ask me if your recent origins were from a Jewish family, I'd answer yes, they probably are.
2) What we are trying to understand is if your family came from the ancient Jewish pool before the diaspora or from people introgressed after that. It isn't easy to answer this question without the ancient DNA (aDNA) which probably isn't easy to do in Israel for religious reasons.
3) As I believe (and I have expressed that above) that your haplotype is linked to that of Moiseev (likely of Jewish origin himself) and if there were a direct descent from a common ancestor, this probably would mean thousands of years ago, but there is also the possibility that these two lines (yours and of Moiseev's) are introgressed independently in Eastern Europe.
4) It is certain that Jews on R-L23 haplogroup are many and a possible Jewish origin of we all has to be put in account.
5) You aren't only Z2110 (like me), but belong to the subclade CTS9219, which is the most diffused and overall in Europe. I said already so long ago that the great part of the Eastern European L23 (those belonging to the E[ast]E[uropean] haplotype) were to me Z2110/CTS7822, and sincerely to think that they all are of Jewish origin is a little believable.
6) We are waiting for the next tests in progress. It seems that the most ancient haplotypes of the branch Z2110 are in India (NA20866) and the Caucasus (NA18645, 164226). After there is my line (Italy and the Balkans), but we have to ascertain if the most ancient of the other two lines (L277 and L584) are in Italy or not. The answer will come from the test of the two Europeans (one is the Italian Carnevali) who are PF7580 but we don't know if L584- or +.
7) As to L277 we are waiting the test of Mattoli.

Joe B
01-26-2014, 11:37 PM
Hi everyone
I am 300134 Järvinen Leo Nikolai, familyname unknown b.1917 and d.1999 Finland R1b1a2a1.
These things are pretty new to me. I try to discover my paternal line, cause I know only of a little bit of the roots of my father - line. My brother take the test. My paternal line history end`s my granfather Leo Nikolai. I know he`s father was Russian Tzar officer, who name we don`t know. My granfather born in Finland (first paternal line member in Finland) 1917 just before Finland`s independency and civil war and time Russian`s revolution. Granfather never knew he`s parent`s and crow up as an orphan. He`s paternal line seem to come fron Russia. He got the familyname Koskinen (a modified Abelson name in the beginning 1900) to he`s mother. Who died when he was small child. He`s father was most likely Jew, cause some thing`s coul not explain other wise. Many Russian officer`s were Jews.

My Geno 2.0 and FTDNA answers are confusing. I dont understand my answers, maby cause there isn`t lot about information these mutations. Imformation I only have from National Geographic says
"Branch L278, Age: To Be Determined,Location of Origin: West Asia
While some from this group traveled west into Central Asia, others moved south toward the Levant region. Today, they are present in trace frequencies of less than 1 percent in Italy, the Ukraine, and the region of the Pannonian Basin. Note: This branch is not accompanied by a major movement on the map, and research on this branch is continuing.
Those who belong to this lineage but do not belong to a descendant branch are rare."

But you must of known this already. I have been told that Z2103+ is not downstream from R-P312+ or R-U106+.

Hello 300134 and welcome to our little corner of the Anthrogenica forum. Hopefully this is where you can find cutting edge information for the R1b-CTS7822/Z2110 miniclade of R1b-Z2103. Keep an eye on Forum: R1b Early Subclades (http://www.anthrogenica.com/forumdisplay.php?51-R1b-Early-Subclades) as useful information can show up on any of the threads.

I'm not sure if we can draw too many conclusions about your brother's haplotype yet. The database needs to grow some more to give you and me better answers. Your family history is still most important at this point and likely will be corroborated as the data comes in.

You have your choice of different phylogenetic trees that vary by expermentation. ISOGG (http://www.isogg.org/tree/ISOGG_HapgrpR.html) and Mike W's (http://www.anthrogenica.com/showthread.php?820-R1b-Early-Branching-Phylogeny-%28SNP-based-family-tree%29&p=15405&viewfull=1#post15405) phylogenetic trees are solid but do not include CTS7822/Z2110 and CTS9219 yet. Chris Morley has a computer based Experimental Y-SNP Phylogenies (http://ytree.morleydna.com/experimental-phylogeny) and you should be on level 1980 of page 38 in the latest edition. We are very fortunate that smal is a R1b-Z2103 and makes a R1b-Z2103 specific tree (http://www.anthrogenica.com/showthread.php?1727-R1b-phylogeny&p=26401&viewfull=1#post26401) for us from the semargl (http://www.semargl.me/en/dna/ydna/) data base. It is fun to watch his tree evolve as it reflects the newest phylogenetic thinking for R1b-Z2103.

I see that you are a member of the R1b project. Would you mind joining the R1b1a2 (P312- U106-) DNA Project (http://www.familytreedna.com/public/ht35new,ht35new/default.aspx) too. Please add the earliest known location for your Grandfather in your FTDNA profile as that is part of the story. (latitude and longitude too)

What National Geographic says about us is about as generic as they can make it. You should not have any trouble finding debates about the R1b-Z2103 subclade and human migration to Europe in this forum.

Thanks and please ask any questions that you may have.

Don't forget to check out the The Lounge (http://www.anthrogenica.com/forumdisplay.php?12-The-Lounge) now and then.

Silesian
01-27-2014, 12:27 AM
Hi everyone
I am 300134 Järvinen Leo Nikolai, familyname unknown b.1917 and d.1999 Finland R1b1a2a1.
These things are pretty new to me. I try to discover my paternal line, cause I know only of a little bit of the roots of my father - line. My brother take the test. My paternal line history end`s my granfather Leo Nikolai. I know he`s father was Russian Tzar officer, who name we don`t know.

Welcome to our clade ! I also had a look at your numbers and they are very interesting.
12 25 14 10 11-15 12 12 13 14 13 30 15 10-10 11 11 25 15 19 32
I would have to say no to any Jewish ancestry as far as the two major clusters
R1b1a2a1* (R-L150*) Group A DYS 426-11 DYS 392-14
R1b1a2a1* (R-L150*) Group B DYS 392-14

Looks Russian,Slavic my theory is Scythian Iranian.
Can you share any autosomal results.

Rathna
01-27-2014, 06:00 AM
Welcome to our clade ! I also had a look at your numbers and they are very interesting.
12 25 14 10 11-15 12 12 13 14 13 30 15 10-10 11 11 25 15 19 32
I would have to say no to any Jewish ancestry as far as the two major clusters
R1b1a2a1* (R-L150*) Group A DYS 426-11 DYS 392-14
R1b1a2a1* (R-L150*) Group B DYS 392-14

Looks Russian,Slavic my theory is Scythian Iranian.
Can you share any autosomal results.

Silesian, you are free to continue to follow this (wrong) phylogeny, but it is misleading for newbies:
1) to put L150 like the common SNPs between R-M269 and R-L23 is due only to the believing of the Jewish R1b Project to unify these two different haplogroups that has no reason to be now. One thing is

R-M269+ L150+ PF7558+ PF7562+ PF7563+ but L23- L49- Z2103- Z2105- etc

and another is

R-L23+ L49+L150+ Z2103+ Z2105+ and others tens of SNPs and PF7558- PF7562- PF7563-

2) I do know very well that the two most diffused clusters of the R1b Jewish pool are these ( I have spoken about these from years and probably not hundreds but thousands of letters) but probably they aren't alone. Other haplotypes are only less diffused, because didn't participate to the growing of the Jewish Ashkenazi pool in these last centuries, but we have to take in consideration also them, and so far we haven't elements to say if they are from the Jewish pool before the diaspora or not.
3) Another cluster which has no meaning to be is the R-L23+ L150- of the "ht 35 FTDNA Project" (and also of the Morley's tree): these are (at least the tested ones) R-Z2110*, as it is evident in the smal's tree you can see here. That cluster was due to a paper of geneticists published on a peer review, but it isn't said that they understand these facts better than me.

Silesian
01-27-2014, 04:46 PM
Silesian, you are free to continue to follow this (wrong) phylogeny, but it is misleading for newbies:
You are free to post phylogeny theories. However the fact is, we have ancient R found in Russia and ancient R1b found in Kromsdorf, Germany and also R1b Z2103 in Caech/Poland[U98VT] we have not 1 ancient sample to compare from Italy or Saudi Arabi, or Levant.

newtoboard
01-27-2014, 04:53 PM
Welcome to our clade ! I also had a look at your numbers and they are very interesting.
12 25 14 10 11-15 12 12 13 14 13 30 15 10-10 11 11 25 15 19 32
I would have to say no to any Jewish ancestry as far as the two major clusters
R1b1a2a1* (R-L150*) Group A DYS 426-11 DYS 392-14
R1b1a2a1* (R-L150*) Group B DYS 392-14

Looks Russian,Slavic my theory is Scythian Iranian.
Can you share any autosomal results.

Can you cool it with these theories? An R1b in a Finn with paternal Russian ancestry is not evidence of R1b Scythians. I have no idea you came to that conclusion when there is no Scythian R1b sample much less anything for you decide this line is Scythian based on STR's. Scythians roamed all over Central and South Asia. Funny they didn't leave any R1b behind there. Russians did not absorb Scythians. Turks did.

And where is this ancient R in Russia?

Silesian
01-27-2014, 05:06 PM
Can you cool it with these theories? An R1b in a Finn with paternal Russian ancestry is not evidence of R1b Scythians. I have no idea you came to that conclusion when there is no Scythian R1b sample much less anything for you decide this line is Scythian based on STR's. Scythians roamed all over Central and South Asia. Funny they didn't leave any R1b behind there. Russians did not absorb Scythians. Turks did.

And where is this ancient R in Russia?

I don't care about your theories either quite frankly it would be nice if you for once would provide some proof, oh yeah I forgot you don 't care about the same subjects as I do. R1b Samples from Eastern Europe and Kromsdorf Germany are not theories, they are actual physical proof !

Rathna
01-27-2014, 05:10 PM
You are free to post phylogeny theories. However the fact is, we have ancient R found in Russia and ancient R1b found in Kromsdorf, Germany and also R1b Z2103 in Caech/Poland[U98VT] we have not 1 ancient sample to compare from Italy or Saudi Arabi, or Levant.

I was referring to this phylogeny
One thing is
R-M269+ L150+ PF7558+ PF7562+ PF7563+ but L23- L49- Z2103- Z2105- etc
and another is
R-L23+ L49+L150+ Z2103+ Z2105+ and others tens of SNPs and PF7558- PF7562- PF7563-
What is wrong is to think that these two haplogroups are linked by the SNP L150+.
Do you understand this or not? About the origin of R1b we'll see next, but I wasn't referring to that.

Silesian
01-27-2014, 05:12 PM
I was referring to this phylogeny
One thing is
R-M269+ L150+ PF7558+ PF7562+ PF7563+ but L23- L49- Z2103- Z2105- etc
and another is
R-L23+ L49+L150+ Z2103+ Z2105+ and others tens of SNPs and PF7558- PF7562- PF7563-
What is wrong is to think that these two haplogroups are linked by the SNP L150+.
Do you understand this or not? About the origin of R1b we'll see next, but I wasn't referring to that.
Nothing is wrong, however if someone does not have an Italian surname it is not wrong to think that they may have other origins other than the Middle East. Like newtoboard, just provide me with some ancient samples for your theories and you can win me.

newtoboard
01-27-2014, 05:16 PM
I don't care about your theories either quite frankly it would be nice if you for once would provide some proof, oh yeah I forgot you don 't care about the same subjects as I do. R1b Samples from Eastern Europe and Kromsdorf Germany are not theories, they are actual physical proof !

I don;t care about your theories on R1b but I care when you start spreading false information on Scythians. Your theories are garbage but someone new to this subject might not realize that like Rathna said.

I don't see what modern R1b samples from Eastern Europe or ancient R1b samples from Germany have anything to do with Scythians. So anything found in these regions is associated with Scythian. Why don't you go speculating on N1c-tat Scythians. Because that it is just as likely, Scythians originated in Central Asia.

Silesian
01-27-2014, 05:21 PM
I don;t care about your theories on R1b but I care when you start spreading false information on Scythians. Your theories are garbage but someone new to this subject might not realize that like Rathna said.

I don't see what modern R1b samples from Eastern Europe or ancient R1b samples from Germany have anything to do with Scythians. So anything found in these regions is associated with Scythian. Why don't you go speculating on N1c-tat Scythians. Because that it is just as likely, Scythians originated in Central Asia.
Stop being so foolish Scythians are classified as a Iranic tribe; you know very well, you can check the Grugni et al report yourself the clad of R1b Z2103 found in Eastern Europeans and the Urals and Ossetians is the same as the R1b found among Northwest Iranians. In fact it is the same found in Anatolians and Albanians .

Humanist
01-27-2014, 05:26 PM
Your theories are garbage...



Stop being so foolish...


Please keep it civil, guys.

newtoboard
01-27-2014, 05:27 PM
Stop being so foolish Scythians are classified as a Iranic tribe; you know very well, you can check the Grugni et al report yourself the clad of R1b Z2103 found in Eastern Europeans and the Urals and Ossetians is the same as the R1b found among Northwest Iranians. In fact it is the same found in Anatolians and Albanians .

if it is the same in Anatolians and Albanians then how is it from Scythians? Are you suggesting Anatolians and Albanians have significant Scythian ancestry? I asked for ancient Scythian samples showing R1b. I didn't ask you about R1b in Ossetians or Azeris. I asked you about R1b from ancient Scythian samples from the steppe and South Siberia. There are none. Those groups also share G2a. So you might as well speculate on G2a Scythians. Oh wait people did that before and ended up being wrong.

Silesian
01-27-2014, 05:28 PM
Please keep it civil, guys.
Thank you for the reminder.

newtoboard
01-27-2014, 05:35 PM
Please keep it civil, guys.

Sorry. Will try to keep that in mind.

Silesian
01-27-2014, 05:45 PM
if it is the same in Anatolians and Albanians then how is it from Scythians? Are you suggesting Anatolians and Albanians have significant Scythian ancestry? I asked for ancient Scythian samples showing R1b. I didn't ask you about R1b in Ossetians or Azeris. I asked you about R1b from ancient Scythian samples from the steppe and South Siberia. There are none. Those groups also share G2a. So you might as well speculate on G2a Scythians. Oh wait people did that before and ended up being wrong.
G2a3 has been around a long time compare ancient R1b Eastern and Western branches of contrast to ancient G2a ,I C. It's true that I have no evidence for ancient Iranians I can only deduce by current studies like Grugni et al and ancient R in Mal'ta boy the direction and lack of any significant ancient R1b in Western Europe. The lack of any ancient samples in far Western Europe and Italy [so far] lead me [my opinion] that it won't be found in Levant either, but closer to the direction R Mal'ta boy.

newtoboard
01-27-2014, 05:53 PM
G2a3 has been around a long time compare ancient R1b Eastern and Western branches of contrast to ancient G2a ,I C. It's true that I have no evidence for ancient Iranians I can only deduce by current studies like Grugni et al and ancient R in Mal'ta boy the direction and lack of any significant ancient R1b in Western Europe.

Ancient Iranians originated on the steppe though. There are alternative explanations for the presence of R1b-L23+ in NW Iran. But it is worth mentioning R1a-Z93+ is the clade that unites and is shared between NW, SW, SE, and NE Iranian speakers as well as between Dardic, Nuristani and Indo-Aryan speakers.

Silesian
01-27-2014, 06:03 PM
Ancient Iranians originated on the steppe though. There are alternative explanations for the presence of R1b-L23+ in NW Iran. But it is worth mentioning R1a-Z93+ is the clade that unites and is shared between NW, SW, SE, and NE Iranian speakers as well as between Dardic, Nuristani and Indo-Aryan speakers.

That maybe, but this is a R1b thread and I can only comment on things I know, like the samples found in Kromsdorf and Eastern Europe, and myself, autosomal shows ANE and Ural[Eurogenes K12 calculator in my signature]. From where does Volga-Ural come from, R1a Z283 R1a 93? Or from R1b Z2103 R1b M73 Bashkir found in Ural
http://www.familytreedna.com/public/Bashqort_Clans/

JärvinenT
01-28-2014, 09:13 AM
I am happy that I found this discussion.It is been important to me to share with others the same results. I feel pretty weard that know one share my results R1b group.

When I got the results of FTDNA I did not have any matches there (genetic matches) after level 12. I tested up to level 67. When I have my Geno 2.0 answers I had matches first time what was nice. Most of them were ashkenazi jews from emigrated from Russia to USA, or other were in Europe, but Jews. Eastern Europeans there was, few Irish, one France, one Greece, One Check,Scot,English mix, one Indian and one Algerian, man from USA,north Carolina - They story I read.

To me most important clue has been, why I belive my paternal (maternal line is Sephardic, converted to Christianity what allowed they live in Finland and they have kep it family secret in centuries. They would hope even now that I would not talk about it) line most likely be Jews is my granfather. He was circumcised. It wasnt done medical reasons. It was done when he was baby and he never understand it why. He must of guess. There is also the history: The first Finnish Jews were Russian soldiers.

Short Finland`s history jewish point "Finland was part of the Swedish monarchy until the early 19th century and forbade Jews from living within its borders until the mid-19th century.Under Swedish law, Jews of that period were allowed to settle only in three major towns in the Kingdom, none of them being situated in the territory of Finland. In 1809, as a consequence of the defeat of Sweden in the Russian-Swedish war of 1808-9, part of the Napoleonic Wars, Sweden lost control of Finland and an autonomous Grand Duchy of Finland was established within the Russian Empire. The Swedish constitution and legal system was, however, maintained in the Grand Duchy, and the prohibition on Jewish settlement in Finland thus continued. Finnish Jewish history effectively began in the first half of the 19th century when Jewish soldiers (so-called cantonists), who served in the Russian Army in Finland, were permitted to stay in Finland by the Russian military authorities following the soldiers' discharge. Subsequently, the presence of Jews in the country was governed by the decree of 1858, under which discharged Russian soldiers and their families, without regard to their religion, were allowed to stay temporarily in Finland. The occupations open to discharged soldiers were defined in a decree of 1869 which was applied also to soldiers of Jewish origin. Jews conscripted to the Russian Army within Finland were not allowed to return to Finland after their discharge.

By the end of the 1880s there were about a thousand Jews resident in Finland. It was not until 1917, when Finland became independent, that the Jews received civil rights. On 22 December 1917, Parliament approved an Act concerning "Mosaic Confessors," and on 12 January 1918 the Act was promulgated. Under the Act, Jews could for the first time become Finnish nationals.

Geno 2.0 answers my map ends in Branch L278 (Is it in different form in FTDNA SNP map?????)
But that would gesture that others traveled west into Central Asia, others moved south toward the Levant region (according National Geographic).

But this is all so new to me and I have so much to learn. I follow these discussions cause it`s the only way to learn. But I have nothing to give these discussion but what I think of.

JärvinenT
01-28-2014, 10:12 AM
I appreciate everyone of you what you think and say. It`s important to me that you who know so much and have knowledge that I dont have discuss, eaven depate. I apologize if I said something stupid things. I am newborn and my English could be bad sometimes. It`s not my native language.

There is my SNP answers: 300134. I must admit that the answers arent tell me yet alot. Cause I dont understand it all.
http://www.semargl.me/de/dna/ydna/item-snp/2245/

Silly observation:I have to admit that the results are surprising, not least because we do not look at all dark. We are completely opposites (light skin, blue eyes and I have original blond hair and my brother is red head, and my youngest brother had dark brown hair. Both my brother have curl bend hair). But appearance does not seem to matter in Genetics.

Oh and I join this R1b1a2 (P312- U106-) DNA Project (aka ht35 Project)? But before I wasn`t sure is that right for me?

Humanist
01-28-2014, 10:37 AM
Silly observation:I have to admit that the results are surprising, not least because we do not look at all dark.

Hi JärvinenT. Thank you very much for sharing your fascinating story with us. Some Russian Jews could be rather "European" in appearance. Even if they were recent arrivals from the Middle East. I am from the Middle East, and I am not (http://www.anthrogenica.com/showthread.php?1513-Photos-From-Your-Childhood&p=17574&viewfull=1#post17574) what many would consider very dark. So, if one had three northern European grandparents, and one Russian Jewish grandparent, I would anticipate a child with light features.

JärvinenT
01-28-2014, 11:30 AM
Hi JärvinenT. Thank you very much for sharing your fascinating story with us. Some Russian Jews could be rather "European" in appearance. Even if they were recent arrivals from the Middle East. I am from the Middle East, and I am not (http://www.anthrogenica.com/showthread.php?1513-Photos-From-Your-Childhood&p=17574&viewfull=1#post17574) what many would consider very dark. So, if one had three northern European grandparents, and one Russian Jewish grandparent, I would anticipate a child with light features.

