PDA

View Full Version : DF99 (P312>DF99)



Pages : [1] 2 3 4

VinceT
08-11-2013, 10:32 PM
DF99 defines a new branch under P312

http://tech.groups.yahoo.com/group/R1b-P312-Project/message/6036


The defining SNP is C8829491A and was found in NA20783 and HG02008, from
Tuscany and Peru, and has also been confirmed in at least one British sample.

GoldenHind
08-11-2013, 11:41 PM
DF99 defines a new branch under P312

http://tech.groups.yahoo.com/group/R1b-P312-Project/message/6036


The defining SNP is C8829491A and was found in NA20783 and HG02008, from
Tuscany and Peru, and has also been confirmed in at least one British sample.

Excellent news! If it has been found in Tuscany, Peru and Britain, it must truly be old and widespread. Now we just need to get some company to offer testing for it.

TigerMW
08-12-2013, 01:52 AM
It looks like our fine citizen-scientists have struck again. With geographic samples that include Tuscany, Peru and the British Isles, I think we have to consider that DF99 is widespread and could be quite old.

It deserves its own thread.

brianlm1
08-12-2013, 08:51 AM
Is it one I should test for?

TigerMW
08-12-2013, 12:53 PM
I have received clarification of what we know about DF99's positioning.


Yes you are correct. DF99 is parallel to L21, U152, DF27 and DF19 underneath of
P312.

Looking at the data, DF99 could conceivably be upstream of L238, but
unfortunately I don't have any L238 samples to test http://tech.groups.yahoo.com/group/R1b-P312-Project/message/6039

An L238 person needs to test for DF99 before we know for sure DF99's position, but it could either upstream of L238 or parallel. We already know it is parallel to U152, L21, DF27 and DF19.

TigerMW
08-12-2013, 12:55 PM
Is it one I should test for?

Have you tested for U152, L21 and DF27. Odds are more likely you'll be one of those three than DF99 but DF99 is definitely an option for P312+ U152- L21- DF27- people. Of course, DF19 and L238 are also options. DF19 may be larger than we think but it won't be as large as U152, L21 or DF27.

R.Rocca
08-12-2013, 01:16 PM
I will verify with @AndyG, but two L238 samples are DF99- and four DF99+ samples are L238-, so I think the likelihood of them being on the same branch is highly unlikely, unless of course there is missing data somewhere in all six of these samples.

rms2
08-12-2013, 01:29 PM
DF99, an easy SNP to remember, with its own theme song:

http://www.youtube.com/watch?v=qVjCag8XoHQ B)

razyn
08-12-2013, 01:56 PM
DF19 may be larger than we think but it won't be as large as U152, L21 or DF27.
I'm pretty sure I agree (although it might depend on how large you think, vs. I think, DF19 is). What may become more interesting, as these other high-level branches of P312 get identified, is the variance and age of several clades (including DF27, DF19, L238 and now DF99) that are all but untouched in academic studies to date. My impression is that the implied geographical information about the origin and diffusion of Mr. L11 and his patrilineal descendants is being shifted northward and eastward. Probably someone else is getting a completely different impression; anyway, it's interesting to watch. FUN to watch, really. A couple of years ago, large areas within Europe that happened not to be rich in L21, U152 and/or U106 were genetic terra incognita. That's changing rapidly.

R.Rocca
08-12-2013, 03:56 PM
I'm pretty sure I agree (although it might depend on how large you think, vs. I think, DF19 is). What may become more interesting, as these other high-level branches of P312 get identified, is the variance and age of several clades (including DF27, DF19, L238 and now DF99) that are all but untouched in academic studies to date. My impression is that the implied geographical information about the origin and diffusion of Mr. L11 and his patrilineal descendants is being shifted northward and eastward. Probably someone else is getting a completely different impression; anyway, it's interesting to watch. FUN to watch, really. A couple of years ago, large areas within Europe that happened not to be rich in L21, U152 and/or U106 were genetic terra incognita. That's changing rapidly.

IMO, not much has changed since 2010. In academic studies, L21, U152 and U106 are being found exactly where they were expected to be found with frequencies that were expected with a few percentage points higher or lower.

As for a shift north/east for an L11 origin, the chances become more unlikely with every new ancient DNA result. This is especially true with Corded Ware samples where R1b is still absent in German and Polish samples (R1a, I/J and G). Clearly the front-runner of an L11 origin in the north is still the Low Countries with Dutch Bell Beaker, but we are then considering a NW origin, not NE. Unfortunately it is impossible to tell based on frequency and/or phylogeny and the heavy testing bias is as big now as its ever been (75K isles kits versus 1K Austrians, 2K Swiss, 4K Italian, 4K French, 5K Iberian, etc.

GoldenHind
08-12-2013, 05:21 PM
Is it one I should test for?
I happen to know Brian has already tested negative for L21, U152, DF27 and DF19, and is currently in the P312** group. So yes, DF99 is something you should test for.