Your picture was beautiful. My granmother was blond like me. My parent`s were blond in child but they get darker in adult age. I am still very blond and I have light skin (and I dont blond my hair eaven people think so). Most of my relatives are dark/black hear (only few blonds). But no one is like my brother =D with red head and light skin. =D

ADW_1981
01-28-2014, 01:13 PM
Hi everyone
I am 300134 Järvinen Leo Nikolai, familyname unknown b.1917 and d.1999 Finland R1b1a2a1.
These things are pretty new to me. I try to discover my paternal line, cause I know only of a little bit of the roots of my father - line. My brother take the test. My paternal line history end`s my granfather Leo Nikolai. I know he`s father was Russian Tzar officer, who name we don`t know. My granfather born in Finland (first paternal line member in Finland) 1917 just before Finland`s independency and civil war and time Russian`s revolution. Granfather never knew he`s parent`s and crow up as an orphan. He`s paternal line seem to come fron Russia. He got the familyname Koskinen (a modified Abelson name in the beginning 1900) to he`s mother. Who died when he was small child. He`s father was most likely Jew, cause some thing`s coul not explain other wise. Many Russian officer`s were Jews.

My Geno 2.0 and FTDNA answers are confusing. I dont understand my answers, maby cause there isn`t lot about information these mutations. Imformation I only have from National Geographic says
"Branch L278, Age: To Be Determined,Location of Origin: West Asia
While some from this group traveled west into Central Asia, others moved south toward the Levant region. Today, they are present in trace frequencies of less than 1 percent in Italy, the Ukraine, and the region of the Pannonian Basin. Note: This branch is not accompanied by a major movement on the map, and research on this branch is continuing.
Those who belong to this lineage but do not belong to a descendant branch are rare."

But you must of known this already. I have been told that Z2103+ is not downstream from R-P312+ or R-U106+.

If you have taken 23andMe, you should know if you have some recent Ashkenazi ancestry. By the sheer number of cousins, this would be obvious. You could have more distant generic jewish ancestry directly through your YDNA line if you do not have 2000+ cousins at 23andMe, but it would be more ancient. As you might already know, the R1b1b2a lineage is shared by a minority of European men, but also Russian men too who may never have been jews. That said, I am fairly certain R1b was among the original Semitic/Afro-Asiatic speakers in some form.

Silesian
01-28-2014, 03:22 PM
Oh and I join this R1b1a2 (P312- U106-) DNA Project (aka ht35 Project)? But before I wasn`t sure is that right for me?

If you feel very strong for your Russian/Jewish heritage than you can also join the Belorussian project you will be number 7# cluster.
http://www.familytreedna.com/public/belarus/default.aspx?section=yresults

Silesian
01-28-2014, 03:24 PM
That said, I am fairly certain R1b was among the original Semitic/Afro-Asiatic speakers in some form.
You mean like Haddad[R1a}?

Humanist
01-28-2014, 04:59 PM
That said, I am fairly certain R1b was among the original Semitic/Afro-Asiatic speakers in some form.

You mean like Haddad[R1a}?

As stated before, Haddad's paternal line is Chaldean Catholic from Mosul (~Nineveh). It was not necessarily "among the original Semitic/Afro-Asiatic speakers." Based on modern distributions, it is more likely that his line entered our (Assyrian/Chaldean) community from the east. Perhaps an Indo-Iranian-speaking person.

Silesian
01-28-2014, 05:16 PM
As stated before, Haddad's paternal line is Chaldean Catholic from Mosul (~Nineveh). It was not necessarily "among the original Semitic/Afro-Asiatic speakers." Based on modern distributions, it is more likely that his line entered our (Assyrian/Chaldean) community from the east. Perhaps an Indo-Iranian-speaking person.
Okay thanks, I told everyone already I'm not the sharpest tool in the shed, our Northern Scythian clans of R1b Z2103 who slurp water and ice slushy, out of the garden hose on a cold winters day and have oral traditions of our ancestors not practicing genital mutilation have a hard time understanding these concepts. Thanks for the insight and warnings, much appreciated,. :beerchug:

newtoboard
01-28-2014, 05:20 PM
That maybe, but this is a R1b thread and I can only comment on things I know, like the samples found in Kromsdorf and Eastern Europe, and myself, autosomal shows ANE and Ural[Eurogenes K12 calculator in my signature]. From where does Volga-Ural come from, R1a Z283 R1a 93? Or from R1b Z2103 R1b M73 Bashkir found in Ural
http://www.familytreedna.com/public/Bashqort_Clans/

There really is no need to bring up Scythians. The idea that Scythians left behind significant ancestry in a Eastern Europe is outdated. Almost none of the R1b and R1a in Eastern Europe has anything to do with a Scythians.

Humanist
01-28-2014, 05:22 PM
Okay thanks, I told everyone already I'm not the sharpest tool in the shed, our Northern Scythian clans of R1b Z2103 who slurp water out of the garden hose on a cold winters day and have oral traditions of our ancestors not practicing genital mutilation have a hard time understanding these concepts. Thanks for the insight careful warnings much appreciated,. :beerchug:

Please cease the sarcasm, and the devoid of content posts.

newtoboard
01-28-2014, 05:34 PM
Maybe some Scythians carried R1b (I doubt it) but it's unlikely they did until they crossed the Don or Dnieper river. They originated in Central Asia not Europe.

Silesian
01-28-2014, 05:37 PM
There really is no need to bring up Scythians. The idea that Scythians left behind significant ancestry in a Eastern Europe is outdated. Almost none of the R1b and R1a in Eastern Europe has anything to do with a Scythians.
I'm just saying everyone can provide oral and written testimony about their heritage, mine happen to be R1b Z2103/Z2105 Scythian also known as Aškuz[not to be mistaken for Ashkenaz] to the Aššur clan they were also found around lake Urmia perhaps we may one day find out if the R1b in that region are connected to the Northern R1b Z2103/Z2105 found in Scythian/Aškuz decsendants.

newtoboard
01-28-2014, 05:39 PM
I'm just saying everyone can provide oral and written testimony about their heritage, mine happen to be R1b Z2103/Z2105 Scythian also known as Aškuz[not to be mistaken for Ashkenaz] to the Aššur clan they were also found around lake Urmia perhaps we may one day find out if the R1b in that region are connected to the Northern R1b Z2103/Z2105 found in Scythian decsendants.

Sorry but a bunch of oral stories and similar sounding clan names is not evidence of anything. You are not a Scythian. Aren't you just a German or Pole?

Silesian
01-28-2014, 05:44 PM
Maybe some Scythians carried R1b (I doubt it) but it's unlikely they did until they crossed the Don or Dnieper river. They originated in Central Asia not Europe.
I don't see anything wrong with associating the main branch of the Scythians with R1a and a minor branch/tribe with R1b, after all there is a common kinship in heritage and language on many levels not shared with other branches like G J I C; do you really believe that R1a-R1b have deep ancestral roots in Levant and the Arabian peninsula? Unless of course you are contemplating the Italian refugium theory.

Silesian
01-28-2014, 05:48 PM
There really is no need to bring up Scythians. The idea that Scythians left behind significant ancestry in a Eastern Europe is outdated. Almost none of the R1b and R1a in Eastern Europe has anything to do with a Scythians.
Yes you are correct; 70/30 Slav/German with heavy bias towards Carpithian and Ukraine region on both 23andme and ydna str matches.

/

newtoboard
01-28-2014, 05:57 PM
I don't see anything wrong with associating the main branch of the Scythians with R1a and a minor branch/tribe with R1b, after all there is a common kinship in heritage and language on many levels not shared with other branches like G J I C; do you really believe that R1a-R1b have deep ancestral roots in Levant and the Arabian peninsula? Unless of course you are contemplating the Italian refugium theory.

I never said anything about Arabia, the Levant or Italy.

Yes there is a problem with associating a minor branch with R1b when there isn't much evidence for it. Do you see anybody associating a minor branch of Celts with R1a. It's a continuum in a way. The mixed R1a/R1b groups are in the middle. On one side Celts with no R1a, italic /Balkan speakers with a very tiny amount of R1a, Germanic speakers with more R1b but still a decent amount of R1a and Balto-Slavs with a tiny but of R1b, and Scythians with no R1b.

My other issue is that even if some Scythians carried R1b,which I admit might have happened, they picked this lineage up from other IE speakers. Not to mention nothing would support European R1b descending from Scythians since Scythians were absorbed by Turks and for every R1b lineage they would have left behind they would left multiple R1a lineages behind and that doesn't seem to be the case.

Silesian
01-28-2014, 06:14 PM
I never said anything about Arabia, the Levant or Italy.
We have this debate before so I just wanted to make you aware that I find it extremely unrealistic that any branch of R1a or R1a derive from these regions G, I/J, E . I may change my mind if we get King Tuts results and he ends up being in some Western European R1b clad.


Yes there is a problem with associating a minor branch with R1b when there isn't much evidence for it. Do you see anybody associating a minor branch of Celts with R1a. It's a continuum in a way. The mixed R1a/R1b groups are in the middle. On one side Celts with no R1a, italic /Balkan speakers with a very tiny amount of R1a, Germanic speakers with more R1b but still a decent amount of R1a and Balto-Slavs with a tiny but of R1b, and Scythians with no R1b. In my opinion what you are describing is the process of P.I.E dispersal which no one has a good explanation; in my opinion of course.


My other issue is that even if some Scythians carried R1b,which I admit might have happened, they picked this lineage up from other IE speakers. Not to mention nothing would support European R1b descending from Scythians since Scythians were absorbed by Turks and for every R1b lineage they would have left behind they would left multiple R1a lineages behind and that doesn't seem to be the case.
I don't make a distinction between R1b and R1a Scythian/Aškuz tribes, in my opinion they were at some point all speaking I.E branches, even R1b Z2103/Z2105

Silesian
01-28-2014, 06:35 PM
My other issue is that even if some Scythians carried R1b,which I admit might have happened, they picked this lineage up from other IE speakers. Not to mention nothing would support European R1b descending from Scythians since Scythians were absorbed by Turks and for every R1b lineage they would have left behind they would left multiple R1a lineages behind and that doesn't seem to be the case.

Do you have any issues with calling R1b Ashkuza or Ishhuza they must have been in relative close proximity to the Assyrians?

. The Assyrians of the time of Esarhaddon record campaigning against a people they called in the Akkadian the Ashkuza or Ishhuza.[7]

Humanist
01-28-2014, 06:39 PM
Do you have any issues with calling R1b Ashkuza or Ishhuza they must have been in relative close proximity to the Assyrians?

They were not only in proximity to the Assyrians, but both Scythians and Cimmerians served as auxiliaries in the Neo-Assyrian Army.

Joe B
01-28-2014, 06:48 PM
I appreciate everyone of you what you think and say. It`s important to me that you who know so much and have knowledge that I dont have discuss, eaven depate. I apologize if I said something stupid things. I am newborn and my English could be bad sometimes. It`s not my native language.

There is my SNP answers: 300134. I must admit that the answers arent tell me yet alot. Cause I dont understand it all.
http://www.semargl.me/de/dna/ydna/item-snp/2245/

Silly observation:I have to admit that the results are surprising, not least because we do not look at all dark. We are completely opposites (light skin, blue eyes and I have original blond hair and my brother is red head, and my youngest brother had dark brown hair. Both my brother have curl bend hair). But appearance does not seem to matter in Genetics.

Oh and I join this R1b1a2 (P312- U106-) DNA Project (aka ht35 Project)? But before I wasn`t sure is that right for me?
@JärvinenT
I want to apologize for some of the content that followed your very important family history. A new CTS7822/Z2110 thread will start soon. Please stay with us, you're doing great.
Joe

Joe B
01-29-2014, 04:29 AM
Received my CTS7822/Z2110 results from Yseq.net (http://www.yseq.net/) this evening. It's more information than was expected. Any good thoughts would be appreciated.

My Allele Results
Marker+ ..Chr ....Start ....End ....Allele....Mutation*
CTS7822 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=CTS7822) ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684619..17684779) 17684699 17684699 A- ....(A->T*)
CTS7823 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=CTS7823) ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684637..17684797) 17684717 17684717 T- ....(T->G*)
M4203 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=M4203)....ChrY (ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684644..17684804) 17684724 17684724 A- ....(A->G*)
M8817 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=M8817)....ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684637..17684797) 17684717 17684717 T- ....(T->G*)
Z2110 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=Z2110)....ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684619..17684779) 17684699 17684699 A- ....(A->T*)


*ISOGG SNP Compendium Spreadsheet/Y-DNA SNP Index - 2014 (http://www.isogg.org/tree/ISOGG_YDNA_SNP_Index.html)

smal
01-29-2014, 07:33 AM
You are CTS7822/Z2010-.
CTS7823, M8817 and M4203 are not important for Z2103 line. All Z2103+ samples in 1KGP are negative for these SNPs.

Joe B
01-29-2014, 07:57 AM
You are CTS7822/Z2110-.
CTS7823, M8817 and M4203 are not important for Z2103 line. All Z2103+ samples in 1KGP are negative for these SNPs.Is testing M4203 and CTS7823/M8817 on purpose or are those SNP results just part of testing CTS7822/Z2110?
How do you want Yseq SNP results for the database?

Rathna
01-29-2014, 08:52 AM
Received my CTS7822/Z2110 results from Yseq.net (http://www.yseq.net/) this evening. It's more information than was expected. Any good thoughts would be appreciated.

My Allele Results
Marker+ ..Chr ....Start ....End ....Allele....Mutation*
CTS7822 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=CTS7822) ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684619..17684779) 17684699 17684699 A- ....(A->T*)
CTS7823 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=CTS7823) ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684637..17684797) 17684717 17684717 T- ....(T->G*)
M4203 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=M4203)....ChrY (ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684644..17684804) 17684724 17684724 A- ....(A->G*)
M8817 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=M8817)....ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684637..17684797) 17684717 17684717 T- ....(T->G*)
Z2110 (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=Z2110)....ChrY (http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/?name=ChrY:17684619..17684779) 17684699 17684699 A- ....(A->T*)


*ISOGG SNP Compendium Spreadsheet/Y-DNA SNP Index - 2014 (http://www.isogg.org/tree/ISOGG_YDNA_SNP_Index.html)

I have examined Bork's haplotype in a thread I dedicated to him and he disliked. His values are in the norm of the others, but with two interesting mutations in very slow mutating markers: DYS436=13 from 12 and DYS640=13 from 12. With DYS436=13 I have found only these samples in the "ht 35 FTDNA Project":
257842 Helmut Bork 1931 - 1983 Darmstadt, Germany Germany R1b1a2a1
12 24 14 10 11-14 12 12 13 13 13 29 17 9-10 11 11 26 15 19 30 14-15-16-17 10 12 18-23 15 17 19 16 35-39 12 12 11 9 15-16 8 10 10 8 10 11 12 23-23 16 10 13 12 15 8 12 23 20 13 12 11 13 11 12 12 12 33 15 9 16 12 26 25 19 13 11 12 12 10 9 11 12 10 11 11 30 12 13 23 15 10 11 21 15 19 13 24 17 13 15 24 12 24 18 10 14 17 9 11 11
149195 Mardakhanian Turkey R1b1a2a
12 25 13 11 11-14 12 12 12 13 13 30 16 7-10 11 11 25 15 20 30 15-15-17-18 11 12 19-23 15 15 20 16 36-39 12 12 11 10 15-16 8 10 11 8 11 11 12 23-23 16 10 13 12 16 8 11 22 21 13 12 11 13 12 11 12 12
5215 George Sloan b. ca 1720 nr Armagh and d. 1803 Northern Ireland R1b1a2
13 24 14 11 11-14 12 12 12 13 14 29 18 9-10 11 11 25 15 19 29 14-15-16-17 11 11 19-23 16 16 20 17 37-37 12 12 11 9 15-16 8 10 10 8 10 10 12 23-23 16 10 13 12 15 8 12 23 20 13 12 11 13 11 11 12 12
250191 William Wishart (d.1786 Tabusintac, New Brunswick) Scotland R1b1a2
14 24 15 10 11-14 12 12 12 13 13 29 16 9-10 11 11 26 15 19 29 15-15-15-18 11 11 19-23 16 15 18 18 35-38 12 12 11 9 15-16 8 10 10 8 10 11 12 23-23 16 10 13 12 15 0 12 24 20 15 12 11 13 11 11 12 12
299810 Armenia R1b1a2
12 23 14 11 11-16 12 12 12 13 15 28 17 9-10 11 11 25 15 19 27 15-15-16-19 10 11 19-22 16 16 18 18 36-39 11 12 11 9 15-17 8 10 10 8 10 10 12 23-23 16 10 13 12 15 8 12 22 20 13 12 11 13 11 11 12 12
B6530 Isaac Stedman (1605-1678), b. Biddenden, Kent England R1b1a2a1a1
13 24 14 10 12-14 12 12 12 12 13 27 17 9-10 11 11 26 15 19 31 16-16-16-18 11 11 19-23 14 15 18 17 37-38 12 12 11 9 15-16 8 10 10 8 11 10 12 23-23 16 11 13 12 15 8 11 23 20 14 12 11 13 11 11 12 12
Thus a mutation very rare and not all these samples belong to R-L23, perhaps only those with DYS393=12, and they are all Armenians, even though very different in the two series:
Bork
8 10 10 8 10 11
11 13 11 12 12 12
Mardakhanian
8 10 11 8 11 11
11 13 12 11 12 12
299810 Armenian
8 10 10 8 10 10
11 13 11 11 12 12
We don't know if these haplotype are unified by the mutation DYS436=13, which could be very ancient, also more than the mutations in these very slow markers, because DYS436 is one of the slowest markers. And that Armenians get a highest variance in R-L23 is known. What to say? That this could be another line (of some others to be discovered) under Z2103/Z2105*, and we have in the smal's tree other Geno 2.0 tested people which aren't put in these three lines (if L277 will be unified with that of the Tuscan NA20532, what we don't know so far), even though some of them aren't tested for L277 and L584, whereas Bork is and is negative.

In the letters that are deleted I wrote that to do Chromo2 would be better, because Bork would have had more answers. Perhaps Thomas Krahn could say something, also about M4203, not comprised in the "daver compendium".

Joe B
01-29-2014, 09:03 PM
I have examined Bork's haplotype in a thread I dedicated to him and he disliked. His values are in the norm of the others, but with two interesting mutations in very slow mutating markers:
In the letters that are deleted I wrote that to do Chromo2 would be better, because Bork would have had more answers. Perhaps Thomas Krahn could say something, also about M4203, not comprised in the "daver compendium".
Your comparisons to my haplotype have nothing to do with CTS7822. To focus in on one or two STR markers across haplogroups(R1b1a2a1a1?) does not fit the science as we know it. It's very obvious that the R1b-Z2103 haplogroup has no shortage of off modal slow mutating markers. Some of them may be very recent mutations as we do see them in father-son comparisons.
My preference is that you stop examining my specific haplotype, that's my job. The only purpose for posting was to let everyone see what CTS7822/Z2110 results from YSEQ.net looked like.
I am very happy with Thomas Krahn/YSEQ and think it is the better choice than Chromo 2 for myself. Certainly fewer problems and quicker results. For others, Geno 2.0 or Chromo 2 may be just fine.
M4203 can be found in the ISOGG SNP Compendium Spreadsheet.
Peace Out

Cofgene
01-30-2014, 12:11 AM
Is testing M4203 and CTS7823/M8817 on purpose or are those SNP results just part of testing CTS7822/Z2110?
How do you want Yseq SNP results for the database?

Just part of testing for Z2110. They are all present in the same segment of DNA that was sequenced. 1 primer pair can be used to read 3 different SNPs.

Rathna
01-30-2014, 01:19 AM
Just part of testing for Z2110. They are all present in the same segment of DNA that was sequenced. 1 primer pair can be used to read 3 different SNPs.

They are within a string of 26bp: 17684699 -17684724.

Silesian
01-30-2014, 06:27 PM
@JärvinenT
I want to apologize for some of the content that followed your very important family history. A new CTS7822/Z2110 thread will start soon. Please stay with us, you're doing great.
Joe

We are now have our R1b Z2103 Z2105 clades from samples from different areas Eurogenes has designed ANE marker, Humanist's [Assyrian samples]/Kostop-Greece/JärvinenT-Finland Jewish/Bork Germany/Silesia/Italy, why not choose autosomal to see how we differ or are the same for example let us all post our ANE scores in one thread? Since ANE was linked to an extinct branch R in Mal'ta.

Rathna
01-30-2014, 07:37 PM
We are now have our R1b Z2103 Z2105 clades from samples from different areas Eurogenes has designed ANE marker, Humanist's [Assyrian samples]/Kostop-Greece/JärvinenT-Finland Jewish/Bork Germany/Silesia/Italy, why not choose autosomal to see how we differ or are the same for example let us all post our ANE scores in one thread? Since ANE was linked to an extinct branch R in Mal'ta.


Silesian, I have just yesterday shared my 23andMe with Ware (an African American R-Z2110* from the British Z2110 I suspect now of probably Roman descent at the time of the Roman Empire) and of course we haven’t any percentage in common in the IBD.
The link of the Z2110* is very far, at least thousands of years, and of course we have in common only the Y (with relative mutations). Central-Eastern Europeans are probably CTS9219, and they are much further.

kostop
01-31-2014, 11:46 AM
We are now have our R1b Z2103 Z2105 clades from samples from different areas Eurogenes has designed ANE marker, Humanist's [Assyrian samples]/Kostop-Greece/JärvinenT-Finland Jewish/Bork Germany/Silesia/Italy, why not choose autosomal to see how we differ or are the same for example let us all post our ANE scores in one thread? Since ANE was linked to an extinct branch R in Mal'ta.

Below are my Dodecad Globe4 and Globe13 results. If my understanding is correct they do not mean much, since I am a Geno2 customer and the Dodecad calculators are primarily designed for 23andMe customers, hence they only test around 20K common SNPs comparing to a potential 150K. Any help finding a calculator more suitable for Geno2 would be much appreciated.

Also, I don't understand how Globe4 finds me 5.53% Amerindian when Globe13 finds me 0.37% Amerindian?? It doesn't make sense and (unless I am doing something wrong) I believe it is because of the narrow range of SNPs taken into account.

Globe4:
93.80% European
0.67% Asian
0.00% African
5.53% Amerindian

Globe13:
35.85% Mediterranean
31.51% North_European
17.51% West_Asian
13.36% Southwest_Asian
1.13% Siberian
0.37% Amerindian
0.27% Arctic
0.00% West_African
0.00% Palaeo_African
0.00% East_Asian
0.00% Australasian
0.00% South_Asian
0.00% East_African

JärvinenT
01-31-2014, 03:17 PM
Below are my Dodecad Globe4 and Globe13 results. If my understanding is correct they do not mean much, since I am a Geno2 customer and the Dodecad calculators are primarily designed for 23andMe customers, hence they only test around 20K common SNPs comparing to a potential 150K. Any help finding a calculator more suitable for Geno2 would be much appreciated.

Globe4:
93.80% European
0.67% Asian
0.00% African
5.53% Amerindian

Globe13:
35.85% Mediterranean
31.51% North_European
17.51% West_Asian
13.36% Southwest_Asian
1.13% Siberian
0.37% Amerindian
0.27% Arctic
0.00% West_African
0.00% Palaeo_African
0.00% East_Asian
0.00% Australasian
0.00% South_Asian
0.00% East_African

In facetube =) R1b groub someone recommended This
http://www.y-str.org/tools/diy-dodecad-wrapper/
I havent tested it

Silesian
01-31-2014, 03:40 PM
Below are my Dodecad Globe4 and Globe13 results. If my understanding is correct they do not mean much, since I am a Geno2 customer and the Dodecad calculators are primarily designed for 23andMe customers, hence they only test around 20K common SNPs comparing to a potential 150K. Any help finding a calculator more suitable for Geno2 would be much appreciated.

Globe4:
93.80% European
0.67% Asian
0.00% African
5.53% Amerindian

Globe13:
35.85% Mediterranean
31.51% North_European
17.51% West_Asian
13.36% Southwest_Asian
1.13% Siberian
0.37% Amerindian
0.27% Arctic
0.00% West_African
0.00% Palaeo_African
0.00% East_Asian
0.00% Australasian
0.00% South_Asian
0.00% East_African

Thanks Kostop that is really great 1.13% any idea where your Siberian is from?

JärvinenT
01-31-2014, 03:54 PM
The Geno 2.0 results of 300134 Järvinen have appeared. He has CTS7822+ CTS9219+ haplotype. He is also CTS8749+. CTS8749 is strange, it is available in different haplogroups.

So what is this CTS8749?

I use semargl.me to find that is enyone share it and no :)
http://www.semargl.me/de/dna/ydna/item-snp/5952/
Maby thats not inportant, but it makes me wonder and I´m frustrated my answers.

Silesian
01-31-2014, 04:32 PM
So what is this CTS8749?

I use semargl.me to find that is enyone share it and no :)
http://www.semargl.me/de/dna/ydna/item-snp/5952/
Maby thats not inportant, but it makes me wonder and I´m frustrated my answers.

Everything is important. Is there any information in Finnish on the Komi R1b samples and Chinese Hui/Han R1b? Rathna has always speculated that the Chinese samples may be from the West.

Rathna
01-31-2014, 05:14 PM
Is there any information in Finnish on the Komi R1b samples and Chinese Hui/Han R1b? Rathna has always speculated that the Chinese samples may be from the West.

There is a Hui who matches me on the STRs. As my haplotype is very rare amongst the R-Z2110 (DYS19=15, DYS391=10 etc.) and I have not more than 18 matches on YHRD, and the Hui is the unique in East Asia and also in Central Asia, what should I think?
The other Chinese in 1KGP (NA18645) belongs to a subclade of R-Z2106 with the mutations CTS7763 and CTS8966 in common with 164226 from Caucasus, what should I think? That probably these Chinese R-L23 come at least from Caucasus. We'll see from next tests if the numerous haplogroups in common between Italy and Armenia do come from the Alps or from Caucasus.

Silesian
01-31-2014, 06:01 PM
There is a Hui who matches me on the STRs. As my haplotype is very rare amongst the R-Z2110 (DYS19=15, DYS391=10 etc.) and I have not more than 18 matches on YHRD, and the Hui is the unique in East Asia and also in Central Asia, what should I think?
The other Chinese in 1KGP (NA18645) belongs to a subclade of R-Z2106 with the mutations CTS7763 and CTS8966 in common with 164226 from Caucasus, what should I think? That probably these Chinese R-L23 come at least from Caucasus. We'll see from next tests if the numerous haplogroups in common between Italy and Armenia do come from the Alps or from Caucasus.
Can you contact him, I would like to help him $ to get fully tested to confirm your theory?

Joe B
01-31-2014, 06:17 PM
So what is this CTS8749?

I use semargl.me to find that is enyone share it and no :)
http://www.semargl.me/de/dna/ydna/item-snp/5952/
Maby thats not inportant, but it makes me wonder and I´m frustrated my answers.
JärvinenT,
CTS8749 may or may not be important. Only when enough other results come in and a pattern develops will we know.
The probable next SNPs for investigation for the CTS7822+ CTS9219+ haplogroup are CTS7959, CTS9230 and CTS11767. smal has more information on these SNPs. Primers can be setup at YSEQ (http://www.yseq.net/) if anybody want to test them.

kostop
01-31-2014, 06:31 PM
Thanks Kostop that is really great 1.13% any idea where your Siberian is from?

No idea, I never paid too much attention, because of the limitations of this calculator when processing Geno2 results, and the low percentage.
My Geno2 admixture results (that take the whole number of SNPs tested into account) do not include it at all, they only include Mediterranean, North European and West Asian ancestry.

Rathna
01-31-2014, 08:44 PM
Can you contact him, I would like to help him $ to get fully tested to confirm your theory?

Silesian, you know that unfortunately it isn't possible to contact these people, neither those of SMGF nor of the YHRD nor those tested on blind in all the researches. I have a match amongst the people tested in Modena province by Dr Ferri et alii but he was so kind to answer a letter of mine, but saying that it wasn't possible to contact that person.
I think we are lucky to have the people tested in the 1KGP, whose we know the genome, and now, like I did for the data released, the STRs (see the Tuscan NA20532 and the Indian NA20866).

JärvinenT
02-01-2014, 11:42 AM
Everything is important. Is there any information in Finnish on the Komi R1b samples and Chinese Hui/Han R1b? Rathna has always speculated that the Chinese samples may be from the West.

No there is only little information in Finnish (maby because most Finns are N or H or J) , but I can read English better than write it. Geno 2 answers (todether paternal and maternal: V2a1a) make us most at British and second a Finn =D,

Northern European 48%, Mediterranean 26% ,Southwest Asian 16%, Northeast Asian 4% and Native American 4% (but there was note that: This doesn’t mean that you belong to these groups, only that these were the groups in our 43 reference populations that were closest to you.). It must mess up my answers cause there is only few that has similaritys our paternal line.

JärvinenT
02-01-2014, 12:44 PM
There is a Hui who matches me on the STRs. As my haplotype is very rare amongst the R-Z2110 (DYS19=15, DYS391=10 etc.) and I have not more than 18 matches on YHRD, and the Hui is the unique in East Asia and also in Central Asia, what should I think?
The other Chinese in 1KGP (NA18645) belongs to a subclade of R-Z2106 with the mutations CTS7763 and CTS8966 in common with 164226 from Caucasus, what should I think? That probably these Chinese R-L23 come at least from Caucasus. We'll see from next tests if the numerous haplogroups in common between Italy and Armenia do come from the Alps or from Caucasus.

I think something special happend between Italy and Armenia (new branch was born). Pannonian Basin is associated with our paternal stories. I think so cause my paternal story ended there according to scientists and also because similar answers has only found in Italy, the Ukraine and there middle of Alps and carpathians.
http://www.mantleplumes.org/images3/PannomianFig1_600.jpg
Also I tink my branch started Levant area, yours too (ended beautiful Italy)? my line ended (cold Finland at last).
http://upload.wikimedia.org/wikipedia/commons/a/aa/The_Levant_3.png
This group in our line were first in China,Japan and mongolia -area before went Levant region. I was 4%from China,Japanice, mongolia too and 4 % Native american Indian.

I probably write something stupid. Sorry If I do that.

I also did not have any matches in FTDNA. I was think that is weard. It`s also interesting what are we what is to be discovered.

JärvinenT
02-01-2014, 12:50 PM
JärvinenT,
CTS8749 may or may not be important. Only when enough other results come in and a pattern develops will we know.
The probable next SNPs for investigation for the CTS7822+ CTS9219+ haplogroup are CTS7959, CTS9230 and CTS11767. smal has more information on these SNPs. Primers can be setup at YSEQ (http://www.yseq.net/) if anybody want to test them.

I should be more patient and hope others would test. Thats not easy for me: to wait.

Rathna
02-01-2014, 02:29 PM
I think something special happend between Italy and Armenia (new branch was born). Pannonian Basin is associated with our paternal stories. I think so cause my paternal story ended there according to scientists and also because similar answers has only found in Italy, the Ukraine and there middle of Alps and carpathians.
http://www.mantleplumes.org/images3/PannomianFig1_600.jpg
Also I tink my branch started Levant area, yours too (ended beautiful Italy)? my line ended (cold Finland at last).
http://upload.wikimedia.org/wikipedia/commons/a/aa/The_Levant_3.png
This group in our line were first in China,Japan and mongolia -area before went Levant region. I was 4%from China,Japanice, mongolia too and 4 % Native american Indian.

I probably write something stupid. Sorry If I do that.

I also did not have any matches in FTDNA. I was think that is weard. It`s also interesting what are we what is to be discovered.

This is just what we are trying to understand, and from many years and many thousands of letters, but this should come out from scientific inquires and not ideological or religious ones.
1) the idea of an origin from Middle East (or Near East if others prefer), that I am contrasting from years, and that is that of the R1b projects of FTDNA, has probably more ideological or religious reasons than scientific ones, even though, of course, merits to be taken in consideration and discussed, but papers demonstrated already many years ago that there weren't R-M269* in Middle East shores, only this Jewish cluster that now has been demonstrated R-M269+/L150+/PF7558+/PF7562+/PF7563+, but diffused in Europe from the Balkans to the Isles and with higher variance (the Jewish cluster is practically only one haplotype). There is in Middle East R-V88+, but, apart the subclade V69 come from North Africa, the two main clusters of the Jewish pool are closely linked to the Iberian ones and with 24 PF SNPs found firstly in Sardinia. I have many doubts that its origin is in Middle East.
About R1b1* there is also here a Jewish cluster with many components, but also here one only haplotype, whereas I am trying to demonstrate from years that Italy has the highest variance. These are the R1b1* with L388/L389+. The Indian ones tested so far are definitely L388/L389-, thus not our ancestors. I am waiting that the Caucasian haplotypes are tested for L388/L389 and not only for P25.
2) The R1b in Middle East/ Caucasus is above all from Armenians, and we should understand where they come from, as many think that their Indo-European language and perhaps their R1b came from the Balkans.
3) Of course the Caucasus remains for me one the most probable places for the origin of this haplogroup, with the Alpine zone of course.
4) About East Asia and Siberia we know that there has been some R* (not of our line) 24000 years ago, but about what has happened in the meantime we don't know anything at all. I don't believe that R1b has something to do with China.

newtoboard
02-01-2014, 02:42 PM
What is the evidence that R1b in the Middle East and Caucasus is above all from Armenians? There are probably more Iranian speakers who carry R1b than there are Armenians in the Middle East/Caucasus.

Rathna
02-01-2014, 02:47 PM
I should be more patient and hope others would test. Thats not easy for me: to wait.

CTS8749 is very likely a SNP downstream Z2110/CTS9219 in you line with many others to be discovered. Of course who gets it is closer to you. When all the possible SNPs will be discovered by a Full Y, we'll get our descent. Of couse so far we know only a few SNPs by Geno 2.0 or Chromo2. More with Big Y, and much more with the Full Y, even though neither this tests all the Y.
We know so far that my line and yours have the same SNPs upstream Z2110, but downstream they diverged (and if we could count all them we could calculate from how much time).
As others has been tested by Geno 2.0 and haven't your SNP, you may be sure that it is downstream CTS9219, whereas my 13 new SNPs (of course to be investigated) I don't know where to put if others of our haplogroup don't do Chromo2.

Rathna
02-01-2014, 02:56 PM
What is the evidence that R1b in the Middle East and Caucasus is above all from Armenians? There are probably more Iranian speakers who carry R1b than there are Armenians in the Middle East/Caucasus.

You know that the first R1b we knew came massively, as to regard Middle East, from Turkey, but their surnames are above all Armenian. If you look at the "ht 35 FTDNA Project", there are many people from Turkey but with an Armenian surname. R1b from Iran probably has been known more recently, even though I am extracting from so long Iranian R1b from SMGF and putting them in Ysearch. Probably many Iranian haplotypes has been known from my work.
And it seems that R1b isn't uniform in Iran: some people have many, others very few. Of course I should study them more carefully, but perhaps the Iranian people close to the Caspian Sea and the Caucasus have more, or am I wrong?
But if you have some suggestions, I am very glad to take them in due consideration.

newtoboard
02-01-2014, 03:00 PM
Of course Iranians near the Caucasus and Caspian have more R1b. That is where the majority of the population lives. But Lurs have a good amount too.

Rathna
02-01-2014, 03:07 PM
Of course Iranians near the Caucasus and Caspian have more R1b. That is where the majority of the population lives. But Lurs have a good amount too.
Unfortunately, if I remember well, many people from Iran I found on SMGF were anonymous, and couldn't be attributed to a people. I understand that there are probably reasons of persecution or others I don't know, but this doesn't help to make hypotheses about the origin of an haplogroup, and as I realize how many are wrong when they speak of Italy, because they don't know its history and its geography, so you could have many things to say about some hypothesis I could make about Iran. For this any suggestion of yours is well accepted.

Rathna
02-01-2014, 03:19 PM
STJ5A Anonymous from Iran Iran
12 23 15 10 11 14 12 12 13 12 13 28 15 9 10 11 11 25 15 19 30 14 14 16 17 10 12 17 24 15 12 12 11 11 12 23 10 13 12 12 14 30 24
EGJDN Trussell Frederick County, Virginia, USA
12 23 15 10 11 14 12 12 12 13 13 31 16 9 10 11 11 25 15 19 30 14 14 15 17 10 12 19 21 15 12 12 11 11 13 23 10 14 12 12 13 30 24
HFXBJ Del Badia Castelfiorentino, Italy
12 24 15 10 11 14 12 12 12 13 13 29 16 9 10 11 11 25 15 19 29 14 14 16 17 10 11 19 23 15 12 12 11 11 13 23 10 14 12 12 13 30 24
N92C5 Tognoni Italy
12 24 15 10 11 14 12 12 13 13 13 29 16 9 10 11 11 25 15 19 29 14 14 16 17 10 11 19 23 15 12 12 11 11 13 23 10 14 12 12 13 30 24
QA4AC Savi Soverzene, Belluno, Italy
12 24 14 10 11 14 12 12 13 13 13 29 17 9 9 11 11 25 15 19 29 14 14 16 16 10 12 19 22 14 11 12 11 11 13 23 10 13 12 12 14 30 24
ZHADK Yevdokimov North Caucasus (Kuban Region), Russia
12 24 15 10 11 14 12 12 12 13 13 29 16 9 10 11 11 25 15 19 31 14 15 16 18 10 10 19 23 15 12 12 12 11 12 23 10 14 13 12 14 30 24
This is an interesting haplotype of an Iranian, of course anonymous, I found on SMGF. Who are the closest to him? I, my relatives, and others. But the others come from Caucasus.

Rathna
02-01-2014, 04:59 PM
About Iranians I can say that the SNP L584 was discovered firstly because I invited an Iranian, a friend of mine, I knew in some forum even though I haven't news of him from so long, and I knew he did 23andMe, to send his data to "Adriano Squecco", and came out for the first time that SNP. I don't know if he has done after a STRs test. Anyway Iranians are certainly R-L584 and probably many other subclades, but, apart DMXX, I don't know any other from that country.

Silesian
02-01-2014, 05:08 PM
No there is only little information in Finnish (maby because most Finns are N or H or J) , but I can read English better than write it. Geno 2 answers (todether paternal and maternal: V2a1a) make us most at British and second a Finn =D,

Northern European 48%, Mediterranean 26% ,Southwest Asian 16%, Northeast Asian 4% and Native American 4% (but there was note that: This doesn’t mean that you belong to these groups, only that these were the groups in our 43 reference populations that were closest to you.). It must mess up my answers cause there is only few that has similaritys our paternal line.

Thanks JärvinenT now that you are part of our R1b clan :) can you give any information on your autosomal. For instance ANE, Siberian and or Ural scores.

Silesian
02-01-2014, 05:27 PM
What is the evidence that R1b in the Middle East and Caucasus is above all from Armenians? There are probably more Iranian speakers who carry R1b than there are Armenians in the Middle East/Caucasus.
Your quite right. However the largest study [data set] are the ones done on Armenians [N734] The study on some of the Iranians [Lurs/Talysh/Gilaki] are in the [N40-N50] range if my memory serves me correct.

Rathna
02-01-2014, 09:07 PM
About Iranians I can say that the SNP L584 was discovered firstly because I invited an Iranian, a friend of mine, I knew in some forum even though I haven't news of him from so long, and I knew he did 23andMe, to send his data to "Adriano Squecco", and came out for the first time that SNP. I don't know if he has done after a STRs test. Anyway Iranians are certainly R-L584 and probably many other subclades, but, apart DMXX, I don't know any other from that country.

Unfortunately I was wrong about Chitsaz: he is L277+ and not L584+, like I said in this old post: "Humanist, unfortunately I can’t see from my PC the “Adriano’s spreadsheet”, but I am seeing on Facebook that you have submitted not only yourself (G1) but two other Assyrians R1b1b2a/L23/rs9786602- like the Iranian Chitsatz. Then what I supposed, when Chitsatz by my invite submitted his V3 to “Adriano’s spreadsheet”, that there was an Iranian R-L23+ different from our Western one, is confirmed".

JärvinenT
02-03-2014, 03:47 PM
Thanks JärvinenT now that you are part of our R1b clan :) can you give any information on your autosomal. For instance ANE, Siberian and or Ural scores.

I have try to download my Autosomal raw data in readable form. I still have not managed to do that. I will try again later. Hope with better luck
You probably did not mean these results
England 6 30419 < 0.1 %
Germany 2 15541 < 0.1 %
Ireland 2 18653 < 0.1 %
Italy 3 4228 0,1%
Scotland 1 14470 < 0.1 %
Spain 2 4156 < 0.1 %
UK 5 12519 < 0.1 % MDKO: Mexico (1) Shetland Islands (1)
Wales 1 2562 < 0.1 %

Silesian
02-03-2014, 04:07 PM
I have try to download my Autosomal raw data in readable form. I still have not managed to do that. I will try again later. Hope with better luck
You probably did not mean these results
England 6 30419 < 0.1 %
Germany 2 15541 < 0.1 %
Ireland 2 18653 < 0.1 %
Italy 3 4228 0,1%
Scotland 1 14470 < 0.1 %
Spain 2 4156 < 0.1 %
UK 5 12519 < 0.1 % MDKO: Mexico (1) Shetland Islands (1)
Wales 1 2562 < 0.1 %

No, but thanks for trying, autosomal http://www.gedmatch.com/

Your str signature, it is very unique, have you entered them into ysearch?
http://www.ysearch.org/

Between our results and Nazarov-Urals[Cossak] we have quite a distance, yet we are all on the same Eatern R1b Z2103/z2105 branch. Hopefully we can also test Nazarov for autosomal also, I have not heard from him in a while.