What we don't know at this point is how many of those currently in the P312** group will turn out to be DF99. I have little doubt that the P312** group is fairly diverse in both distribution and STR varieties, but one can't rule out an old umbrella SNP that they all share, rather like DF27, which includes many diverse subclades.

TigerMW
08-12-2013, 07:07 PM
IMO, not much has changed since 2010. In academic studies, L21, U152 and U106 are being found exactly where they were expected to be found with frequencies that were expected with a few percentage points higher or lower.

As for a shift north/east for an L11 origin, the chances become more unlikely with every new ancient DNA result. This is especially true with Corded Ware samples where R1b is still absent in German and Polish samples (R1a, I/J and G). Clearly the front-runner of an L11 origin in the north is still the Low Countries with Dutch Bell Beaker, but we are then considering a NW origin, not NE. Unfortunately it is impossible to tell based on frequency and/or phylogeny and the heavy testing bias is as big now as its ever been (75K isles kits versus 1K Austrians, 2K Swiss, 4K Italian, 4K French, 5K Iberian, etc.

Particularly since L11* is lightly scattered, I have a hard time even contemplating where L11 is from. I guess I was leaning to somewhere along the L51xL11 trail that you've drawn up and I'm particularly interested in Tyrol, Austria because of L51xL11, Alpine orientation and proximity to the Danube.

I hadn't really thought much about the Low Countries but it is a nice, central maritime location as far as Beaker folks go. It would make it easier to consider U106 originating on the Baltic side of the Jutland rathern than some kind of L11* route all the way from Portugal. Is there something about the Rhenish Bell Beaker folks anthropology or the Beaker expansions that have you leaning towards this?

I am assuming Rhenish and Dutch Bell Beakers are the same thing, right?

TigerMW
08-12-2013, 07:18 PM
DF19 may be larger than we think but it won't be as large as U152, L21 or DF27.

I'm pretty sure I agree (although it might depend on how large you think, vs. I think, DF19 is)...

That's actually a typo but it doesn't matter. I don't see how either DF99 or DF19 can be close to as high in frequency as U152, L21 or DF27. There's just not that much left over of P312 to be DF99, DF19 or L238 after you we test out U152, L21 and DF27 completely. This is why I call them the Big Three.

That was only point I was trying to make - IMO, it's still wise to test U152, L21 and DF27 before testing DF99, DF19 and L238. Of course, if you have a match with someone who is positive for one of these, by all means, test that first, but without any matching logic I think P312 people need to consider the Big Three first.

This is just off the cuff, but among the Big Three, again without matching information, the sequence might depend on the MDKA geography. L21 is most likely in the Isles and NW France. U152 from lower Denmark down through Italy. SW France and Iberia P312'ers should probably test DF27, first. Scandinavia, in general, I don't know. Its anybody's guess.

greystones22
08-12-2013, 07:45 PM
I will verify with @AndyG, but two L238 samples are DF99- and four DF99+ samples are L238-, so I think the likelihood of them being on the same branch is highly unlikely, unless of course there is missing data somewhere in all six of these samples.

I think you are right. I would prioritise testing for P312* folk.
By the way Jim Wilson tells me that DF99 is on his new custom chip (from Britains DNA) but it will go by a different name. S-"something".

R.Rocca
08-12-2013, 08:02 PM
Particularly since L11* is lightly scattered, I have a hard time even contemplating where L11 is from. I guess I was leaning to somewhere along the L51xL11 trail that you've drawn up and I'm particularly interested in Tyrol, Austria because of L51xL11, Alpine orientation and proximity to the Danube.

I hadn't really thought much about the Low Countries but it is a nice, central maritime location as far as Beaker folks go. It would make it easier to consider U106 originating on the Baltic side of the Jutland rathern than some kind of L11* route all the way from Portugal. Is there something about the Rhenish Bell Beaker folks anthropology or the Beaker expansions that have you leaning towards this?

I am assuming Rhenish and Dutch Bell Beakers are the same thing, right?

I still think the likeliest path is through the Alps, but of all of the L11 areas in the northern regions, the mouth of the Rhine does seem to have a nice diversity of subclades. This plays well into the BB Dutch model that claims an expansion from there to the rest of Europe. Not my first choice, but perhaps my second.

razyn
08-12-2013, 09:25 PM
[/B]

IMO, not much has changed since 2010. In academic studies, L21, U152 and U106 are being found exactly where they were expected to be found with frequencies that were expected with a few percentage points higher or lower.
I was referring to the specific naming of these other clades under discussion. In 2010 millions of guys would have been P312* (had millions of them tested, but as it was, their relatives were P312*); SRY2627 and M153 were way higher on the tree than they belonged, by virtue of having been discovered. That sort of thing. The recent fine tuning or differentiation within L21, and Mike's other Big Two, has helped a lot with the geographical picture. And IMO L11 in general looks less Mediterranean all the time -- but I freely admit, my opinion is not especially weighty. Whether L11 is as eastern as I suspect or as western as you do remains to be seen. Mouth of the Rhine, Alps, whatever; I believe we are being weaned a bit from Italy and Portugal, and I believe that's a step in the right direction. Perhaps, too long a step -- and perhaps, not long enough.

Webb
08-12-2013, 10:15 PM
I still think the likeliest path is through the Alps, but of all of the L11 areas in the northern regions, the mouth of the Rhine does seem to have a nice diversity of subclades. This plays well into the BB Dutch model that claims an expansion from there to the rest of Europe. Not my first choice, but perhaps my second.

I like the Rhine Delta myself. Danube to Rhine. Rhine to the North Sea.

brianlm1
08-12-2013, 10:58 PM
G'day Mike,
Yes I have tested negative to all of the SNPs that are listed in your reply.
Have you tested for U152, L21 and DF27. Odds are more likely you'll be one of those three than DF99 but DF99 is definitely an option for P312+ U152- L21- DF27- people. Of course, DF19 and L238 are also options. DF19 may be larger than we think but it won't be as large as U152, L21 or DF27.

GoldenHind
08-13-2013, 03:49 AM
I will verify with @AndyG, but two L238 samples are DF99- and four DF99+ samples are L238-, so I think the likelihood of them being on the same branch is highly unlikely, unless of course there is missing data somewhere in all six of these samples.

Is the coverage of the samples in question sufficient to rule out an unidentified upstream SNP connecting L238 with DF99 and/or DF19? Presumably a connection between L238 and an as yet undiscovered P312 subclade also remains a possibility.

I for one would be very surprised if there is no SNP between P312 and L238. There are too many aspects of L238 which indicate to me that L238 is much, much younger than P312, and I find it unlikely that no SNP occurred on this line over the lengthy interval between them. I think the only explanation could be that L238 is much older than it appears and that an extraordinary bottleneck took place.

R.Rocca
08-13-2013, 11:27 AM
Is the coverage of the samples in question sufficient to rule out an unidentified upstream SNP connecting L238 with DF99 and/or DF19? Presumably a connection between L238 and an as yet undiscovered P312 subclade also remains a possibility.

I for one would be very surprised if there is no SNP between P312 and L238. There are too many aspects of L238 which indicate to me that L238 is much, much younger than P312, and I find it unlikely that no SNP occurred on this line over the lengthy interval between them. I think the only explanation could be that L238 is much older than it appears and that an extraordinary bottleneck took place.

The answer is yes, DF99 is on a separate branch from both L238 and DF19.

R.Rocca
08-13-2013, 03:25 PM
As for L238, let's not forget that there are 9 other SNPs that all L238 samples share, so any one of them might be between L238 and P312. The key is to get more samples.

TigerMW
08-13-2013, 03:28 PM
The answer is yes, DF99 is on a separate branch from both L238 and DF19.
Thanks. I just removed the cloud from behind DF99 and L238. DF99 now stands alone as a peer to the Big Three, DF19 and L238.
http://tinyurl.com/R1b-P312-Tree

GoldenHind
08-14-2013, 12:41 AM
According to Rich Rocca's post today on the P312 in the Netherlands thread, DF99 was found in .8% of 500 samples in a study there. This works out to be just four. However that more than doubles the amount we knew about yesterday, which was only three. So now we know it is found in Britain, Italy, Peru (presumably from Spain?) and Holland.

Webb
08-14-2013, 10:38 AM
According to Rich Rocca's post today on the P312 in the Netherlands thread, DF99 was found in .8% of 500 samples in a study there. This works out to be just four. However that more than doubles the amount we knew about yesterday, which was only three. So now we know it is found in Britain, Italy, Peru (presumably from Spain?) and Holland.

I know it is too early to call, but that distribution is similar to many of the DF27 clades.

Telfermagne
08-14-2013, 08:01 PM
I am hoping FTDNA offers DF99 soon, if not then I will be more than willing to give my money to whatever other company has the test for this SNP. Been a four year wait so far to be assigned beyond R-P312.

R.Rocca
08-22-2013, 05:52 PM
Primers for DF99 are now on order and should be available for order soon.

jdean
08-22-2013, 06:16 PM
Great news : )_

Telfermagne
08-22-2013, 10:48 PM
I'm really hoping my upgrade to Y-67 is done by the time DF99 is finally released (results have already been delayed by 3 months). Not sure if having my sample tied up in that battery of tests would interfere with a DF99 order. Does anyone have any information about the origin of the Peruvian DF99+ individual? (whether or not they're paternal line is Spanish, Italian, German or other)

VinceT
08-23-2013, 07:52 AM
Does anyone have any information about the origin of the Peruvian DF99+ individual? (whether or not they're paternal line is Spanish, Italian, German or other)

"All four grandparents were born in Peru".

http://ccr.coriell.org/Sections/Search/Sample_Detail.aspx?Ref=HG02008&PgId=166


47% of Peruvians are Mestizo, having a mixed native South American Indian and Colonial Spanish ancestry.
http://internacional.universia.net/latinoamerica/datos-paises/peru/poblacion.htm
http://en.wikipedia.org/wiki/Mestizo#Peru

This is not to say that the paternal line of the Peruvan sample was ultimately Spanish, but I would say it's a good guess.