JärvinenT
02-04-2014, 12:56 PM
No, but thanks for trying, autosomal http://www.gedmatch.com/

Your str signature, it is very unique, have you entered them into ysearch?
http://www.ysearch.org/

Between our results and Nazarov-Urals[Cossak] we have quite a distance, yet we are all on the same Eatern R1b Z2103/z2105 branch. Hopefully we can also test Nazarov for autosomal also, I have not heard from him in a while.

I have entered my results in Gedmatch (months ago) but I dont know how to use it. Can you help me and tell where in Gedmatch I can get only my kits results? I only find tools to compare the answers.

How is my STR signature unique? I have entered them in Ysearch. I havent use it some time now.

I hope for all of us that we soon get research-based information by geneticist.

Silesian
02-05-2014, 06:04 PM
How is my STR signature unique? I have entered them in Ysearch. I havent use it some time now.

You have the Slavic Eastern Europe[ Poland Ukraine] 464abcd 14/15/16/19
Here are your closest matches, like many of us, no real close matches maybe 1500- 2500+/- year;


User ID Last Name Origin Haplogroup Tested With Markers Compared Genetic Distance
F5DYR Finland R1b1a2 (tested) Family Tree DNA
QQUFE Drumhome Parish, Ireland R1b1a2a1 (tested) GD 13
QUH9X North Carolina, USA R1b1a2a1 (tested) GD 16
Z5PSZ Scotland R1b1a2 (tested) GD 17
P7U4J Woloshka, Ukraine Unknown GD 17
8U3YQ Staudernheim, Rheinland-Plalz, Germany R1b1a2a1 (tested)GD 19 X7KU2 (Przemysl), Poland R1b1a2a (tested) GD 19

Humanist
02-05-2014, 06:27 PM
You have the Slavic Eastern Europe[ Poland Ukraine] 464abcd 14/15/16/19
Here are your closest matches, like many of us, no real close matches maybe 1500- 2500+/- year;


User ID Last Name Origin Haplogroup Tested With Markers Compared Genetic Distance
F5DYR Finland R1b1a2 (tested) Family Tree DNA
QQUFE Drumhome Parish, Ireland R1b1a2a1 (tested) GD 13
QUH9X North Carolina, USA R1b1a2a1 (tested) GD 16
Z5PSZ Scotland R1b1a2 (tested) GD 17
P7U4J Woloshka, Ukraine Unknown GD 17
8U3YQ Staudernheim, Rheinland-Plalz, Germany R1b1a2a1 (tested)GD 19 X7KU2 (Przemysl), Poland R1b1a2a (tested) GD 19

I thought JärvinenT's paternal line was Russian Jewish?

Silesian
02-05-2014, 06:46 PM
I thought JärvinenT's paternal line was Russian Jewish?
It may very well be, however it does not belong to the two main Jewish clusters and there are not many Jewish R1b with DYS 464abcd 14/15/16/19 if any. You can check the Assyrian/Middle East projects also; he is most likely Z2103+ L277- L584- Slavic.
http://www.familytreedna.com/public/JewishR1b/default.aspx?section=yresults

I would guess Ukraine.

Humanist
02-05-2014, 07:05 PM
It may very well be, however it does not belong to the two main Jewish clusters and there are not many Jewish R1b with DYS 464abcd 14/15/16/19 if any. You can check the Assyrian/Middle East projects also; he is most likely Z2103+ L277- L584- Slavic.
Jewish R1b (http://www.familytreedna.com/public/JewishR1b/default.aspx?section=yresults)

OK. Thank you. We should also keep in mind, in my opinion, that millions of Jews were murdered not too long ago, when speaking of Jewish Y-DNA variability in Eastern Europe.

Wikipedia


Of the nine million Jews who had resided in Europe before the Holocaust, approximately two-thirds were killed.


Pre-war killed % kill Country
3300000 3000000 90 Poland
253000 228000 90 Baltic countries
240000 210000 90 Germany and Austria
90000 80000 89 Bohemia and Moravia

90000 75000 83 Slovakia

70000 54000 77 Greece
140000 105000 75 Netherlands
650000 450000 70 Hungary

375000 245000 65 Byelorussian SSR
1500000 900000 60 Ukrainian SSR
65000 40000 60 Belgium
43000 26000 60 Yugoslavia

600000 300000 50 Romania

2173 890 41 Norway

350000 90000 26 France
64000 14000 22 Bulgaria
40000 8000 20 Italy
5000 1000 20 Luxembourg

975000 107000 11 Russian SFSR

8000 52 <1 Denmark
8861800 5933900 67 Total

Joe B
02-05-2014, 07:42 PM
You have the Slavic Eastern Europe[ Poland Ukraine] 464abcd 14/15/16/19
Here are your closest matches, like many of us, no real close matches maybe 1500- 2500+/- year;


User ID Last Name Origin Haplogroup Tested With Markers Compared Genetic Distance
F5DYR Finland R1b1a2 (tested) Family Tree DNA
QQUFE Drumhome Parish, Ireland R1b1a2a1 (tested) GD 13
QUH9X North Carolina, USA R1b1a2a1 (tested) GD 16
Z5PSZ Scotland R1b1a2 (tested) GD 17
P7U4J Woloshka, Ukraine Unknown GD 17
8U3YQ Staudernheim, Rheinland-Plalz, Germany R1b1a2a1 (tested)GD 19 X7KU2 (Przemysl), Poland R1b1a2a (tested) GD 19
464abcd 14/15/16/19 can be found in R1b-L277*, R1b-L584* and R1b-CTS7822+, CTS9219*. If you want to compare haplotypes you should make sure they are in the same clade. Because of STR convergence, SNP testing is essential. In this case, not testing for CTS7822/Z2110 and CTS9219 makes the STR comparison of little value* and confusing.

EDIT: Worthless* was too strong of a word and unnecessary.

Rathna
02-05-2014, 09:31 PM
464abcd 14/15/16/19 can be found in R1b-L277*, R1b-L584* and R1b-CTS7822+, CTS9219*. If you want to compare haplotypes you should make sure they are in the same clade. Because of STR convergence, SNP testing is essential. In this case, not testing for CTS7822/Z2110 and CTS9219 makes the STR comparison worthless and confusing.

I have always thought and written what you say too, and that is right, but it seems to me that these subclades are so very close that they may presuppose the same values at the start, and for DYS464 they could be 14-15-16-18. Probably these were the values also for R-L51, which is the sister clade of R-Z2105.
I have written a lot about this on another thread you can see. Of course they are only hypotheses, but that there is a cluster amongst the EE cluster (now we know probably R-Z2110/CTS9219+) which had the mutation I name "for the tangent" in DYS464d from 18 to 19 is a possibility.
The numbers of the Jews killed are dreadful, but probably this isn't the cause that some Jewish haplotypes are rarer than others, i.e. these haplotypes may have been a later introgression in the Jewish pool, whereas other haplotypes introgressed before or belonging to the original Jewish pool from Middle East had the great expansion we know and are more numerous also to-day.
That Jarvinen belonged to a Jewish family but probably introgressed from the Eastern European R-CTS9219 I hypothesized too.

Humanist
02-05-2014, 09:52 PM
The numbers of the Jews killed are dreadful, but probably this isn't the cause that some Jewish haplotypes are rarer than others, i.e. these haplotypes may have been a later introgression in the Jewish pool, whereas other haplotypes introgressed before or belonging to the original Jewish pool from Middle East had the great expansion we know and are more numerous also to-day.
That Jarvinen belonged to a Jewish family but probably introgressed from the Eastern European R-CTS9219 I hypothesized too.

How can it be, though, that "probably this isn't the cause that some Jewish haplotypes are rarer than others."

For example, before WWII, according to the Wikipedia article, the Jewish population of Poland stood at ~3,300,000. Afterwards, it was 300,000.


EDIT: I failed to notice that you used the qualifier "some." I will agree with you on that point.

Rathna
02-05-2014, 10:18 PM
How can it be, though, that "probably this isn't the cause that some Jewish haplotypes are rarer than others."

For example, before WWII, according to the Wikipedia article, the Jewish population of Poland stood at ~3,300,000. Afterwards, it was 300,000.


EDIT: I failed to notice that you used the qualifier "some." I will agree with you on that point.

Because Nazis didn't a genetic test and we cannot think that only some haplotypes have been killed. This is statistic. Probably there were and there are some haplotypes more numerous and other less, I think for the reasons I said.
And that R-Z2110* (my haplotype) is above all (it seems) Italian and Balkan till the Isles and that the subclade CTS9219 is above all in Eastern Europe is a fact. The two Jewish cluster (wrongly united under the SNP L150+: I have explained because this is wrong by a genetic point of view) more diffused are R-M269* and R-L23* (actually L277+). There are also many L584+, but, as I have said many times and also in letters dedicated to you, it seems that your Assyrians are ancestral to this, having L943+ and L945+, whereas Silver, for instance, is a subclade of a subclade of a subclade.
And I am waiting that someone tests if they all descend from the R-PF7580, found so far in an Italian (Carnevali) and a Romanian (Aghinitei).

Silesian
02-06-2014, 06:12 AM
464abcd 14/15/16/19 can be found in R1b-L277*, R1b-L584* and R1b-CTS7822+, CTS9219*. If you want to compare haplotypes you should make sure they are in the same clade. Because of STR convergence, SNP testing is essential. In this case, not testing for CTS7822/Z2110 and CTS9219 makes the STR comparison of little value* and confusing.

EDIT: Worthless* was too strong of a word and unnecessary.
Okay I'll keep that in mind maybe one day you and JärvinenT's, Rathna can come over and we can have some timbits and hot chocolate after we play some ice hockey?

- - - Updated - - -


having L943+ and L945+, whereas Silver, for instance, is a subclade of a subclade of a subclade.
And I am waiting that someone tests if they all descend from the R-PF7580, found so far in an Italian (Carnevali) and a Romanian (Aghinitei).

That is a lot of subclades; does Silver play hockey? He can join us for hot chocolate and timbits :)

JärvinenT
02-06-2014, 04:05 PM
Okay I'll keep that in mind maybe one day you and JärvinenT's, Rathna can come over and we can have some timbits and hot chocolate after we play some ice hockey?

- - - Updated - - -



That is a lot of subclades; does Silver play hockey? He can join us for hot chocolate and timbits :)

What a lovely idea! Ice hockey is my favorite sport. Not that I can play myself. I prefer more power lifting.

- - - Updated - - -


like many of us, no real close matches maybe 1500- 2500+/- year;


That`s why I stopped looking for answers in Ysearch. It seemed pointless. Thats why I tested Geno 2.0 to have deeper and more detailed answers. Answers brought me this discussion. What I am happy.

I think strongly that I am Jewish.

Silesian
02-06-2014, 04:20 PM
What a lovely idea! Ice hockey is my favorite sport. Not that I can play myself. I prefer more power lifting..

- - - Updated - - -
Don't worry your part of the Eastern R1b clan:) I'll teach you, we will put JoeB in net; of course we will have to use a sponge puck LOL.



That`s why I stopped looking for answers in Ysearch. It seemed pointless. Thats why I tested Geno 2.0 to have deeper and more detailed answers. Answers brought me this discussion. What I am happy.

I think strongly that I am Jewish.
Here are your autosomal results professor.

Eurogenes EUtest V2 K15 4-Ancestors Oracle

# Population Percent
1 North_Sea 32.07
2 Atlantic 22.72
3 Baltic 20.52
4 Eastern_Euro 15.10
5 Siberian 5.44
6 West_Med 1.60
7 Amerindian 1.48
8 Oceanian 1.06


Using 4 populations approximation:
1 Finnish + Finnish + Irish + Southwest_Finnish @ 4.282
2 Finnish + Finnish + Finnish + Irish @ 4.291
3 Finnish + Finnish + Southwest_Finnish + West_Scottish @ 4.300
4 Finnish + Finnish + Finnish + West_Scottish @ 4.321
5 Finnish + Southwest_Finnish + Southwest_Finnish + Swedish @ 4.377

Dodecad K12b Admixture Proportions

Population
Gedrosia 3.61%
Siberian 6.66%
Northwest_African -
Southeast_Asian -
Atlantic_Med 25.36%
North_European 62.20%
South_Asian 1.04%
East_African -
Southwest_Asian 0.90%
East_Asian -
Caucasus 0.20%
Sub_Saharan -



Using 4 populations approximation:
1 FIN30 + FIN30 + Norwegian + Norwegian @ 3.424
2 Finnish + Finnish + Finnish + Pais_Vasco @ 3.615
3 FIN30 + Finnish + Finnish + Pais_Vasco @ 3.616
4 FIN30 + FIN30 + Finnish + Pais_Vasco @ 3.712
5 FIN30 + Finnish + Norwegian + Norwegian @ 3.775
6 British_Isles + FIN30 + Finnish + Norwegian @ 3.854
7 British_Isles + FIN30 + FIN30 + Swedish @ 3.858
8 FIN30 + FIN30 + Orkney + Swedish @ 3.866

Again compared to your matches on ysearch

User ID Last Name Origin Haplogroup Tested With Markers Compared Genetic Distance
F5DYR Finland R1b1a2 (tested) Family Tree DNA
QQUFE Drumhome Parish, Ireland R1b1a2a1 (tested) GD 13
QUH9X North Carolina, USA R1b1a2a1 (tested) GD 16
Z5PSZ Scotland R1b1a2 (tested) GD 17
P7U4J Woloshka, Ukraine Unknown GD 17
8U3YQ Staudernheim, Rheinland-Plalz, Germany R1b1a2a1 (tested)GD 19 X7KU2 (Przemysl), Poland R1b1a2a (tested) GD 19[/QUOTE]


K12 I'm red


Eurogenes K12 Admixture Proportions
Population
South Asian 0.44%1.28%
Caucasus - 0% 5.57%
Southwest Asian - 0% 0%
North Amerindian + Arctic 0.89%0%
Siberian 5.27%0%
Mediterranean 0.67%8.12%
East Asian -
West African 0.38%0%
Volga-Ural 14.03%16.18%
South Baltic 24.17%30.45%
Western European 18.36%18.21%
North Sea 35.79%20.18

JärvinenT
02-06-2014, 04:31 PM
OK. Thank you. We should also keep in mind, in my opinion, that millions of Jews were murdered not too long ago, when speaking of Jewish Y-DNA variability in Eastern Europe

I have been angry my ancestors for not taught Jewish traditions and hiding the roots. I have to admit that maby they have been wise to do so. I have been visiting in Auschwitz - Birkenau, reed and watch documents about Jews history and it is so horrible. Auschwitz crowned all. I didnt speek for 6 hours in that visit and still the place haunts at me. It sounds crazy but it does. That place leaves the track. In Finland too they send few people in Nazi camps. One was only a baby. In Russia they killed Jews too.

If I would be like my ancestor wanted and my oldest relatives (maternal)have hoped and advised me than I would never tell anyone. I hope the history dont repeat itself.

JärvinenT
02-06-2014, 05:12 PM
- - - Updated - - -
Don't worry your part of the Eastern R1b clan:) I'll teach you, we will put JoeB in net; of course we will have to use a sponge puck LOL.



Here are your autosomal results professor.

Eurogenes EUtest V2 K15 4-Ancestors Oracle

# Population Percent
1 North_Sea 32.07
2 Atlantic 22.72
3 Baltic 20.52
4 Eastern_Euro 15.10
5 Siberian 5.44
6 West_Med 1.60
7 Amerindian 1.48
8 Oceanian 1.06


Using 4 populations approximation:
1 Finnish + Finnish + Irish + Southwest_Finnish @ 4.282
2 Finnish + Finnish + Finnish + Irish @ 4.291
3 Finnish + Finnish + Southwest_Finnish + West_Scottish @ 4.300
4 Finnish + Finnish + Finnish + West_Scottish @ 4.321
5 Finnish + Southwest_Finnish + Southwest_Finnish + Swedish @ 4.377

Dodecad K12b Admixture Proportions

Population
Gedrosia 3.61%
Siberian 6.66%
Northwest_African -
Southeast_Asian -
Atlantic_Med 25.36%
North_European 62.20%
South_Asian 1.04%
East_African -
Southwest_Asian 0.90%
East_Asian -
Caucasus 0.20%
Sub_Saharan -



Using 4 populations approximation:
1 FIN30 + FIN30 + Norwegian + Norwegian @ 3.424
2 Finnish + Finnish + Finnish + Pais_Vasco @ 3.615
3 FIN30 + Finnish + Finnish + Pais_Vasco @ 3.616
4 FIN30 + FIN30 + Finnish + Pais_Vasco @ 3.712
5 FIN30 + Finnish + Norwegian + Norwegian @ 3.775
6 British_Isles + FIN30 + Finnish + Norwegian @ 3.854
7 British_Isles + FIN30 + FIN30 + Swedish @ 3.858
8 FIN30 + FIN30 + Orkney + Swedish @ 3.866

K12 I'm red


Eurogenes K12 Admixture Proportions
Population
South Asian 0.44%1.28%
Caucasus - 5.57%
Southwest Asian - 0% 0%
North Amerindian + Arctic 0.89%0%
Siberian 5.27%0%
Mediterranean 0.67%8.12%
East Asian -
West African 0.38%0%
Volga-Ural 14.03%16.18%
South Baltic 24.17%30.45%
Western European 18.36%18.21%
North Sea 35.79%20.18


Thank you professor for helping me:P

Well
I seem to come all over the world:biggrin1:
except it does not account for unknown factors. I think maby we are only survivors our clan. :biggrin1:

The net is best place to play. Or what place you think is the best place?

Silesian
02-06-2014, 05:25 PM
Thank you professor for helping me:P

My pleasure. :)


Well
I seem to come all over the world:biggrin1:
except it does not account for unknown factors. I think maby we are only survivors our clan. :biggrin1:

You had mentioned your brother has red hair, is it the same gene as found in Ireland or Poland?


The net is best place to play. Or what place you think is the best place?
A frozen mountain Lakes in British Columbia, are very nice
Something along these lines except with snow and the lake frozen,.
http://static.squarespace.com/static/51959b80e4b0acc777d86621/51af510ee4b04106fcb51f5c/51af5118e4b04106fcb51f6f/1381462254000/

JärvinenT
02-08-2014, 08:38 AM
[QUOTE=Silesian;30262]
You had mentioned your brother has red hair, is it the same gene as found in Ireland or Poland?

Yes my brother has red hair. It could come Ireland/ Britain yes. My maternal DNA had Irish matches, also Polish. I have heard that my Granfather (from paternal side) had black hair, but he`s beard had the red pigment. Somewhere we have get also tendency to make muscle rather easy. I think it comes in our genes too. I am interested in health-related genetics including genetic diseases. It probably is due to my profession.

A frozen mountain Lakes in British Columbia, are very nice
Something along these lines except with snow and the lake frozen,.

That is beautiful landscape. Especially I love mountains.
/QUOTE]

Silesian
02-08-2014, 03:48 PM
[QUOTE=Silesian;30262]
You had mentioned your brother has red hair, is it the same gene as found in Ireland or Poland?

Yes my brother has red hair. It could come Ireland/ Britain yes. My maternal DNA had Irish matches, also Polish. I have heard that my Granfather (from paternal side) had black hair, but he`s beard had the red pigment. Somewhere we have get also tendency to make muscle rather easy. I think it comes in our genes too. I am interested in health-related genetics including genetic diseases. It probably is due to my profession.

A frozen mountain Lakes in British Columbia, are very nice
Something along these lines except with snow and the lake frozen,.

That is beautiful landscape. Especially I love mountains.


Phenotype can be a bit tricky so I do not put much into eye colour or hair colour more interest in specific mutations. I'll pm some picture later with autosomal of family, but not on this public forum. To give you an idea about some of the different branches in our family of R1b Z2103/5


12-24-14-10-[11-14]-12-13-12-13-13-29 (Pakistan, Pashtun)
12-24-14-11-[11-14]-12-12-12-13-14-28 (Pakistan)
12-24-14-11-[11-15]-12-12-13-13-14-29 (India)
12-24-14-10-[11-14]-12-13-12-13-13-29 (India, Gujarit)


12-21-14-11-[11-15]-12-12-12-13-14-28 (Kazakhstan, Urals)
12-24-14-10-[11-14]-12-12-12-13-13-30 (Urals,Bashkir,Bashkiria)
12-24-14-10-[12-15]-12-13-12-13-13-29 (Kazakhstan)
12-24-11-11-[11-14]-12-12-13-13-13-30 (Kazakhstan)



12-25-14-10-[11-15]-12-12-13-14-13-30 (Finland)

12-24-14-11-[11-15]-12-12-11-13-13-29 (Germany)
12-24-14-10-[11-17]-12-12-14-13-13-28 (Germany)
12-24-14-10-[11-14]-12-12-11-14-13-31 (Poland)
12-23-14-11-[11-14]-12-12-13-13-13-29 (Russia)
12-24-14-11-[12-14]-12-12-11-13-13-29 (Russia)
12-24-14-10-[11-15]-12-12-12-12-14-27 (Russia, Pskovskaya region)
12-24-15-10-[11-15]-12-12-13-13-14-28 (Russia,Voronezhskaya)
13-24-15-10-[11-14]-12-12-12-13-14-28 (Switzerland)
12-23-14-11-[11-15]-12-12-12-13-12-29 (Ukraine)
12-23-14-11-[10-15]-12-12-12-13-14-28 (Bulgaria)
12-24-14-11-[11-16]-12-12-11-13-13-29 (Bulgaria)
13-24-14-10-[11-11]-12-12-14-13-13-29 (Bulgaria, Strouga, Macedonia)


12-24-14-11-[11-15]-12-12-12-12-13-28 (Ireland)
12-24-14-11-[11-15]-12-12-12-13-13-29 (Scotland)
12-25-14-10-[11-15]-12-12-12-13-13-29 (Ireland)
11-23-14-11-[11-14]-12-12-12-13-13-29 (England,Plymstock, Devon)
12-24-14-11-[11-15]-12-12-12-13-13-29 (England)
12-25-15-10-[11-15]-12-12-13-13-13-29 (England, Cheshire)



13-23-14-11-[11-11]-12-12-13-13-13-30 ( Albania, Kosovo)
13-24-14-11-[10-11]-12-12-12-13-13-29 (Albania)
13-24-14-11-[10-11]-12-12-12-13-13-29 (Greece)
12-25-14-11-[12-15]-12-12-12-13-13-29 (Armenia)
12-23-14-10-[11-15]-12-12-13-13-14-28 (Armenia)
13-23-14-11-[11-14]-12-12-11-13-13-30 (Armenian, project)
13-24-14-11-[11-16]-12-12-12-13-14-28 (Armenian, project)



12-23-14-11-[11-14]-12-12-11-14-13-30 (Georgian)
12-25-14-11-[12-15]-12-12-12-15-13-31 (Georgian)
12-25-14-10-[12-15]-12-12-12-13-13-30 (Georgian)
12-24-15-11-[11-15]-12-12-14-13-13-28 (Georgian)
11-24-14-10-[12-14]-12-12-12-12-13-28 (Georgian)
12-24-14-11-[11-14]-12-12-11-12-13-29 (Ossetian, Digor)

Rathna
02-08-2014, 04:15 PM
KJ8UQ Nazarov Uralsk, Kazakhstan
12 21 14 11 11 15 12 12 12 13 14 28 17 9 10 11 11 25 15 19 28 15 15 16 18 11 11 19 23 16 16 17 17 37 42 12 12 12 12 13 11 9 15 16 8 10 10 8 10 11 21 22 16 10 12 12 15 8 22 20 12 11 13 11 11 12 12
DW7P3 Bahlavouni Turkey
13 24 14 11 11 16 12 12 12 13 14 28 17 9 10 11 11 25 15 19 28 15 15 16 17 10 11 19 23 15 15 17 17 37 39 11 12 12 12 14 11 9 15 16 8 10 10 8 10 11 23 23 16 10 12 12 16 8 22 20 12 11 13 11 11 12 12
FGK82 Svihra Majer, Austro-Hungarian Empire
12 24 14 11 11 14 12 12 12 13 13 29 16 9 10 11 11 25 15 19 31 14 15 16 18 11 11 19 23 16 16 19 17 37 40 12 12 12 12 13 11 9 15 16 8 10 10 8 11 11 23 23 16 10 12 12 15 8 22 20 12 11 13 11 11 12 12
P9N8S Anas Turkey
12 23 14 11 11 15 12 12 12 13 14 28 16 9 10 11 11 25 15 19 27 15 15 15 16 10 12 19 22 16 16 17 17 36 38 11 12 12 12 13 11 9 15 16 8 10 10 8 10 11 23 23 16 10 12 12 15 8 22 20 12 11 13 11 11 12 11
WEMEU Polins Tampa, Slovakia
12 22 14 10 11 14 12 12 12 13 13 29 17 9 10 11 11 25 15 19 30 15 15 17 17 11 11 19 23 15 16 18 17 34 40 12 12 12 12 13 11 9 15 16 8 10 10 8 10 11 21 23 16 10 12 12 14 8 22 20 12 11 13 11 11 12 12

Nazarov’s haplotype isn’t so strange if compared with other haplotypes of Eastern Europe. They have the series

8 10 10 8 10 11
11 13 11 11 12 12

and seem to belong to L227 and to Z2110/CTS9219.

Silesian
02-08-2014, 04:30 PM
KJ8UQ Nazarov Uralsk, Kazakhstan
12 21 14 11 11 15 12 12 12 13 14 28 17 9 10 11 11 25 15 19 28 15 15 16 18 11 11 19 23 16 16 17 17 37 42 12 12 12 12 13 11 9 15 16 8 10 10 8 10 11 21 22 16 10 12 12 15 8 22 20 12 11 13 11 11 12 12

Nazarov’s haplotype isn’t so strange if compared with other haplotypes of Eastern Europe. They have the series

8 10 10 8 10 11
11 13 11 11 12 12

and seem to belong to L227 and to Z2110/CTS9219.
Yes maybe even more snp branching. What about Northern Italy? Can you give any beside Burkhardt L277+

Rathna
02-08-2014, 04:47 PM
Yes maybe even more snp branching. What about Northern Italy? Can you give any beside Burkhardt L277+

Nazarov has been confirmed L277+
223828 Piotr Nazarov, b.1886, d.1932, Yaik Cossack clan R1b1a2a1 R-L150
L150+, L23+, L277+, M269+, L51-, L584-, P312-, U106-

but you should know from many posts of mine that I paid for testing Mattoli for L277 and we are waiting for his result. If all Italians I supposed will be confirmed you'll get something very astonishingly in the L277+ haplogroup:
12 14 27
13 14 28
14 14 29
12 15 27
13 15 28
and I mean DYS389I/DYS392/DYS389II.
Nazarov seems highly varied, but he belongs to the modal 13 14 28 for this haplogroup.

Silesian
02-08-2014, 04:52 PM
Nazarov has been confirmed L277+
223828 Piotr Nazarov, b.1886, d.1932, Yaik Cossack clan R1b1a2a1 R-L150
L150+, L23+, L277+, M269+, L51-, L584-, P312-, U106-

but you should know from many posts of mine that I paid for testing Mattoli for L277 and we are waiting for his result. If all Italians I supposed will be confirmed you'll get something very astonishingly in the L277+ haplogroup:
12 14 27
13 14 28
14 14 29
12 15 27
13 15 28
and I mean DYS389I/DYS392/DYS389II.
Nazarov seems highly varied, but he belongs to the modal 13 14 28 for this haplogroup.
Between Nazarov and Italy/Switzerland R1b L277+ there is quite variance perhaps quite old in Italy.

Rathna
02-08-2014, 04:58 PM
Between Nazarov and Italy/Switzerland R1b L277+ there is quite variance perhaps quite old in Italy.
Of course we have to wait for the answers of the tests. So far we have only two Italians tested L277+: Stasi and Manno (from 23andMe).

ADW_1981
02-08-2014, 06:39 PM
[QUOTE=Silesian;30262]
You had mentioned your brother has red hair, is it the same gene as found in Ireland or Poland?

Yes my brother has red hair. It could come Ireland/ Britain yes. My maternal DNA had Irish matches, also Polish. I have heard that my Granfather (from paternal side) had black hair, but he`s beard had the red pigment. Somewhere we have get also tendency to make muscle rather easy. I think it comes in our genes too. I am interested in health-related genetics including genetic diseases. It probably is due to my profession.

A frozen mountain Lakes in British Columbia, are very nice
Something along these lines except with snow and the lake frozen,.

That is beautiful landscape. Especially I love mountains.
/QUOTE]

It's most likely that males with R1b also carried the west Asian skin lightening mutations - but also additional *younger age* skin lightening mutations found only in Europe and possible northern west Asia today. This is why there is no way in hell an northern Indian or Iranian has the same skin colour as I do even though we may have the same SLC24A5 mutation. However, an acquaintance of mine from Azerbaijan has milky skin and red hair like someone from Scotland. These folks arrived in Europe no earlier than 3000 BC. Back migration from Europe to west Asia seems to be ruled out since R1b has not been in found in ancient Europe, and these folks didn't have white skin.

Humanist
02-08-2014, 06:56 PM
It's most likely that males with R1b also carried the west Asian skin lightening mutations - but also additional *younger age* skin lightening mutations found only in Europe and possible northern west Asia today. This is why there is no way in hell an northern Indian or Iranian has the same skin colour as I do even though we may have the same SLC24A5 mutation. However, an acquaintance of mine from Azerbaijan has milky skin and red hair like someone from Scotland. These folks arrived in Europe no earlier than 3000 BC. Back migration from Europe to west Asia seems to be ruled out since R1b has not been in found in ancient Europe, and these folks didn't have white skin.

NW Iranians can be rather light in complexion as well. The same can be said for a minority of Assyrians. Red hair does exist in our community, but from what I can tell it is nearly exclusive to members of the Syriac Orthodox Church. However, there are some members of the Church of the East whose hair color fall within the red spectrum, such as the fellow below:

http://i1178.photobucket.com/albums/x372/paulgiva78/passover/UptownFilmFestival-AP1.jpg

JärvinenT
02-09-2014, 05:11 PM
My paternal map:

After my paternal ascestors left Afrika About 75,000 Years Ago they move outward from Africa and along the coastline, members of this lineage were some of the earliest settlers in Asia, Southeast Asia, and Australia. Some from this line would even travel over the land bridge to reach the Americas. This was about 70,000 years ago.

The next male ancestor in our Paternal line is the man who gave rise to M89, a marker found in 90 to 95 percent of all non-Africans. This man was born around 50,000 years ago in northern Africa or the Middle East. This line ancestors had two options: remain in the Middle East, or move on. While many of the descendants of M89 remained in the Middle East, others continued to follow the great herds of wild game through what is now modern-day Iran to the vast steppes of Central Asia. My (and yours) ancestors, having migrated north out of Africa into the Middle East, then traveled both east and west along this Central Asian superhighway. A smaller group continued moving north from the Middle East to Anatolia and the Balkans, trading familiar grasslands for forests and high country.Today, geneticists have found the lineage in 1 to 2 percent of Pakistani and Indian populations. However, it is about 4 percent of some Austro-Asiatic-language-family-speaking groups in India. It is about 9 percent of some Dravidian-language-family-speaking groups in India, and it is 9 to 10 percent of male lineages in Sri Lanka. In Borneo, it is about 5 percent of the population. In Malaysia, it is about 6 percent of the population.

About 45,000 years ago in South Asia.The next male ancestor in my ancestral lineage is the man who gave rise to P128, a marker found in more than half of all non-Africans alive today. This man was born around 45,000 years ago in the Middle East or Central Asia.The descendants of P128 migrated to the east and north, picking up additional markers on their Y-chromosomes. This lineage is the parent of several major branches on the Y-chromosome tree: O, the most common lineage in East Asia; R, the major European Y-chromosome lineage; and Q, the major Y-chromosome lineage in the Americas. These descendant branches went on to settle the rest of Asia, the Americas, and Europe; many others traveled to Southeast Asia.Today, P128 individuals lacking these additional markers are rare in most populations, and are most commonly seen in Oceanian and Australian Aboriginal populations.

Round 35,000 Years Ago in Central Asia or South Asia. This paternal ancestor traveled with groups in the open savannas between Central and South Asia during the Paleolithic. These big game hunters were the parents to two of the most widespread male lineages in modern populations, one that is responsible for the majority of pre-Columbian lineages in the Americas (haplogroup Q) and many others from Asia and Europe. Another one that spread farther into Asia produced the highest frequency lineages in European populations (haplogroup R).Today, members of this lineage who do not belong to a descendant branch are rare, and geneticists have found them most often in India. These populations include such diverse groups as the Saora (23 percent), the Bhumij (13 percent), and Muslims from Manipur (33 percent).Known as the Central Asian Clan, this branch gave rise to many distinct lineages that spent the next 30,000 years gradually populating much of the planet.

About 30,000 Years Ago Central Asia. M207 was born in Central Asia around 30,000 years ago. His descendants would go on to settle in Europe, South Asia and the Middle East over the following 20,000 years. Today, most western European men belong to one branch—R-M342—that descended from this lineage. While it appears to have been one of the earliest lineages to settle in Europe more than 25,000 years ago, more recent population expansions associated with the post-glacial repopulation of northern Europe after the end of the last ice age, as well as the spread of agriculture during the Neolithic, also contributed to its high frequency in Ireland, the UK, France and Spain.One descendant lineage—R-L62—is common in Eastern Europe and India, and was likely spread in part through the migration of Indo-European steppe nomads over the past 5,000 years.

P231 25,000 – 30,000 Years Ago in Central Asia. The Paleolithic ancestor who founded this lineage lived a nomadic lifestyle. His descendants include two major descendant branches that today account for most European men and many others from Central Asia, West Asia, and South Asia.

M343 17,000 – 22,000 Years Ago in South Asia or West Asia. The first members of this lineage lived as hunter-gatherers on the open savannas that stretched from Korea to Central Europe. They took part in the advances in hunting technology that allowed for population growth and expansions.When the Earth entered a cooling phase, most from this line sheltered in refugia to the southeast of Europe and in West Asia. It was from these refugia that their populations rapidly expanded when the ice once more receded. Some traveled west across Europe. Others moved back toward their distant ancestors’ homelands in Africa, passing through the Levant region. Through these movements and the population boom triggered by the Neolithic Revolution, this lineage and its descendant lineages came to dominate Europe.Today, it has a wide distribution. In Africa, geneticists have found this lineage in Northern Africa (6 percent) and central Sahel (23 percent). Its frequency in Europe is at times high and at other times moderate. It represents about 7 percent of Russian male lineages, about 13 percent of male lineages in the Balkans, about 21 percent of Eastern European male lineages, 55 to 58 percent of Western European lineages, and about 43 percent of Central European male lineages. In Asia, most men of this lineage are found in West Asia (6 percent) and South Asia (5 percent). However, trace frequencies of around half a percent from this lineage are present in East Asia.Russian Emperor Nicholas II belonged to this lineage.

The final brach what is for fact in my paternal line what age is to Be Determined born West Asia (L278).This is the part i have tell you before. While some from this group traveled west into Central Asia, others moved south toward the Levant region. Today, they are present in trace frequencies of less than 1 percent in Italy, the Ukraine, and the region of the Pannonian Basin.This branch is not accompanied by a major movement on the map, and research on this branch is continuing.Those who belong to this lineage but do not belong to a descendant branch are rare.

Now starts my speculation what I base my theory in my FTDNA answers: Y-DNA - Ancestral Origins in leevel 12. After they left Levant area they moved into Italy. After that into Spain. They moving ahead in to Ireland and United Kingdom, Scotland, Wales and England (difficult to guess the order). Some point they were in Germany. Before they moved the British Isles. Some-one and somehow ended up in Russia. One theory could be that Vikings took some male ancestor of mine as an slave and like Vikings did they went into Russia too and fact: my granfathers (born 1917) father served the Tsar of Russia and received the assignment to Finland.

Silesian
02-14-2014, 07:21 AM
My paternal map:

Now starts my speculation what I base my theory in my FTDNA answers: Y-DNA -

JärvinenT your Eurogenes Jtest score. I don't think you are Jewish at all,just my personal opinion.

# Population Percent
1 NORTH-CENTRAL_EURO 24.66
2 SOUTH_BALTIC 23.77
3 EAST_EURO 21.23
4 ATLANTIC 19.56
5 SIBERIAN 5.44
6 WEST_MED 3.38
7 ASHKENAZI 1.78
8 SOUTH_ASIAN 0.17


The Ashkenazi cluster is very similar to the Middle Eastern cluster in that regard. So anyone who gets an Ashkenazi score of around 2-3% either has very distant Jewish ancestry or, more likely, none at all. However, those who show more than 25% membership in that cluster are almost certainly of fully Ashkenazi ancestry, and their genomes peppered with Ashkenazi-specific chromosomal segments.

http://bga101.blogspot.ca/2012/09/eurogenes-ashkenazim-ancestry-test-files.html

Mixed Mode Population Sharing:

# Primary Population (source) Secondary Population (source) Distance
1 90.4% South_Finnish + 9.6% Scottish @ 2.3
2 90.1% South_Finnish + 9.9% Orcadian @ 2.36
3 86.2% South_Finnish + 13.8% South_&_Central_Swedish @ 2.37
4 90.5% South_Finnish + 9.5% English

Humanist
02-14-2014, 08:00 AM
JärvinenT your Eurogenes Jtest score. I don't think you are Jewish at all,just my personal opinion.

# Population Percent
1 NORTH-CENTRAL_EURO 24.66
2 SOUTH_BALTIC 23.77
3 EAST_EURO 21.23
4 ATLANTIC 19.56
5 SIBERIAN 5.44
6 WEST_MED 3.38
7 ASHKENAZI 1.78
8 SOUTH_ASIAN 0.17



http://bga101.blogspot.ca/2012/09/eurogenes-ashkenazim-ancestry-test-files.html

Mixed Mode Population Sharing:

# Primary Population (source) Secondary Population (source) Distance
1 90.4% South_Finnish + 9.6% Scottish @ 2.3
2 90.1% South_Finnish + 9.9% Orcadian @ 2.36
3 86.2% South_Finnish + 13.8% South_&_Central_Swedish @ 2.37
4 90.5% South_Finnish + 9.5% English

JärvinenT.

If it is your father that you believe was Jewish, then based on the above data posted by Silesian, that is not at all a likely possibility.

EDIT: Perhaps he was Jewish, but I imagine he would have been a recent convert? Did conversions to Judaism occur during that time, in that part of the world? Someone more knowledgeable on Jewish/European history would need to answer that.

Humanist
02-14-2014, 09:37 AM
Not to go too OT, but following up on the previous post, from Wikipedia:


The Second Temple period in Jewish history lasted between 530 BCE and 70 CE, when the Second Temple of Jerusalem existed. The sects of Pharisees, Sadduccees, Essenes, and Zealots were formed during this period. The Second Temple period ended with the First Jewish–Roman War and the Roman destruction of Jerusalem and the Temple.

....

During this period, Second Temple Judaism can be seen as shaped by three major crises and their results, as various groups of Jews reacted to them differently. First came the destruction of the Kingdom of Judah in 587/6 BCE, when the Judeans lost their independence, monarchy, holy city and First Temple and were mostly exiled to Babylon. They consequently faced a theological crisis involving the nature, power, and goodness of God and were also threatened culturally, racially, and ceremonially as they were thrown into proximity with other peoples and religious groups. The absence of recognized prophets later in the period left them without their version of divine guidance at a time when they felt most in need of support and direction.[1] The second crisis was the growing influence of Hellenism in Judaism, which culminated in the Maccabean Revolt of 167 BCE. The third crisis was the Roman occupation of the region, beginning with Pompey and his sack of Jerusalem in 63 BCE.[1] This included the appointment of Herod the Great as King of the Jews by the Roman Senate, the Herodian Kingdom of Judea comprising parts of what today are Israel, Palestinian Authority, Gaza Strip, Jordan, Lebanon and Syria.

JärvinenT
02-14-2014, 03:43 PM
I have been crow up as an christian. When I started to study my family history I did not think anything about where my granfather come from. I didnt think we were Jewish my paternal side, i was known only my granfather`s father was Russian. Then I study history and get help from professional history researcher and she was first who gave me this clue. I started put things together. Then I get my geno 2 answers.

Tell me how it is possible to have (Geno 2 answers) Ashkenazi, sephardic matches if there would not be any truth in this theory?

Silesian
02-14-2014, 03:58 PM
I have been crow up as an christian. When I started to study my family history I did not think anything about where my granfather come from. I didnt think we were Jewish my paternal side, i was known only my granfather`s father was Russian. Then I study history and get help from professional history researcher and she was first who gave me this clue. I started put things together. Then I get my geno 2 answers.

Tell me how it is possible to have (Geno 2 answers) Ashkenazi, sephardic matches if there would not be any truth in this theory?
Your closest str matches are non Jewish. With almost 99.99% certainty you are non Jewish autosomal. In my opinion your forefathers lied to stay alive and not be tortured or executed by NKVD.