Telfermagne
08-23-2013, 06:47 PM
Seems like a safe guess, but exposes some problems with the 4 grandparent birthplace questions (something that has plagued resources like 23andMe). Doesn't do much help in trying to pinpoint MRCA's origin when the Old World components of New World populations are not identified.

GoldenHind
09-13-2013, 03:14 PM
This is not to say that the paternal line of the Peruvan sample was ultimately Spanish, but I would say it's a good guess.

It's a good guess, but it remains a guess. According to an article on Wikipedia about immigration to Peru, there has been a gradual migration of Europeans to Peru since they gained their independence in 1821, coming from France, Germany, Italy, Spain, Switzerland, England, Scotland and Croatia, and settling mostly in Lima, where I gather these samples were collected. Another article says the Peruvian census shows 18.5% of the population as of European (as opposed to Mestizo) ancestry.

GoldenHind
09-13-2013, 03:21 PM
I mentioned this on another thread, but it's probably worth repeating here. I sent an email to FTDNA asking if they anticipated offering DF99 anytime in the near future. I haven't received a response. I suspect that SNP testing at that company is in disarray since the dismissal of the Krahns, at least for the moment.

I have also been informed by someone at BritainsDNA that DF99 is included in their new Chromo2 chip, under the designation S11987. That seems to be the only place one can go to test for it on an a la carte basis at present.

Better yet, for those who can afford it, is full genome sequencing at FullGenomes. They not only test for DF99, but also for at least two SNPs below it.

GoldenHind
09-14-2013, 04:25 PM
I have mentioned this on another thread, but I should probably report it here as well. My results from FullGenomes are finally in, and I am DF99+, which doesn't come as much of a surprise to me. I am also positive for two additional SNPs below DF99 which are as yet unnamed. So I join an otherwise unidentified group of someone from Tuscany, someone from Peru who may or may not be of Spanish origin, and four people from Holland.

Until/unless FTDNA decides to offer it, I suspect the group is unlikely to expand much in the near future. I am very curious just how many of those currently identified as P312** (XL21,U152,DF27,DF19,L238) will also be in this newly identified subclade.

jdean
09-14-2013, 04:42 PM
Hats off !!!

You've been saying for years now that eventually all P312 would be broken down into subgroups, I wounder if DF99 is going to be the last one ?

R.Rocca
09-14-2013, 05:32 PM
GoldenHind, it's good to see that all of those years of waiting have finally paid off.

I checked the Genome of the Netherlands and neither of the two SNPs you share below DF99 with the Peruvian sample was there. If you remember, there were four DF99+ results in their dataset.

Ridiculously speculative: Assuming the Peruvian samples are of Iberian ancestry, it will be interesting to see if there is an Atlantic versus a central (Netherlands down to Italy) division of DF99.

Webb
09-14-2013, 06:02 PM
I have mentioned this on another thread, but I should probably report it here as well. My results from FullGenomes are finally in, and I am DF99+, which doesn't come as much of a surprise to me. I am also positive for two additional SNPs below DF99 which are as yet unnamed. So I join an otherwise unidentified group of someone from Tuscany, someone from Peru who may or may not be of Spanish origin, and four people from Holland.

Until/unless FTDNA decides to offer it, I suspect the group is unlikely to expand much in the near future. I am very curious just how many of those currently identified as P312** (XL21,U152,DF27,DF19,L238) will also be in this newly identified subclade.

That pattern is very similar to the north/south cluster under DF27. Congratulations.

razyn
09-14-2013, 06:19 PM
My results from FullGenomes are finally in, and I am DF99+

Congratulations -- it's kind of like being a Charter Member of something that has a lot of members, but you know it and they don't.

rms2
09-14-2013, 11:03 PM
I have mentioned this on another thread, but I should probably report it here as well. My results from FullGenomes are finally in, and I am DF99+, which doesn't come as much of a surprise to me. I am also positive for two additional SNPs below DF99 which are as yet unnamed. So I join an otherwise unidentified group of someone from Tuscany, someone from Peru who may or may not be of Spanish origin, and four people from Holland.

Until/unless FTDNA decides to offer it, I suspect the group is unlikely to expand much in the near future. I am very curious just how many of those currently identified as P312** (XL21,U152,DF27,DF19,L238) will also be in this newly identified subclade.

Excellent! Congratulations! I really am thrilled for you. This is great news.

Now I wonder what DF99 signifies. Too bad this discovery comes at pretty much the same time as the departure of the Krahns from FTDNA.

rms2
09-14-2013, 11:11 PM
I think you are right. I would prioritise testing for P312* folk.
By the way Jim Wilson tells me that DF99 is on his new custom chip (from Britains DNA) but it will go by a different name. S-"something".

Quoting this post to show that apparently DF99 is on BritainsDNA's new Chromo2 test.

rms2
09-14-2013, 11:39 PM
I would encourage all the current P312xL21,U152,DF27,DF19,L238 guys to pester FTDNA with emails and phone calls asking them to provide DF99 testing.

jdean
09-14-2013, 11:59 PM
I would encourage all the current P312xL21,U152,DF27,DF19,L238 guys to pester FTDNA with emails and phone calls asking them to provide DF99 testing.

My thoughts also, this could be the one that puts P312** into the history books : )_

TigerMW
09-15-2013, 01:23 AM
I have mentioned this on another thread, but I should probably report it here as well. My results from FullGenomes are finally in, and I am DF99+, which doesn't come as much of a surprise to me. I am also positive for two additional SNPs below DF99 which are as yet unnamed. So I join an otherwise unidentified group of someone from Tuscany, someone from Peru who may or may not be of Spanish origin, and four people from Holland.

Until/unless FTDNA decides to offer it, I suspect the group is unlikely to expand much in the near future. I am very curious just how many of those currently identified as P312** (XL21,U152,DF27,DF19,L238) will also be in this newly identified subclade.

Wow. Great news and congratulations!

Since DF99 is widespread (Tuscany to Peru and to you) it looks like your cluster must all be DF99.

As for the other SNPs downstream of DF99, as well as DF99, now comes the challenge of hopefully getting these available a la carte, given the new organizational circumstances at FTDNA.

rms2
09-15-2013, 10:57 AM
I know I am a little inclined to beat the Bell Beaker drum a bit, but I was trying to think of what the Netherlands, Tuscany, and England have in common, since DF99 has been found in those places (Goldenhind representing England). I don't want to assume the Peruvian DF99 is Iberian, although certainly the odds favor that. Anyway, all three European locations have Bell Beaker in common.

http://www.academia.edu/3725517/BELL_BEAKER_POTTERY_IN_CENTRAL_ITALY_Valentina_Leo nini_Lucia_Sarti_

I am not asserting dogmatically that DF99 was spread by the Beaker Folk; I'm just throwing that out there for consideration, given what little we know of its distribution thus far. I fully realize there are other scenarios that could account for it.

But speculating is fun, especially before the facts come on the scene to spoil the party. :biggrin1:

rms2
09-15-2013, 11:19 AM
GoldenHind, it's good to see that all of those years of waiting have finally paid off.

I checked the Genome of the Netherlands and neither of the two SNPs you share below DF99 with the Peruvian sample was there. If you remember, there were four DF99+ results in their dataset.

Ridiculously speculative: Assuming the Peruvian samples are of Iberian ancestry, it will be interesting to see if there is an Atlantic versus a central (Netherlands down to Italy) division of DF99.

I guess I am reading that correctly, that the two SNPs below DF99 found in Goldenhind's sample were also found in the Peruvian sample but not in the Dutch samples. It would be nice if we knew more about that Peruvian, like a surname and if he can trace his y-dna line to an mdka in Europe. Frustrating!

Telfermagne
09-16-2013, 03:20 AM
Got around to ordering Chromo2 with BritainsDNA, kit was shipped out last week so I'm eagerly awaiting. It'll be a death blow to my willingness to participate in further Y-DNA testing if by some stroke of demonic fate I come out DF99- after all this time. :P

GoldenHind
09-16-2013, 10:03 AM
Wow. Great news and congratulations!

Since DF99 is widespread (Tuscany to Peru and to you) it looks like your cluster must all be DF99.

As for the other SNPs downstream of DF99, as well as DF99, now comes the challenge of hopefully getting these available a la carte, given the new organizational circumstances at FTDNA.

I have very little doubt that my 'variety', which shares all or nearly all of 8 slow mutating STRs, will all be DF99. I also suspect they will also be positive for the additional currently unnamed SNPs below DF99 that I share with the Peruvian. All but one in this proposed variety is either British (including telfermagne) or has British surnames. There aren't any from Italy or Spain. I also note that in the large number of Spanish samples in the 1KG data, the Peruvian is the sole DF99 example. So even if the Peruvian is ultimately of Spanish origin, DF99 is likely to be extremely rare there, and probably an import from elsewhere in Europe. However that is certainly not the only possible explanation.

What we don't know is how much of the other P312** list will also test DF99+. My best guess, based on a STR analysis of the group, is not more than a third of them. I would dearly love to know whether the English/Welsh variety I mentioned sometime ago on another thread is DF99.

Unfortunately I don't think we will have the answers to any of these questions anytime soon until/unless FTDNA offers testing for DF99. I think jdean is correct. If they don't, the handwriting will be on the wall for the future of SNP testing, at least for new SNPs, at FTDNA.

As for the suggestion that DF99 spread with the Beakers, though it is far too early, I think that it is a reasonable possibility. However I would lean more to a central or eastern branch of the Beakers, rather than to an Atlantic one. This is at least in part due to the apparent absence of P312**, and hence DF99, in Ireland.

rms2
09-16-2013, 11:14 AM
. . .