JärvinenT
02-14-2014, 04:05 PM
I wrote before your EDIT:
I think that his STRs are linked to those of Moiseev and that both were probably Jewish, but my thinking is that their R-Z2110/CTS9219 is of Eastern European origin and not of Ancient Jewish origin, like my R-Z2110* is Italian

Thank you Rathna. You seem to done lot of research about this subject.

Where is Moiseev tested? I would like compare he`s results with my brothers results.

Silesian
02-14-2014, 04:17 PM
OK. Thank you. We should also keep in mind, in my opinion, that millions of Jews were murdered not too long ago, when speaking of Jewish Y-DNA variability in Eastern Europe.

Wikipedia
Would have been an excellent witness was tortured and executed, Polish hero.

On 8 May 1947, he was arrested by the Ministry of Public Security.[9] Prior to trial, he was repeatedly tortured. The investigation on Pilecki’s activities was supervised by Colonel Roman Romkowski. He was interrogated by Col. Józef Różański, and lieutenants: S. Łyszkowski, W. Krawczyński, J. Kroszel, T. Słowianek, Eugeniusz Chimczak, and S. Alaborski – men who were especially famous for their savagery. But Pilecki sought to protect other prisoners and revealed no sensitive information.[9]
http://en.wikipedia.org/wiki/Witold_Pilecki


This is who JärvinenT forefathers feared NKVD, he lied to stay alive.
https://en.wikipedia.org/wiki/Katyn_Massacre

JärvinenT
02-14-2014, 04:27 PM
JärvinenT your Eurogenes Jtest score. I don't think you are Jewish at all,just my personal opinion.



I appreciate your opinion and help but I stick in my opinions too. If you dont mind :)

Silesian
02-14-2014, 04:30 PM
I appreciate your opinion and help but I stick in my opinions too. If you dont mind :)

I pm you I will not post on this thread anymore best wishes JärvinenT.

AJL
02-14-2014, 04:49 PM
I appreciate your opinion and help but I stick in my opinions too. If you dont mind :)

If your haplotype is isolated it is very hard to make conclusions.

It is remotely possible that your ancestor was one of the professionals (apothecaries etc.) recruited from German states to modernize the Swedish Empire in the 16th-17th century. After about 5-6 generations, there is little chance your Y line will be borne out in your autosomes. However your results do look very typical for someone with mainly Finnish and a little Swedish ancestry.

JärvinenT
02-14-2014, 05:59 PM
Would have been an excellent witness was tortured and executed, Polish hero.

http://en.wikipedia.org/wiki/Witold_Pilecki


This is who JärvinenT forefathers feared NKVD, he lied to stay alive.
https://en.wikipedia.org/wiki/Katyn_Massacre

The Katyn massacre happen 1940 much later than my granfather or he`s father was born.

JärvinenT
02-14-2014, 06:05 PM
If your haplotype is isolated it is very hard to make conclusions.

It is remotely possible that your ancestor was one of the professionals (apothecaries etc.) recruited from German states to modernize the Swedish Empire in the 16th-17th century. After about 5-6 generations, there is little chance your Y line will be borne out in your autosomes. However your results do look very typical for someone with mainly Finnish and a little Swedish ancestry.

My paternal line comes from Russia before 1917.

Joe B
02-15-2014, 04:27 AM
My paternal line comes from Russia before 1917.Hey JärvinenT,
Do you know what part of the Russian Empire your great-grandfather is from?
I hope everybody reviews your first post to the forum. From R-L150 to R-CTS7822 #82 (http://www.anthrogenica.com/showthread.php?1096-From-R-L150-to-R-CTS7822&p=28930&viewfull=1#post28930) You laid out a very plausible scenario for your family heritage, backed up with history. I respect that. At this point, based on what we know, your Y-DNA neither proves or disproves anything. The same goes for me. The hope is that with a larger database and a scientific view, more clues will come about.
Thanks for being part of the solution for this subclade.

brygian
03-20-2014, 10:31 PM
Hi, I just got my results from Geno 2 and it turns out that I am R-CTS7822 too. My results will be coming on FTDNA and ysearch soon. I am Pomak from Bulgaria.

Joe B
03-21-2014, 02:00 AM
Hi,
Some time ago I tested myself at FTDNA and it turn out that belong to R1b1a2. After that I tested myself with Geno 2 and according this test I belong to R-CTS7822. I am really confused. There is very little information online about R-CTS7822. Can anybody please provide some information about this group? On the Geno website there is a chain of groups and for me it goes down to L278. The information about this group is "Note: This branch is not accompanied by a major movement on the map, and research on this branch is continuing. POINT OF INTEREST: Those who belong to this lineage but do not belong to a descendant branch are rare."
Hi, I just got my results from Geno 2 and it turns out that I am R-CTS7822 too. My results will be coming on FTDNA and ysearch soon. I am Pomak from Bulgaria.Welcome to Anthrogenica and this part of the human phylogenetic tree.
First things first. Please join the R1b and Subclades Gateway Project (https://www.familytreedna.com/public/r1b/) and R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/) if you have not already. What's your kit number?
You're basically part of the very small R1b-Z2103>Z2110/CTS7822 branch of the R1b branch of the Y-tree. You can read about it by searching Z3103 on this web site. Z2110/CTS7822 has really only come to our attention last year and has turned out to be a major part of the R1b-Z2103 family. Information is scarce so your test is important. Z2110/CTS7822 has not yet qualified for placement on the ISOGG Y-tree so you will have to look for Z2103 near the bottom. http://www.isogg.org/tree/ISOGG_HapgrpR.html. One of our members maintains very forward looking phylogenetic tree of our subclade. I think this is smal's latest. http://www.anthrogenica.com/showthread.php?1727-R1b-phylogeny&p=26401&viewfull=1#post26401 Did you happen to see if you were positive for CTS9210 or F672. Those are SNPs that may be downstream of Z2110/CTS7822.
Thread: The R-Z2110* haplogroup (http://www.anthrogenica.com/showthread.php?1973-The-R-Z2110*-haplogroup) is a thread started by Rathna, a very prolific member who is also Z2110/CTS7822.
Thanks for your testing and joining Anthrogenica.
Joe

brygian
03-21-2014, 06:35 PM
Hi,
My FTDNA kit number is 314859. As of now I am only participating in the Bulgarian DNA group and the general R1b group. My results from Geno 2.0 are still being processed by FTDNA. Actually the status is still 'Ordered'. When the results are ready I will join all relevant groups and let you know too.

Pillar_of_fire
03-22-2014, 05:47 AM
Hi,
My FTDNA kit number is 314859. As of now I am only participating in the Bulgarian DNA group and the general R1b group. My results from Geno 2.0 are still being processed by FTDNA. Actually the status is still 'Ordered'. When the results are ready I will join all relevant groups and let you know too.

Hi brygian,

Please contact FTDNA on the Geno2.0 transfer.
Yesterday my uncle-in-law Geno2.0 results were ready, I ordered a transfer and they were immediately transferred and visible on the kit Haplotree and SNP page. Mira, the BG project admin was commenting that there is a delayed transfer (it seems it is yours). So there could be some issue with the data if it takes to long.

For the record - I am Bulgarian

Rathna
03-22-2014, 06:35 AM
Hi,
My FTDNA kit number is 314859.

Hi, you belong to what Argiedude and me (Gioiello Tognoni) called the Albanian or Balkan cluster. I have written tons of letter about it and the possible origin from Italy if Rizzo haplotype were tested beyond SMGF. To this cluster belong also Ciulla, a Sicilian-American of Arbereshe origin. Your contribute is great, because now we know that the "Balkan cluster" is R-Z2110. I'd like to see your Geno 2.0 and don't understand this delaying. Data could be interpreted by me (and others) for free.

P.S. Also Varipapa, an Italian I have always thought of Arbereshe origin, belongs to this haplogroup, but with a different haplotype as to the "Albanian or Balkan cluster", thus a Balkan origin of R-Z2110* should be taken into account.

Rathna
03-22-2014, 06:53 AM
314859 Ahmed Hodzha Sertkehayov, d.1912 Bulgaria R1b1a2
13 24 14 12 11-11 12 12 12 13 13 29 16 8-10 12 11 25 15 19 30 14-14-15-16
Also these other Bulgarians belong to this "Balkan cluster"":

248252 Hristo Alex. Gagov (1880-1923), Strouga, Macedonia Bulgaria R1b1a2
13 24 14 10 11-11 12 12 14 13 13 29
248271 Ivan Dimkov (1866-1913) Gorno Brodi, Gr. Mak. Bulgaria R1b1a2
13 24 14 11 11-11 12 12 12 13 13 29
184355 Dimo Ivanov Dimov (1869-1922) Gramatikovo, BG Bulgaria R1b1a2
13 24 14 12 11-11 12 12 13 13 13 29

P.S. What about your Hodzha? Is it similar to the Albanian Hoxha, and comes from Arab "Haji", who made the pilgrim to Meccah? Are you Balkans converted to Muslim religion?

brygian
03-22-2014, 08:29 AM
My Y data can be downloaded in raw format from here: http://www.kumbarov.com/files/314859.ychromo.csv

Hodzha is not the same as Haji. Hodzha in Turkish means "teacher". In the Ottoman Empire the Imams (Muslim priests) were also teachers and that's why the two terms are used interchangeably. The term Haji means somebody who performed Haj - a pilgrimage to Mecca.

Yes, Pomaks (http://en.wikipedia.org/wiki/Pomaks) are native Balkan people who converted to Islam pretty much the same way most Albanians and Bosniaks did.

Ahmed Hodzha Sertkehayov was indeed an Imam and a teacher in the village of Tsrancha (http://en.wikipedia.org/wiki/Tsrancha) until 1912 when he was crucified and burned alive in the mosque by IMRO (http://en.wikipedia.org/wiki/Internal_Macedonian_Revolutionary_Organization). He is my great great great grandfather. His father has been Imam in Tsrancha too as well as several of his grandfathers. I can track this lineage in Ottoman documents back to 1723.

Rathna
03-22-2014, 08:50 AM
My Y data can be downloaded in raw format from here: http://www.kumbarov.com/files/314859.ychromo.csv

Hodzha is not the same as Haji. Hodzha in Turkish means "teacher". In the Ottoman Empire the Imams (Muslim priests) were also teachers and that's why the two terms are used interchangeably. The term Haji means somebody who performed Haj - a pilgrimage to Mecca.

Yes, Pomaks (http://en.wikipedia.org/wiki/Pomaks) are native Balkan people who converted to Islam pretty much the same way most Albanians and Bosniaks did.

Ahmed Hodzha Sertkehayov was indeed an Imam and a teacher in the village of Tsrancha (http://en.wikipedia.org/wiki/Tsrancha) until 1912 when he was crucified and burned alive in the mosque by IMRO (http://en.wikipedia.org/wiki/Internal_Macedonian_Revolutionary_Organization). He is my great great great grandfather. His father has been Imam in Tsrancha too as well as several of his grandfathers. I can track this lineage in Ottoman documents back to 1723.

Many many thanks. I found extremely interesting what Wikipedia says:
"However, some scholars and many Pomaks themselves claim they are actually the descendants of an ancient Thracian tribe called the Achrianes who only became slavicised in the late Byzantine era when most of Thrace".
These Genetic tests will be able to shed some light also about the origin of Pomaks (I actually didn't know so far), and probably you know that many theories, above all from a linguistic point of view, think that there was a link between Thracians and Armenians. This could explain the high percentage of hg. R-L23 amongst Armenians and probably the Balkan origin both of the Y and of the language.
Beyond what others think on this forum (JoeB, ADW), and I don't take in any consideration, I am a scientist and research only the truth.

brygian
03-22-2014, 09:22 AM
These Genetic tests will be able to shed some light also about the origin of Pomaks (I actually didn't know so far), and probably you know that many theories, above all from a linguistic point of view, think that there was a link between Thracians and Armenians. This could explain the high percentage of hg. R-L23 amongst Armenians and probably the Balkan origin both of the Y and of the language.

I read on eupedia that L23 was characteristic of the Bryges. According to Herodotus at some point most of them moved to Asia Minor where they were called Phryges (Phrygians). The Phryges are considered to be the proto Armenians. According to the Roman historian Plinius the Elder, the Bryges populated several regions in the Western Balkan including the river Nestos basin where my lineage is from.

Rathna
03-22-2014, 09:53 AM
By comparing your data with mine on Chromo2 I can see that
CTS1843/Z2109= no_call
CTS7822/Z2110,Y,T,T/my Z2110 TT positive/ you are positive because read in the same strand
CTS9219,Y,A,A/my CTS9219 GG negative/your seems positive because read in the same strand
CTS699,Y,C,C/my CTS699 GG negative/also yours is negative, even though read in other strand
F672,Y,A,A/ F672 22393316 23983928 no no yes no no A -> G you are negative

thus you are R-CTS9219. Of course we should exam all the other data to see if you have some mutation beneath CTS9219. But this is already enough, I think. We'll understand next the origin of this haplogroup and of its upstream ones.

Rathna
03-22-2014, 10:04 AM
I read on eupedia that L23 was characteristic of the Bryges. According to Herodotus at some point most of them moved to Asia Minor where they were called Phryges (Phrygians). The Phryges are considered to be the proto Armenians. According to the Roman historian Plinius the Elder, the Bryges populated several regions in the Western Balkan including the river Nestos basin where my lineage is from.

Hope to not get the rants of JoeB and ADW_1981 (neither yours, I consider a friend), but if my analysis is right you aren't R-Z2110 like me, but the subclade R-CTS9219, then derived from mine, and my theory of an Italian origin of R-Z2110 stands yet.
We'll see what FTDNA will say about your CTS9219.

brygian
03-22-2014, 10:21 AM
Hope to not get the rants of JoeB and ADW_1981 (neither yours, I consider a friend), but if my analysis is right you aren't R-Z2110 like me, but the subclade R-CTS9219, then derived from mine, and my theory of an Italian origin of R-Z2110 stands yet.
We'll see what FTDNA will say about your CTS9219.

The information about R-CTS9219 is scarce too. What data is available so far about it?

Rathna
03-22-2014, 10:29 AM
The information about R-CTS9219 is scarce too. What data is available so far about it?
Look at smal's tree here on "R1b phylogeny" and you'll know more.

brygian
03-22-2014, 10:40 AM
By comparing your data with mine on Chromo2 I can see that
CTS1843/Z2109= no_call
CTS7822/Z2110,Y,T,T/my Z2110 TT positive/ you are positive because read in the same strand
CTS9219,Y,A,A/my CTS9219 GG negative/your seems positive because read in the same strand
CTS699,Y,C,C/my CTS699 GG negative/also yours is negative, even though read in other strand
F672,Y,A,A/ F672 22393316 23983928 no no yes no no A -> G you are negative

thus you are R-CTS9219. Of course we should exam all the other data to see if you have some mutation beneath CTS9219. But this is already enough, I think. We'll understand next the origin of this haplogroup and of its upstream ones.


Look at smal's tree here on "R1b phylogeny" and you'll know more.

Well, that three doesn't show any subgroups under CTS9219. Do you mean that I will be placed in a brand new group given that any other mutations are found?

Rathna
03-22-2014, 11:53 AM
Well, that three doesn't show any subgroups under CTS9219. Do you mean that I will be placed in a brand new group given that any other mutations are found?

Of course I examined only these SNPs (already known), but I cannot exclude so far that you have some other mutation elsewhere. Not having a program for doing it, I should check every SNP, and they are many thousands. Let's wait that FTDNA publishes your Geno 2.0 you'll be able to send to some project, but you'll have to choose from FTDNA, and we all will be able to see.

Rathna
03-22-2014, 03:50 PM
By comparing your data with mine on Chromo2 I can see that
CTS1843/Z2109= no_call
CTS7822/Z2110,Y,T,T/my Z2110 TT positive/ you are positive because read in the same strand
CTS9219,Y,A,A/my CTS9219 GG negative/your seems positive because read in the same strand
CTS699,Y,C,C/my CTS699 GG negative/also yours is negative, even though read in other strand
F672,Y,A,A/ F672 22393316 23983928 no no yes no no A -> G you are negative

thus you are R-CTS9219. Of course we should exam all the other data to see if you have some mutation beneath CTS9219. But this is already enough, I think. We'll understand next the origin of this haplogroup and of its upstream ones.

If I look at your results on the R-M269 SNPs, it is clear that Geno 2.0 reads the data forwards:
PF7558,Y,G,G
PF756,Y,G,G
PF7560,Y,C,C
PF7561,Y,G,G
PF7562,Y,C,C
PF7563,Y,G,G
PF7564,Y,C,C
PF7566,Y,G,G
PF7568,Y,G,G
PF7569,Y,G,G
PF757,Y,C,C
PF7570,Y,C,C
PF7571,Y,T,T
PF7572,Y,T,T
PF7573,Y,A,A

PF7558 3489974 3429974 no no yes no no G -> A
PF7559 6900580 6840580 no no no no no C -> G
PF7560 6914130 6854130 no no yes no no C -> T
PF7561 7742956 7682956 no no yes no no G -> A
PF7562 8012440 7952440 no no yes no no C -> T
PF7563 8670246 8610246 no no yes no no G -> A
PF7564 13973041 15463647 no no yes no no C -> T
PF7565 14306212 15796818 no no no no no C -> A
PF7566 14742512 16233118 no no yes no no G -> T
PF7567 15233918 16724524 no no no no no C -> T
PF7568 15446106 16936712 no no yes no no G -> A
PF7569 16674122 18164728 no no yes no no G -> A
PF7570 17082620 18573226 no no yes no no C -> T
PF7571 17497137 18987743 no no yes no no T -> C
PF7572 19765285 21305897 no no yes no no T -> C
PF7573 21120356 22710968 no no yes no no A -> G
in fact your reading is forwards and it is without any doubt positive:

CTS9219 17264673 18755279 no no yes no no G -> A Your result:
CTS9219,Y,A,A

brygian
03-22-2014, 05:16 PM
314859 Ahmed Hodzha Sertkehayov, d.1912 Bulgaria R1b1a2
13 24 14 12 11-11 12 12 12 13 13 29 16 8-10 12 11 25 15 19 30 14-14-15-16
Also these other Bulgarians belong to this "Balkan cluster"":

248252 Hristo Alex. Gagov (1880-1923), Strouga, Macedonia Bulgaria R1b1a2
13 24 14 10 11-11 12 12 14 13 13 29
248271 Ivan Dimkov (1866-1913) Gorno Brodi, Gr. Mak. Bulgaria R1b1a2
13 24 14 11 11-11 12 12 12 13 13 29
184355 Dimo Ivanov Dimov (1869-1922) Gramatikovo, BG Bulgaria R1b1a2
13 24 14 12 11-11 12 12 13 13 13 29

P.S. What about your Hodzha? Is it similar to the Albanian Hoxha, and comes from Arab "Haji", who made the pilgrim to Meccah? Are you Balkans converted to Muslim religion?

Gorno Brodi is very close to the place where I am from. In the Ottoman Empire we have even been in the same administrative unit - the Nevrokop kaaza.

Rathna
03-22-2014, 05:23 PM
Gorno Brodi is very close to the place where I am from. In the Ottoman Empire we have even been in the same administrative unit - the Nevrokop kaaza.

Many thanks. Even though 12 markers are not enough to understand a relatedness, I think I can say that you all are closely related and probably you have a common ancestor in these last centuries. The mutations happened in DYS391 and DYS439 and could be an interesting sample of my theory of the "mutations around the modal". Many thanks again.

brygian
03-22-2014, 06:28 PM
314859 Ahmed Hodzha Sertkehayov, d.1912 Bulgaria R1b1a2
13 24 14 12 11-11 12 12 12 13 13 29 16 8-10 12 11 25 15 19 30 14-14-15-16
Also these other Bulgarians belong to this "Balkan cluster"":

248252 Hristo Alex. Gagov (1880-1923), Strouga, Macedonia Bulgaria R1b1a2
13 24 14 10 11-11 12 12 14 13 13 29
248271 Ivan Dimkov (1866-1913) Gorno Brodi, Gr. Mak. Bulgaria R1b1a2
13 24 14 11 11-11 12 12 12 13 13 29
184355 Dimo Ivanov Dimov (1869-1922) Gramatikovo, BG Bulgaria R1b1a2
13 24 14 12 11-11 12 12 13 13 13 29

P.S. What about your Hodzha? Is it similar to the Albanian Hoxha, and comes from Arab "Haji", who made the pilgrim to Meccah? Are you Balkans converted to Muslim religion?