As for the suggestion that DF99 spread with the Beakers, though it is far too early, I think that it is a reasonable possibility. However I would lean more to a central or eastern branch of the Beakers, rather than to an Atlantic one. This is at least in part due to the apparent absence of P312**, and hence DF99, in Ireland.

Since we're speculating, which is mostly for fun, another possibility that would account for DF99's presence in Tuscany, the Netherlands, and Britain, but its absence from Ireland, is that it was spread by the Romans. I know, I know; probably not, but I am just tossing another idea out there.

GoldenHind
09-16-2013, 05:02 PM
Since we're speculating, which is mostly for fun, another possibility that would account for DF99's presence in Tuscany, the Netherlands, and Britain, but its absence from Ireland, is that it was spread by the Romans. I know, I know; probably not, but I am just tossing another idea out there.

As you say, it is speculative. It is far too early to rule anything out. Speculation can be fun, as long as people don't start getting into 'wandering monk/Aberdeen merchant' scenarios again. t

The only Italian on the P312** list is also from northern Italy, and from his STR profile I believe he will be DF99. That may of course merely be a coincidence, but if I am correct, that would be two northern Italians, versus none from central or southern Italy.

Clearly the Romans weren't restricted to northern Italy. On the other hand, both the Celts and Germanic tribes were presumably concentrated in the north of that country. I think either is more likely than Romans. We have a fair number in the Netherlands, which I think is unlikely to be Roman in origin.

rms2
09-18-2013, 11:54 AM
As you say, it is speculative. It is far too early to rule anything out. Speculation can be fun, as long as people don't start getting into 'wandering monk/Aberdeen merchant' scenarios again. t

The only Italian on the P312** list is also from northern Italy, and from his STR profile I believe he will be DF99. That may of course merely be a coincidence, but if I am correct, that would be two northern Italians, versus none from central or southern Italy.

Clearly the Romans weren't restricted to northern Italy. On the other hand, both the Celts and Germanic tribes were presumably concentrated in the north of that country. I think either is more likely than Romans. We have a fair number in the Netherlands, which I think is unlikely to be Roman in origin.

Could be, could be, but the Romans controlled much of the Netherlands, too. A Roman soldier could have been from any part of Italy, so you would not need DF99s from all over Italy for it to have been spread by the Romans. I was just trying to think of what all those places had in common that they did not share with Ireland. All of them were part of the Roman Empire, and Ireland was not, so the Roman soldier scenario popped into my feverish brain.

But, again, I was just tossing that out there for fun. Obviously we need a lot more DF99 results.

R.Rocca
09-18-2013, 01:20 PM
I have very little doubt that my 'variety', which shares all or nearly all of 8 slow mutating STRs, will all be DF99. I also suspect they will also be positive for the additional currently unnamed SNPs below DF99 that I share with the Peruvian. All but one in this proposed variety is either British (including telfermagne) or has British surnames. There aren't any from Italy or Spain. I also note that in the large number of Spanish samples in the 1KG data, the Peruvian is the sole DF99 example. So even if the Peruvian is ultimately of Spanish origin, DF99 is likely to be extremely rare there, and probably an import from elsewhere in Europe. However that is certainly not the only possible explanation.

What we don't know is how much of the other P312** list will also test DF99+. My best guess, based on a STR analysis of the group, is not more than a third of them. I would dearly love to know whether the English/Welsh variety I mentioned sometime ago on another thread is DF99.

Unfortunately I don't think we will have the answers to any of these questions anytime soon until/unless FTDNA offers testing for DF99. I think jdean is correct. If they don't, the handwriting will be on the wall for the future of SNP testing, at least for new SNPs, at FTDNA.

As for the suggestion that DF99 spread with the Beakers, though it is far too early, I think that it is a reasonable possibility. However I would lean more to a central or eastern branch of the Beakers, rather than to an Atlantic one. This is at least in part due to the apparent absence of P312**, and hence DF99, in Ireland.

Another possibility is that those DF99+ with your STR signature form one branch and the other is formed by DF99+ of another sub-branch with a less obvious STR signature. Kind of like the scenario below DF27 where L176.2 is very WAMH looking and N/S is not.

GoldenHind
09-18-2013, 03:29 PM
Another possibility is that those DF99+ with your STR signature form one branch and the other is formed by DF99+ of another sub-branch with a less obvious STR signature. Kind of like the scenario below DF27 where L176.2 is very WAMH looking and N/S is not.

That is an obvious possibility. As I said, it was only a guess on my part.

I have found a couple of completely different STR clusters among the P312** group. One is a smaller group which matches a large number of slow mutating off modal STRs with myself. I am reasonably confident that this group will test DF99+. Another cluster, which includes a large number of English and Welsh surnames, matches a completely different off-modal STR pattern, as I recollect, without a single off modal in common with the first group. I have no way of knowing whether this group will also be DF99. it is certainly a possibility. DF99, like L21, could well be composed of several different STR varieties. It is also possible that everyone on the P312** could ultimately fall within DF99. It looks old enough and widespread enough to cast a fairly wide net. As you say, it could turn out to be an umbrella SNP which, like DF27, includes some very diverse groups.