What about 248278. He is R1b1a2 and very similar to the above ones and is from the same geographical region:
12 24 14 11 11-14 12 12 12 13 13 30

Silesian
03-22-2014, 06:55 PM
Many thanks. Even though 12 markers are not enough to understand a relatedness, I think I can say that you all are closely related and probably you have a common ancestor in these last centuries. The mutations happened in DYS391 and DYS439 and could be an interesting sample of my theory of the "mutations around the modal". Many thanks again.
If his family is close to Gorno Brodi:


Residents of the village are named marvatsi and traditionally engaged in ore-mining and cattle. Gorno Brodi is the largest center in zhelezodobivaen Marvashko.

http://translate.google.ca/translate?hl=en&sl=bg&u=http://bg.wikipedia.org/wiki/%25D0%2593%25D0%25BE%25D1%2580%25D0%25BD%25D0%25BE _%25D0%2591%25D1%2580%25D0%25BE%25D0%25B4%25D0%25B 8&prev=/search%3Fq%3Dgorno%2Bbrodi%26client%3Dfirefox-a%26rls%3Dorg.mozilla:en-US:official%26channel%3Dnp%26biw%3D1424%26bih%3D75 9

B, is also R1b1a2a1-L150. R-CTS7763 R-L150 and from Silistra,Northern Bulgaria.

http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0056779

Pillar_of_fire
03-22-2014, 07:06 PM
Gorno Brodi can be translated as Upper ford.

zhelezodobiven - iron ore mining

so the translation should go - Gorno Brodi is the largest iron ore mining center in region of Marvashko

brygian
03-22-2014, 07:14 PM
Gorno Brodi can be translated as Upper ford.

zhelezodobiven - iron ore mining

so the translation should go - Gorno Brodi is the largest iron ore mining center in region of Marvashko

It has been in the past. There's been no mining there for at least a century. The village is located in present day Greece and its name in Greek is Ano Vrondu which is the same as Gorno Brodi in Bulgarian.

Pillar_of_fire
03-22-2014, 07:24 PM
It has been in the past. There's been no mining there for at least a century. The village is located in present day Greece and its name in Greek is Ano Vrondu which is the same as Gorno Brodi in Bulgarian.

the idea is if R1b1 can be tied up with locations where mining was a primary activity and therefore make a connection with Neolithic or Bronze dispersal of populations

brygian
03-22-2014, 08:16 PM
You will need a lot of data to be able to prove this. I have noticed something else that the people in this little group have in common - most of us come from mountainous regions. I think this was the case with the two Greek persons who tested positive for CTS7822. Albania is also a mountainous country.

brygian
03-23-2014, 10:33 AM
Of course I examined only these SNPs (already known), but I cannot exclude so far that you have some other mutation elsewhere. Not having a program for doing it, I should check every SNP, and they are many thousands. Let's wait that FTDNA publishes your Geno 2.0 you'll be able to send to some project, but you'll have to choose from FTDNA, and we all will be able to see.

Maybe if you tell me the algorithm, I can write a program to do the analysis automatically.

Rathna
03-23-2014, 12:43 PM
Maybe if you tell me the algorithm, I can write a program to do the analysis automatically.

Probably there already are many people with a program to exam the raw data. There was the "Itai Perez spreadsheet": if you find it, you may send him your raw data. But are you sure that FTDNA didn't post your mutations on your account? I received those of Fabrizio Federighi immediately.
But I think too that to find other mutations (probably very unlikable with Geno 2.0) is a little worth. What is important is your CTS9219, and I have posted above that it seems it is positive, also because it seems that Geno 2.0 reads the data forwards and not reverse, as it happened sometimes in Chromo2.
But I cannot say more.

brygian
03-23-2014, 02:50 PM
But are you sure that FTDNA didn't post your mutations on your account? I received those of Fabrizio Federighi immediately.

Status is still 'Ordered':

http://www.kumbarov.com/files/ftdna.png

I wrote to their support yesterday but I still haven't received an answer.

Joe B
03-23-2014, 05:19 PM
Status is still 'Ordered':

I wrote to their support yesterday but I still haven't received an answer.

Hey brygian,
Thanks for letting us in on your family history. The R1b-Z2103 subclades is especially full history that should humble one's soul.
When FTDNA does post your results, your haplogroup will be listed as R1b1a2a1 or R-L150 on the SNP page. They use a y-tree that is several years old. Also, only your positive results from Geno 2.0 will be posted.
Rathna is correct, CTS9219 is the farthest downstream SNP that Geno 2.0 will have for you. That's more significant than you might realize. Not so much in that it will give you great insight about your heritage right now, it might, but you will need more data. What's significant is that you are part of a newly uncovered branch of the phylogenetic y-tree. R1b-M269>L23>L150>Z2103>Z2105>Z2110/CTS7822>CTS9219 Z2103 and Z2105 are presumed.

For all the R1b-Z2110/CTS7822 folks.
Now that we have a decent number of people that are Z2110/CTS7822+, it's about time an effort was made to get it and CTS9219 listed on the ISOGG Y-tree. That may require validating results.
Listing Criteria for SNP Inclusion into the ISOGG Y-DNA Haplogroup Tree - 2014 (http://www.isogg.org/tree/ISOGG_SNP_Requirements.html)
Y-DNA Haplogroup R and its Subclades - 2014
That should go a long way in encouraging people to test for Z2110/CTS7822 and CTS9219.

Geolocke
03-23-2014, 08:07 PM
Looking at the Y-distribution maps on Europedia, this one seems appropriate for our group:
http://www.eupedia.com/europe/maps_Y-DNA_haplogroups.shtml#R1b-L23

However, given the continuing discoveries of new downstream SNPs in our group (or so it appears to me), could this map stand a revision, or is this map too generalized for that purpose?

Just curious.

Joe B
03-23-2014, 09:24 PM
Looking at the Y-distribution maps on Europedia, this one seems appropriate for our group:
http://www.eupedia.com/europe/maps_Y-DNA_haplogroups.shtml#R1b-L23

However, given the continuing discoveries of new downstream SNPs in our group (or so it appears to me), could this map stand a revision, or is this map too generalized for that purpose?

Just curious.
It was a nice attempt that left out an important R1b-Z2103 area south of Lake Van. That area, including northern Iraq has a fair amount of R1b-Z2103 in Assyrian, Armenian and other populations. Besides, with so little data, it's really hard to use a paint brush when dots will do. Semargl has a pretty good mapping tool. Just click the relevant SNP check boxes.
http://www.semargl.me/en/dna/ydna/all-snp-maps/
Geolocke, good to have you aboard.

brygian
03-26-2014, 06:59 PM
I wrote to FTDNA's support regarding the delay in transferring my results and this is what they replayed:


Hello,

Thank you for your email. We apologize for the extended delay, but we are currently experiencing some issues with the transfer process and uploading these results to the Family Tree DNA system. We are working to resolve this issue shortly and appreciate your patience.

brygian
03-29-2014, 12:32 PM
My results are now on FTDNA:

CTS10168+, CTS10362+, CTS10834+, CTS109+, CTS11358+, CTS11468+, CTS11575+, CTS11726+, CTS11985+, CTS12478+, CTS125+, CTS12632+, CTS1996+, CTS2134+, CTS2664+, CTS3063+, CTS3135+, CTS3331+, CTS3358+, CTS3431+, CTS3536+, CTS3575+, CTS3654+, CTS3662+, CTS3868+, CTS3996+, CTS4244+, CTS4364+, CTS4368+, CTS4437+, CTS4443+, CTS4740+, CTS5318+, CTS5457+, CTS5532+, CTS5577+, CTS5884+, CTS6135+, CTS623+, CTS6383+, CTS6800+, CTS6907+, CTS7400+, CTS7659+, CTS7822+, CTS7922+, CTS7933+, CTS8243+, CTS8591+, CTS8665+, CTS8728+, CTS8980+, CTS9219+, CTS9828+, F1046+, F115+, F1209+, F1302+, F1320+, F1329+, F1704+, F1714+, F1753+, F1767+, F1794+, F180+, F2048+, F2075+, F211+, F2142+, F2155+, F2302+, F2402+, F2587+, F2688+, F2710+, F2837+, F29+, F295+, F2985+, F2993+, F3111+, F313+, F3136+, F33+, F332+, F3335+, F344+, F3556+, F356+, F359+, F3692+, F378+, F4+, F47+, F506+, F556+, F63+, F640+, F647+, F652+, F671+, F719+, F82+, F83+, F93+, L132+, L15+, L150+, L16+, L23+, L265+, L278+, L350+, L388+, L389+, L407+, L468+, L470+, L471+, L478+, L482+, L483+, L498+, L500+, L502+, L506+, L585+, L721+, L747+, L752+, L754+, L761+, L768+, L773+, L774+, L779+, L82+, M139+, M168+, M207+, M235+, M294+, M343+, M415+, M42+, M45+, M526+, M89+, M94+, P128+, P131+, P132+, P135+, P136+, P138+, P14+, P141+, P145+, P146+, P148+, P151+, P158+, P159+, P160+, P166+, P187+, P207+, P225+, P226+, P228+, P229+, P230+, P232+, P233+, P235+, P236+, P237+, P238+, P240+, P242+, P243+, P244+, P245+, P280+, P281+, P282+, P283+, P284+, P285+, P286+, P295+, P297+, PAGES00083+, PF1016+, PF1029+, PF1031+, PF1040+, PF1046+, PF1061+, PF1092+, PF1097+, PF110+, PF1203+, PF1269+, PF1276+, PF192+, PF210+, PF212+, PF223+, PF234+, PF258+, PF2591+, PF2593+, PF2599+, PF2608+, PF2611+, PF2615+, PF2624+, PF263+, PF2643+, PF272+, PF2745+, PF2747+, PF2748+, PF2749+, PF2770+, PF278+, PF292+, PF316+, PF325+, PF342+, PF500+, PF5465+, PF5466+, PF5468+, PF5471+, PF5851+, PF5853+, PF5854+, PF5865+, PF5869+, PF5871+, PF5882+, PF5886+, PF5887+, PF5888+, PF5953+, PF5956+, PF5957+, PF5964+, PF5965+, PF5982+, PF6063+, PF6091+, PF6145+, PF6246+, PF6249+, PF6250+, PF6263+, PF6265+, PF6270+, PF6271+, PF6272+, PF6404+, PF6409+, PF6411+, PF6424+, PF6425+, PF6430+, PF6432+, PF6434+, PF6438+, PF6443+, PF6463+, PF6494+, PF6495+, PF6498+, PF6500+, PF6506+, PF6507+, PF6509+, PF6524+, PF667+, PF719+, PF725+, PF779+, PF796+, PF803+, PF815+, PF821+, PF840+, PF844+, PF892+, PF937+, PF951+, PF954+, PF970+, s10+, s3+, V186+, V189+, V205+, V52+, V9+, YSC0000067+, YSC0000072+, YSC0000075+, YSC0000166+, YSC0000176+, YSC0000179+, YSC0000182+, YSC0000186+, YSC0000194+, YSC0000201+, YSC0000203+, YSC0000205+, YSC0000207+, YSC0000213+, YSC0000219+, YSC0000224+, YSC0000225+, YSC0000227+, YSC0000230+, YSC0000232+, YSC0000233+, YSC0000251+, YSC0000269+, YSC0000270+, YSC0000279+, YSC0000288+, YSC0000294+

Rathna
03-29-2014, 01:26 PM
Brygian, it is confirmed all what I said: you are R-CTS9219+ (the 7 ancestral SNPs I spoke about elsewhere aren't tested).

smal
03-29-2014, 01:26 PM
You are CTS7822+ CTS9219+.

brygian
03-29-2014, 01:44 PM
Brygian, it is confirmed all what I said: you are R-CTS9219+ (the 7 ancestral SNPs I spoke about elsewhere aren't tested).

Where can I do that testing?

I compared my results with the results of the R-CTS9219+ positive people in the R1b1a2 (P312- U106-) group and I can't find a perfect match. This is how my results differ from the other in my group:


+++ my.txt 2014+03+29 14:36:06.755862748 -0100
--- 257843.txt 2014+03+29 14:36:06.743862689 -0100
-F212
+F2302
-L566
-L781
+M343
-PF15
-PF2600
-PF2631
-PF6007
-PF601
-PF720
-Z2103
-Z2105

+++ my.txt 2014+03+29 14:36:06.755862748 -0100
--- 300134.txt 2014+03+29 14:36:06.747862708 -0100
-CTS8749
-F212
-L566
-L781
-PF15
-PF2600
-PF2631
-PF6007
-PF601
-PF720

+++ my.txt 2014+03+29 14:36:06.755862748 -0100
--- N112689.txt 2014+03+29 14:36:06.755862748 -0100
-F212
+F2302
-L566
-L781
-PF15
-PF2600
-PF2631
-PF6007
-PF601
-PF720

+++ my.txt 2014+03+29 14:36:06.755862748 -0100
--- N115142.txt 2014+03+29 14:36:06.759862768 -0100
-F212
-L566
-L781
-PF15
-PF2600
-PF2631
-PF6007
-PF601
-PF720

+++ my.txt 2014+03+29 14:36:06.755862748 -0100
--- N24004.txt 2014+03+29 14:36:06.763862788 -0100
-F212
+F2302
-L566
-L781
-PF112
-PF15
-PF2600
-PF2631
-PF6007
-PF601
-PF720

Should this mean something?

Rathna
03-29-2014, 01:55 PM
Should this mean something?

Nothing. I have said before (and demonstrated in another thread) that these SNPs you haven't are SNPs ancestral (above all of hg P) that Geno 2.0 doesn't show anymore.
You are R-CTS9219*, or if you prefer with smal R-CTS7822/Z2110/CTS9219+, but CTS9219+ is a subclade of R-CTS7822/Z2110+ (mine). The thing very important, as I said above, is that we know now that the Balkan cluster (yours) is a subclade of R-Z2110* (mine from Italy, also the last tested Milani, and I think the large part of the Italian R-L23, and the British ones like Ware, whose we are waiting for his Big Y).

brygian
03-29-2014, 02:00 PM
Can I test for more markers beneath CTS9219?

smal
03-29-2014, 02:15 PM
You should order BigY test. In this case we can compare your BigY results and HG01515 sample from 1KGP to find new SNPs.

Joe B
03-29-2014, 05:26 PM
Where can I do that testing?

I compared my results with the results of the R-CTS9219+ positive people in the R1b1a2 (P312- U106-) group and I can't find a perfect match. This is how my results differ from the other in my group:



Should this mean something?
Good to see those Geno 2.0 results posted. One of the resources that many of us use is the Morley Y-SNP Terminal Subclade Predictor and the Experimental Y-SNP Phylogenies.
http://ytree.morleydna.com/
Plug in your results and it says this near the top.

This suggested classification does not account for the following positive SNPs:
F2302 (Geno 2.0 results are erratic for this SNP)
A planned future enhancement will further clarify which of these "not placed" SNPs are globally erratic, which are locally ambiguous and which are potential novel terminal SNPs.
The Experimental Y-SNP Phylogenies is excellent reading and has notations about many SNPs that you may find useful. http://ytree.morleydna.com/experimental-phylogeny
Page 45, line 2193 of version: 7 February 2014 is where you would be. Hopefully you will make the next issue.

Z2103, Z2105, L277 and L585 are some of the SNPs that were not included on the Geno 2.0 SNP array test. You should be Z2103+, Z2105+, L277- and L585- based on known phylogeny.
I agree with smal, you are in the SNP discovery area now. Keep an eye on BritainsDNA Chromo 2 for their possible downstream SNPs too.

Any thoughts about testing more STRs? 67 or 111 STRs are the gold and platinum levels. So far at least six R1b-CTS7822/Z2110+ folks have tested to 111 STRs, two of which are R-CTS7822/Z2110/CTS9219+ too.

brygian
03-29-2014, 06:18 PM
Any thoughts about testing more STRs? 67 or 111 STRs are the gold and platinum levels.

So what should I order - Y111 or Big Y? What would be the difference?

Joe B
03-29-2014, 06:53 PM
So what should I order - Y111 or Big Y? What would be the difference?
Hi brygian,
Greed says order both. SNPs are for deep ancestry and STRs are for a closer time frame. Eventually you will want both. Because of convergence, 25 STRs is not enough to compare yourself to haplotypes that have not SNP tested. http://www.isogg.org/wiki/Convergence
If you are ready for Big Y go for it as that will help with SNP discovery. Somebody mentioned somewhere that YFULL http://www.yfull.com/ is teasing a lot of information from Big Y results including mtdna and maybe STRs. That needs to be confirmed. Big Y is still a beta product so we don't know all the information it will provide.
Y-STR(short tandem repeat) http://isogg.org/wiki/Y-STR
Y-SNP(single-nucleotide polymorphism) http://www.isogg.org/wiki/SNP_testing
Any and all of your testing is appreciated.
Joe

brygian
03-29-2014, 07:43 PM
I am a little bit confused. Let's put the question this way: what kind of information will I get if I order Y111 and what could it be useful for? And what kind of information will I get if I order Big Y and what could it be useful for?

You mentioned BritainsDNA Chromo 2. How does this test compare to FTDNA's? Their Chromo2 Raw YDNA is substantially cheaper than Y111. How 'raw' the results are and is it possible to transfer the raw data to FTDNA?

lgmayka
03-29-2014, 08:25 PM
Somebody mentioned somewhere that YFULL http://www.yfull.com/ is teasing a lot of information from Big Y results including mtdna and maybe STRs.
This blogger indeed got Y-STRs and mtDNA from YFull's analysis (http://www.fc.id.au/2014/03/yfull-y-chr-sequence-interpretation.html) of his Big Y (.bam) file. As long as YFull is offering their service for free, Big Y is an amazing bargain for anyone who does not yet have 111 markers or full mtDNA sequencing.

I myself would therefore recommend Big Y to anyone who can afford it.

Joe B
03-29-2014, 08:40 PM
I am a little bit confused. Let's put the question this way: what kind of information will I get if I order Y111 and what could it be useful for? And what kind of information will I get if I order Big Y and what could it be useful for?

You mentioned BritainsDNA Chromo 2. How does this test compare to FTDNA's? Their Chromo2 Raw YDNA is substantially cheaper than Y111. How 'raw' the results are and is it possible to transfer the raw data to FTDNA?
It is confusing compounded by the fact that you have reached the cutting edge of this science.
STRs will be most useful to you when comparing yourself to people that are STR tested only or modestly SNP tested. Unfortunately, most people will not be as well SNP tested as you. Those STRs come in handy then.
BritainsDNA Chromo 2 and Geno 2.0 are SNP tests as is the BIG Y. Chrome 2 is newer than Geno 2.0 and may or may not go a little deeper into your clade.
Y111, Y67 are STR test. STRs and SNPs tell you to different things so BritainsDNA Chromo 2 is not the same as Y111. Two different things.
ISOGG wiki explains it better than me. http://isogg.org/wiki/Y_chromosome_DNA_tests FTDNA info: https://www.familytreedna.com/learn/y-dna-testing/
You don't have to do it all at once. You can upgrade from 25 STRs to 37 STRs for a start. FTDNA puts the STR tests on sale now and then too. Fathers day maybe?
We should be learning a lot more about Big Y and how good it is in the next few weeks as more beta tests are released.
brygian, glad you are here and willing to push this clade to develop more. It needs it.

lgmayka has good advice. He was the first Group Administrator to recognize R1b-CTS7822/Z2110 in the Polish DNA Project. https://www.familytreedna.com/public/polish/default.aspx?section=ycolorized Our clades are on the last page!

Geolocke
03-29-2014, 10:42 PM
Brygian, to add to (affirm) what Joe B just said, I initially tested Y12 STR back in 2005 and have been upgrading my test (now Y67 STR ) through the years as sales have been held. I have also been SNP testing as funds and tests have been available. My STR tests tell me how closely I am associated with other family members (e.g. how many generations back to our common ancestor) whereas my SNP gives me the deeper (archeological) history of my particular genetic lineage. My family (Locke) is part of a "mini-cluster" in southwest England where we are both close in the STR matches as well as the SNP matches.

Where I was originally most interested in finding where my Locke Family came from, I am now far more captivated by the fact that:
A ) by STR testing, I belong to a group of several families with very different surnames, but all originating from the same general location in SW England, and
B ) we are all part of this "new" branch of the R1b tree which has, overall, fewer occurrences in England than in other parts of Europe.

How did we get there?
How many generations back to our common ancestor?
What does our being in SW England have to do with the bigger picture of this particular sub-clade?

I wish I could max out my testing all at once and let the Population Geneticists have my data so they could add it to their analysis, but I have to bide my time while I build up my testing funds. Next on my testing agenda will be upgrading to Y111 STR and then capping it of with Big-Y.

FT-DNA likes to have sales around Father's Day (June) but they also usually have a sale in April around DNA Day, so watch your emails for an announcement. Mother's day (May) is also a time when they hold mtDNA sales.