A couple of other bits of news concerning DF99. Firstly, it does appear on the ISOGG R1b tree, but only as an SNP under investigation. Can anyone assist in getting it placed on the tree, or do we need a full STR profile for another DF99 before it can be added?

Secondly, I have finally had a reply from FTDNA to enquiry about whether they plan on offering it anytime soon. Apparently the person who might know the answer is away on vacation, and they promise they will get back to me when he returns. Not terribly promising, but better than no response whatsoever.

TigerMW
09-18-2013, 07:39 PM
I've tried to assign STR signature based varieties (clusters) to P312* people. I recommend at least one person per variety test. I also appreciate any feedback/corrections on the variety selections I have. This is all in the R1b-P312xL21_Haplotypes spreadsheet.

Unfortunately, some people, actually many, are pretty much unassignable. Of course, we need DF99 available a la carte to purse this anyway.

Webb
09-18-2013, 08:11 PM
That is an obvious possibility. As I said, it was only a guess on my part.

I have found a couple of completely different STR clusters among the P312** group. One is a smaller group which matches a large number of slow mutating off modal STRs with myself. I am reasonably confident that this group will test DF99+. Another cluster, which includes a large number of English and Welsh surnames, matches a completely different off-modal STR pattern, as I recollect, without a single off modal in common with the first group. I have no way of knowing whether this group will also be DF99. it is certainly a possibility. DF99, like L21, could well be composed of several different STR varieties. It is also possible that everyone on the P312** could ultimately fall within DF99. It looks old enough and widespread enough to cast a fairly wide net. As you say, it could turn out to be an umbrella SNP which, like DF27, includes some very diverse groups.

A couple of other bits of news concerning DF99. Firstly, it does appear on the ISOGG R1b tree, but only as an SNP under investigation. Can anyone assist in getting it placed on the tree, or do we need a full STR profile for another DF99 before it can be added?

Secondly, I have finally had a reply from FTDNA to enquiry about whether they plan on offering it anytime soon. Apparently the person who might know the answer is away on vacation, and they promise they will get back to me when he returns. Not terribly promising, but better than no response whatsoever.

Have you thought of getting a hold of Reeder (Barrel Driver)? He is in the P312** group and might be very interested in these developments. The only problem is that FTDNA doesn't offer it individually. Otherwise I'm sure he would jump on it.

Telfermagne
09-18-2013, 09:42 PM
Have you thought of getting a hold of Reeder (Barrel Driver)?

I am he who was Barreldriver. :P

GoldenHind
09-19-2013, 10:29 AM
I am he who was Barreldriver. :P
And yes, we do stay in touch.

He is part of the small group with the matching slow mutating off modals with myself, and our ancestry can be traced to neighboring counties in England. I have little doubt he will be DF99+ when his BritainsDNA results come in.

David
09-19-2013, 11:16 PM
...
A couple of other bits of news concerning DF99. Firstly, it does appear on the ISOGG R1b tree, but only as an SNP under investigation. Can anyone assist in getting it placed on the tree, or do we need a full STR profile for another DF99 before it can be added?
...

In the past, a second result with STR profile has been required. Given the particular combination of circumstances here, I can see some justification to waive that requirement. I will talk to Alice and see what she thinks, and whether this is something we should present to the entire YSNP group or whether I can simply waive it as the guy doing the work on the P312+ part of the tree.

Regards,
david

GoldenHind
09-20-2013, 12:52 PM
In the past, a second result with STR profile has been required. Given the particular combination of circumstances here, I can see some justification to waive that requirement. I will talk to Alice and see what she thinks, and whether this is something we should present to the entire YSNP group or whether I can simply waive it as the guy doing the work on the P312+ part of the tree.

Regards,
david

Thanks very much. With one in Peru, one in Tuscany, one in England and four in Holland, DF99 seems highly unlikely to be private. Getting STRs from another sample is problematic, since FTDNA still hasn't offered testing for it. If it remains only as an SNP under investigation, I'm afraid it will be more difficult to convince them to do so.

Otherwise we will have to wait for Telfermagne's BritainsDNA results. Assuming he turns out to be DF99, as I suspect, we will then have STRs for two DF99 samples whose GDs are sufficiently large to establish the SNP isn't private. However that could take several months.

R.Rocca
09-25-2013, 02:10 AM
Some good news on the SNP front, especially for DF99. From Bennett Greenspan...

"I want to assure you that we have no plans to curtail, rather to enlarge, the number of single Y SNP's we offer. The approx. 120 that Thomas had in various stages will be vetted and launched over the next 3-4 weeks."

TigerMW
09-26-2013, 04:55 AM
Some good news on the SNP front, especially for DF99. From Bennett Greenspan...

"I want to assure you that we have no plans to curtail, rather to enlarge, the number of single Y SNP's we offer. The approx. 120 that Thomas had in various stages will be vetted and launched over the next 3-4 weeks."