Joe B
04-27-2014, 09:23 PM
There is a possibility to order CTS7822 from FTDNA now.
That is very important news from smal. FTDNA is now offering CTS7822/Z2110, CTS9219 and CTS699 as single SNP test.
That makes six ways to test for CTS7822/Z2110, Geno 2.0, Chromo 2.0, Full Genomes, Big Y, the FTDNA tree and YSEQ.

Geolocke
04-28-2014, 12:44 AM
So let me get this straight. Z2110/CTS7822 is now represented on FTDNA's new Y-Tree and is available as a single SNP test. However, This same SNP is not represented on ISOGG's new R 2014 Y-Tree at all, neither on the Tree proper, private, or investigational? Have I overlooked something or perhaps there is another name for Z2110/CTS7822?

Can we set the clock back 3 days and take a deep breath?

Feeling more confused than ever. :\

brygian
04-28-2014, 05:08 PM
So let me get this straight. Z2110/CTS7822 is now represented on FTDNA's new Y-Tree and is available as a single SNP test. However, This same SNP is not represented on ISOGG's new R 2014 Y-Tree at all, neither on the Tree proper, private, or investigational? Have I overlooked something or perhaps there is another name for Z2110/CTS7822?

Can we set the clock back 3 days and take a deep breath?

Feeling more confused than ever. :\

We are working on getting CTS7822 on ISOGG's tree. Hopefully it will be there very soon.

Joe B
04-28-2014, 05:21 PM
CTS7822 and other changes at the R1b1a2 (P312- U106-) DNA Project (aka ht35 Project) (https://www.familytreedna.com/public/ht35new,ht35new/default.aspx?section=ycolorized) today! Many thanks and appreciation to Peter H.

Pillar_of_fire
04-28-2014, 06:10 PM
CTS7822 and other changes at the R1b1a2 (P312- U106-) DNA Project (aka ht35 Project) (https://www.familytreedna.com/public/ht35new,ht35new/default.aspx?section=ycolorized) today! Many thanks and appreciation to Peter H.

I am sorry to notice that N112116 is assigned to the group X: NOT ELIGIBLE: R1b1a2a1a1a = U106+ & R1b1a2a1a1b = P312+ and below...

this is result of the R-Z47 wrong assignment

brygian
04-28-2014, 07:15 PM
CTS7822 and other changes at the R1b1a2 (P312- U106-) DNA Project (aka ht35 Project) (https://www.familytreedna.com/public/ht35new,ht35new/default.aspx?section=ycolorized) today! Many thanks and appreciation to Peter H.

That group is a complete mess. There is a subgroup _b4a. CTS7822+/Z2110+ and CTS9219+ but it has only one member even though there are several CTS7822+/Z2110+ and CTS9219+ in the project.

Joe B
04-28-2014, 07:17 PM
I am sorry to notice that N112116 is assigned to the group X: NOT ELIGIBLE: R1b1a2a1a1a = U106+ & R1b1a2a1a1b = P312+ and below...

this is result of the R-Z47 wrong assignment
Fire,
Thank you for pointing that out and the reason for it. I will pass that along to Peter H. immediately. That Big Y should be enough evidence. Expect more activity as the R1b1a2 (P312- U106-) DNA Project (aka ht35 Project) is updated.

Joe B
04-28-2014, 07:30 PM
That group is a complete mess. There is a subgroup _b4a. CTS7822+/Z2110+ and CTS9219+ but it has only one member even though there are several CTS7822+/Z2110+ and CTS9219+ in the project.
These things take time. Your patience is required and needed. It takes human eyes to look over what the FTDNA tools spit out. Positive changes are happening by volunteers, "Good Vibrations (https://www.youtube.com/watch?v=Eab_beh07HU)" are needed.
Thanks for pointing that out too.

Geolocke
04-28-2014, 11:33 PM
I just received the following notice from FTDNA about an hour ago:

"Dear Group Administrators,

Thank you for all the feedback about the 2014 Haplotree! We appreciate your efforts on behalf of your groups.

We'll correct many of the issues you've brought to our attention over the next few days. In the meantime, we’ve temporarily turned off the SNP order recommendation feature, since it needs accurate results to make those recommendations. Note however, that although the recommendation program is turned off, downstream SNPs will still show as available for purchase. In addition, any customers who ordered inappropriate SNPs can have those orders transferred to appropriate SNPs or, if none are available, get a full refund.

Some of the issues that we'll be addressing include:
•Correcting the algorithm that assigned the haplogroup for the multi-locus markers (the .1, .2, .3 SNPs)
•Syncing data for users that tested with Geno 2.0

Please report any issues using the feedback form, choosing the "About the Y-tree" category. Include as much detail as you can including the kit number so we can thoroughly investigate.


While we understand there are some concerns regarding specific SNPs, we will review those on a case-by-case basis.

Thanks for your help!"

It is reassuring to learn so quickly that FTDNA is aware of the issues and is making every effort to correct the problems.

Geolocke
04-29-2014, 12:06 AM
We are working on getting CTS7822 on ISOGG's tree. Hopefully it will be there very soon.

So would it be safe to say that the more folks that test (consistently/successfully) for CTS7822, the sooner we'll have the data necessary to add it to ISOGG's tree? That would work for me.

Joe B
04-29-2014, 03:03 AM
So would it be safe to say that the more folks that test (consistently/successfully) for CTS7822, the sooner we'll have the data necessary to add it to ISOGG's tree? That would work for me.
That's so true. The more folks that test for CTS7822, the more we will learn. Testing negative for CTS7822 is also very informative for ISOGG to prove that it is a brother clade, or whatever the correct term is, to L277, L584 etc.
No shame in a negative SNP result, rather proud of mine.

Joe B
04-29-2014, 08:27 AM
Two R1b-CTS9219 kits are missing data in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?/publicwebsite.aspx%3Fsection=yresults). 314859 is missing their SNP results and N112689 seems to be missing STRs. Any ideas about this missing data would be appreciated.

Geolocke
04-29-2014, 10:26 AM
That's so true. The more folks that test for CTS7822, the more we will learn. Testing negative for CTS7822 is also very informative for ISOGG to prove that it is a brother clade, or whatever the correct term is, to L277, L584 etc.
No shame in a negative SNP result, rather proud of mine.

I guess I should have worded it differently. What I meant by the phrase "successfully/consistently" was in reference to what began happening with L150 returning inconsistent results.

I for one am grateful for this being made available for single SNP testing regardless of my own results pos or neg. Before Sept. 2012, when I first became aware of being part of this branch of R1b through the ht35 project, my focus was almost entirely on STR matches for our surname project. I have learned so much more about this side of the DNA in the last year and a half, and mostly from guidance provided through these boards. As a lay-person, I equate the experience I've had learning about this "new" branch to being like a surfer catching the "perfect wave" and riding it for a long time. Thanks to all y'all!

brygian
04-29-2014, 05:21 PM
What information is needed for a project manager to push the SNP request button for CTS7822/Z2110?

A total of ten kits have tested CTS7822+ and seven of those ten tested CTS9219+.

CTS7822*
247019 CTS7822+ N. Carolina, USA str111
N29277 CTS7822+ Italy
N115176/N98739 CTS7822+, L584- Greece**

CTS7822>CTS9219*
257843 CTS7822+, CTS9219+, Z2103+, Z2105+ Unknown/Jewish Project str111
N115142 CTS7822+, CTS9219+ Germany
N114393 CTS7822+, CTS9219+ Unknown/White Surname Project
N112689 CTS7822+, CTS9219+ Russia
N115870 CTS7822+, CTS9219+ France
N116170 CTS7822+, CTS9219+ Greece
278024 CTS7822+, CTS9219+ Poland

12 STR Modal
MIN 11 24 14 10 11-13 12 12 12 12 12 28
MAX 13 25 15 12 11-15 12 12 13 13 13 30
MODE 12 24 14 11 11-14 12 12 12 13 13 29

Page 38 of the Chris Morley experimental computer-generated Y-chromosomal phylogeny (http://ytree.morleydna.com/experimental-phylogeny) clearly shows that CTS7822 could be as important as L584 or L277 to our subclade. That should not be a surprise since Geno 2.0 has identified these kits as CTS7822 from the beginning. The L150 label is from FTDNA.

CTS9219 may be an important SNP under CTS7822 that should be considered too.

A SNP request for our subclade may be buried under an avalanche of SNP requests from our R1b downstream cousins. Ftdna has indicated limited space for new SNPs so it is important submit our request with good justification and early. SNP CTS7822 is showing up in roughly 1/3 or the R1b-L23xL51 Geno 2.0 test kits posted to FTDNA. Hopefully that is a big enough market for SNPs CTS7822 and CTS9219 to add them to the a la carte snp list.

** N115176/N98739 is the same individual as per kostop.

I have a total of 14 CTS9219+ on my list:

N24004 James F. Sands, b. 1817 and d. 1887 USA 12 23 14 11 11-11 12 12 12 13 13 29
N115142 Hanse Casper Soltz, b. 1657, Germany; Germany 12 24 14 11 11-13 12 12 13 12 13 28 16 9-10 11 11 24 14 19 30 14-14-17-17 11 11 19-23 15 15 20 18 35-36 12 12
257843 Jew Unknown Origin 12 24 14 12 11-14 12 12 12 13 13 29 16 9-10 11 11 25 15 19 30 14-15-17-18 11 11 19-23 15 16 18 16 35-35 12 12 11 9 15-16 8 10 10 8 10 11 12 23-23 16 10 12 12 15 8 12 22 20 14 12 11 13 11 12 12 12 34 15 9 15 12 26 26 19 12 11 13 12 10 9 12 11 10 11 11 30 12 12 24 14 10 10 20 15 18 14 24 16 12 16 24 12 23 18 10 14 17 9 12 11
289628 Russian Federation 12 24 14 10 11-14 12 12 12 13 13 30 16 9-10 11 11 25 15 19 31 14-15-16-18 10 10 19-23 15 15 18 15 37-37 12 12 11 9 15-16 8 10 10 8 10 10 12 22-23 16 10 12 12 17 9 12 22 20 14 13 11 13 11 11 12 12 35 15 9 16 12 28 26 19 12 11 13 11 10 9 12 11 10 11 11 30 12 13 24 14 10 10 20 15 21 13 24 18 11 15 23 12 23 18 10 14 18 9 12 11
300134 Leo Nikolai (father from Russia) b.1917 d.1999, Jew Finland 12 25 14 10 11-15 12 12 13 14 13 30 15 10-10 11 11 25 15 19 32 14-15-16-19 11 11 19-23 15 16 18 17 37-37 12 12 11 9 15-16 8 10 10 8 10 11 12 23-25 17 10 12 12 16 8 12 21 20 14 12 11 13 11 11 12 12
314859 Ahmed Hodzha Sertkehayov, d.1912 (Pomak) Bulgaria 13 24 14 12 11-11 12 12 12 13 13 29 16 8-10 12 11 25 15 19 30 14-14-15-16
278024 Swoboda Poland 13 25 15 10 11-14 12 12 12 13 13 30
257843 Shomo, Jew Unknown Origin
N112689 I. (Kursk) Russian Federation
N115870 Claude Bastard, 1747 - 1782 France
N116170 Greece
N118997 Walenty Straszewski b 1731 and d 1811 Poland
N114393 White Unknown Origin
HGO1515 Unknown Origin


Two R1b-CTS9219 kits are missing data in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?/publicwebsite.aspx%3Fsection=yresults). 314859 is missing their SNP results and N112689 seems to be missing STRs. Any ideas about this missing data would be appreciated.

As I said earlier, the R1b1a2 (P312- U106-) project is not very well maintained. I heard that a new group on L23 is going to be created on FTDNA but don't know any details yet.

smal
04-29-2014, 05:54 PM
brygian, there are so many bugs in FTDNA projects now.


Two R1b-CTS9219 kits are missing data in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?/publicwebsite.aspx%3Fsection=yresults). 314859 is missing their SNP results and N112689 seems to be missing STRs. Any ideas about this missing data would be appreciated.

Joe B
04-29-2014, 05:55 PM
As I said earlier, the R1b1a2 (P312- U106-) project is not very well maintained. I heard that a new group on L23 is going to be created on FTDNA but don't know any details yet.Think long and hard about that. I know nobody has talked to me about a new project and they would not have my support right now.

Geolocke
04-30-2014, 04:41 PM
I ordered CTS7822 last night. I will reassess further testing on the outcome of those results.

Joe B
05-01-2014, 06:33 PM
We are working on getting CTS7822 on ISOGG's tree. Hopefully it will be there very soon.
ISOGG revised the listing criteria.

This looked important and may impact getting CTS7822/Z2110 listed on the ISOGG tree.

3. Microarray Chip-based Genotyping
Examples of microarray chip-based genotyping are Geno 2.0, 23andMe, Chromo 2.0.

a. Novel SNPs found in microarray products without a presence also in other qualifying sources - such as Sanger sequencing or next generation sequencing - cannot be submitted. However, chip-based genotyping results can be used in combination with Sanger sequencing and/or next generation sequencing results as validating evidence for one of the samples. If chip-based genotyping is part of the evidence, the approved SNP will be listed in regular type, rather than italics, even if the other evidence is from next generation sequencing.
b. Samples from chip-based genotyping used to prove a new terminal branch must meet the criteria for STR diversity described in the Sanger sequencing section.

http://www.isogg.org/tree/ISOGG_SNP_Requirements.html

International Society of Genetic Genealogy (2014). Y-DNA Haplogroup Tree 2014, Version: 9.54, Date: 30 April 2014, http://www.isogg.org/tree/ May 01,20014.

brygian
05-01-2014, 06:47 PM
If I understand this correctly, if we have one CTS7822+ tested with Geno 2.0 and one more tested with Sanger sequencing or Next Generation sequencing, then we can still apply. Is that correct? If this is the case, then we can apply right away. I have Geno 2.0 results while N112116 has both Geno 2.0 and Big Y as well as Y67. Otherwise we can wait for my results from YSEQ.

Joe B
05-01-2014, 08:30 PM
If I understand this correctly, if we have one CTS7822+ tested with Geno 2.0 and one more tested with Sanger sequencing or Next Generation sequencing, then we can still apply. Is that correct? If this is the case, then we can apply right away. I have Geno 2.0 results while N112116 has both Geno 2.0 and Big Y as well as Y67. Otherwise we can wait for my results from YSEQ.
I think the best thing is to get a CTS7822/Z2110 and CTS9219 application to them right away. That way they will be alerted and know we are serious.
We will have very detailed SNP information from YSEQ the way they report results. I've read of people ordering CTS7822 from FTDNA too.
This should be the immediate goal.
Provisional SNPs are color coded purple and defined as: SNPs newly submitted to the ISOGG committee that have sufficient information to be at an approximate tree position but require better evidence for exact placement.

Here is my list of CTS7822+ folks. It's a little old. Compare it to yours.

Kit Number.....Project.....Country.....Haplogroup..... SNPs
N115176/N98739 Greek DNA Project Greece R1b1a2a1 CTS7822+, Geno2.0, L150+, L23+, L584-
247019 Ware Surname Project North Carolina R1b1a2a1 CTS7822+, Geno2.0
N29277 Italy DNA Project Italy R1b1a2a1 CTS7822+, Geno2.0
272057 Ireland Project Ireland? R1b1a2a1 CTS7822+, Geno2.0
N112116 Bulgarian Project Bulgaria R1b1a2 CTS7822+, Z2103+, Z2105+, L277-, L584-, Big Y
H1614 Italy Project Italy R1b1a2 CTS7822+, Chomo 2
H1621 Italy Project Italy R1b1a2 CTS7822+, Predicted
108347 R1b1a2 (P312- U106-) DNA Project England R1b1a2a CTS7822+, F672, Geno2.0, L150-, L23+, Z2103+, Z2105+, L277-, L584-
N24004 R1b1a2 (P312- U106-) DNA Project USA W. Virginia R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
257843 Jewish DNA Project R1b1a2a1 CTS7822+, CTS9219+, Z2103+, Z2105+, Geno2.0
N115142 German DNA Project Germany R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
N112689 Russia DNA Project Russian Federation R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
300134 JewishGen Scandinavia SIG DNA Project Finland R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
278024 Polish Project Poland R1b1a2a1 CTS7822+, CTS9219+, Geno2.0
289628 R1b1a2 (P312- U106-) DNA Project R1b1a2a1 CTS7822+, CTS9219+, Geno 2.0
314859 Bulgarian Project Bulgaria R1b1a2 CTS7822+, CTS9219+, Geno 2.0
N112516 Italy DNA Project Italy R1b1a2a1 CTS7822+, Geno2.0 strs?
N114393 White Surname Project R1b1a2a2 CTS7822+, CTS9219+, Geno2.0 strs?
N115870 French Heritage Project R1b1a2a1 CTS7822+, CTS9219+, Geno2.0 strs?
N116170 Arcadia Project Greece R1b1a2a1 CTS7822+, CTS9219+, Geno2.0 strs?
HGO1515 1000 Genomes Spain CTS7822+, CTS9219+
HGO1277 1000 Genomes Columbia CTS7822+, CTS699+

brygian
05-01-2014, 08:47 PM
A lot of SNP data from Geno 2.0 is missing on FTDNA as it is being reimported. We can wait until it is finished. I don't have a list of CTS7822+ people but am going to scan FTDNA for this SNP once they have imported all Geno 2.0 results back. I have a CTS9219+ list and you have all the matches that I have except for N118997 Walenty Straszewski b 1731 and d 1811, Poland. He is in the R1b1a2 (P312- U106-) project.

brygian
05-01-2014, 08:51 PM
I've read of people ordering CTS7822 from FTDNA too.

We have three such people in the Bulgarian project. Hopefully the results will be announced soon. I have information about more people from the Bulgarian project who are considering ordering CTS7822 and CTS9219 from FTDNA pending the results of the first three I mentioned.

Joe B
05-01-2014, 09:11 PM
A lot of SNP data from Geno 2.0 is missing on FTDNA as it is being reimported. We can wait until it is finished. I don't have a list of CTS7822+ people but am going to scan FTDNA for this SNP once they have imported all Geno 2.0 results back. I have a CTS9219+ list and you have all the matches that I have except for N118997 Walenty Straszewski b 1731 and d 1811, Poland. He is in the R1b1a2 (P312- U106-) project.
No need to wait for FTDNA to fix things, the R-CTS7822 and R-CTS-9219 SNP results are saved for when you need them. Another great resourse is semargl.me for finding CTS7822 negative and positive results.

Pillar_of_fire
05-02-2014, 10:05 AM
If I understand this correctly, if we have one CTS7822+ tested with Geno 2.0 and one more tested with Sanger sequencing or Next Generation sequencing, then we can still apply. Is that correct? If this is the case, then we can apply right away. I have Geno 2.0 results while N112116 has both Geno 2.0 and Big Y as well as Y67. Otherwise we can wait for my results from YSEQ.

One clarification - N112116 has only BIG Y, he has not done Geno 2.0

razyn
05-02-2014, 08:37 PM
One of your CTS7822 guys is in the DF27 project, #272057. Have you tracked him down yet? You had ID'd him in an Ireland project. I can email him, if he isn't yet following your study.

Joe B
05-02-2014, 08:48 PM
One of your CTS7822 guys is in the DF27 project, #272057. Have you tracked him down yet? You had ID'd him in an Ireland project. I can email him, if he isn't yet following your study.
Thanks razyn,
Please have him join the R1b1a2 (P312- U106-) DNA Project (aka ht35 Project) (https://www.familytreedna.com/public/ht35new/default.aspx?/publicwebsite.aspx%3Fsection=yresults) right away. The project has new and accurate phylogenetic trees.
Did a quick look at your very well maintained DF27 project and did not see anybody else that was obvious.
Thank you Sir!

razyn
05-02-2014, 11:54 PM
OK, I have sent him links to that project, and this thread. Good luck.

Joe B
05-10-2014, 05:16 AM
One of the first CTS7822/Z2110 SNP test result using Sanger sequencing from the FTDNA lab is posted in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?section=ycolorized). Thanks for testing. Hopefully the first of many results for CTS7822.

brygian
05-10-2014, 08:42 AM
One of the first CTS7822/Z2110 SNP test results using Sanger sequencing from the FTDNA lab is posted in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?section=ycolorized). Thanks for testing. Hopefully the first of many results for CTS7822.

Very good. Do you know if he is going to order downstream SNP tests? If his results are out, then we should be getting some more CTS7822 results very very soon.

Geolocke
05-10-2014, 12:14 PM
One of the first CTS7822/Z2110 SNP test results using Sanger sequencing from the FTDNA lab is posted in the R1b1a2 (P312- U106-) DNA Project (https://www.familytreedna.com/public/ht35new/default.aspx?section=ycolorized). Thanks for testing. Hopefully the first of many results for CTS7822.

Joe, my brain is a little foggy this morning. I thought that FTDNA was using Next Gen Sequencing. From what I've read though, Sanger sequencing is the standard, so this is good news indeed.