Is DF99 one that is already in progress? Do we need to be sure this is submitted? I guess I'm asking for what the process is? Who has to collect what information and submit it to who?

David
09-26-2013, 05:45 AM
Is DF99 one that is already in progress? Do we need to be sure this is submitted? I guess I'm asking for what the process is? Who has to collect what information and submit it to who?

Ymap was showing primers for DF99, which would indicate that Thomas designed and ordered the primers before he and ftdna parted ways. Normally that would mean we are waiting for ftdna to receive and test the primers.

primer_f: DF99_F TTTACACCAGCACTTACAGTAAG
primer_r: DF99_R CTGAATTAAAACATAATGTTTCATTTGGC

Regards,
david

GoldenHind
09-26-2013, 09:46 AM
Ymap was showing primers for DF99, which would indicate that Thomas designed and ordered the primers before he and ftdna parted ways. Normally that would mean we are waiting for ftdna to receive and test the primers.

primer_f: DF99_F TTTACACCAGCACTTACAGTAAG
primer_r: DF99_R CTGAATTAAAACATAATGTTTCATTTGGC

Regards,
david

Rich R. reported on August 22 (see post #28 above) that the primers had already been ordered. I suspect he may have been the one who designed them.

While it is good to know that FTDNA plans to continue with testing new SNPs, they do seem to be in a transitional period at the moment.

alan
09-28-2013, 05:44 PM
Is it possible to predict a variance age yet for DF99?

GoldenHind
09-29-2013, 10:08 AM
Is it possible to predict a variance age yet for DF99?

No, because There is only one DF99 whose STRs are available (namely myself). Because DF99 is also known to be present in one person in Peru, one in Tuscany and four in the Netherlands, it seems reasonable to assume it is both old and widespread. Additionally there is a considerable genetic distance between me and another English P312** individual whom I believe will test DF99+, based on our matching slow mutating off modal markers..

We will need a considerable number of STR examples before variance calculations can be made. The process cannot even begin until/unless FTDNA begins to offer testing for it.

Jean M
09-29-2013, 03:16 PM
My results from FullGenomes are finally in, and I am DF99+

I'm delighted for you. Been too busy (and away from home for a while) to follow many threads here lately, so my congratulations are very belated! But this new discovery is exciting and I hope to hear a lot more about it.

GoldenHind
11-07-2013, 11:41 PM
It appears that DF99 is finally available to order at FTDNA! Everyone who has tested P312** (ie negative for L21, U152, DF27, DF19 and L238) should order it. Very little is known about it other than it appears to be very old and fairly widespread. It is anyone's guess whether it is the last subclade directly below P312, or whether there are others yet to be identified.

jdean
11-07-2013, 11:45 PM
Wahay !!!!!

TigerMW
11-08-2013, 12:38 AM
It appears that DF99 is finally available to order at FTDNA! Everyone who has tested P312** (ie negative for L21, U152, DF27, DF19 and L238) should order it. Very little is known about it other than it appears to be very old and fairly widespread. It is anyone's guess whether it is the lasy subclade directly below P312, or whether there are others yet to be identified.

Hot dog! I just posted notice of this on the P312 yahoo group (http://http://groups.yahoo.com/groups/R1b-P312-Project/).

It might be time for a bulk email for the P312 project to re-iterate testing guidance for P312+ undifferentiated people. If we did that, I'd try to insert something like described on the yahoo message:


"If you are P312+ L21- U152- DF27-, this is very important.

Aside from L238, you are quite likely to be DF99+. I guess we don't really know but after the big three of L21, U152 and DF27, it looks like the next mostly likely SNP will be DF99. Some are speculating this will take up all of the rest of (old) P312* people. The only way to know is to the test.

I want to clarify this from a general odds to score a hit (postitive SNP) perspective:

1. L21, U152 and DF27 are very big and could have almost any haplotype. Be sure to test for them if you haven't already.
2. DF99 is your next choice.
3. L238 is a special situation. If you match L238+ peoples' haplotypes, you directly go and test for that.

You can order DF99 or anything above from the Advanced Orders menu after you've logged into your FTDNA account. I believe the price is $39.

I encourage those want to do Advanced Orders SNP testing to not wait. We had a price increase on these about a year ago and I've always heard FTDNA does not make much money on these."

R.Rocca
11-08-2013, 02:03 AM
It appears that DF99 is finally available to order at FTDNA! Everyone who has tested P312** (ie negative for L21, U152, DF27, DF19 and L238) should order it. Very little is known about it other than it appears to be very old and fairly widespread. It is anyone's guess whether it is the lasy subclade directly below P312, or whether there are others yet to be identified.

That is great news. Do you have contact with the Penna kit owner?

GoldenHind
11-08-2013, 07:10 AM
That is great news. Do you have contact with the Penna kit owner?

Yes, I have advised her that her brother Penna is probably DF99, and suggested she order it.

GoldenHind
11-08-2013, 07:19 AM
Hot dog! I just posted notice of this on the P312 yahoo group (http://http://groups.yahoo.com/groups/R1b-P312-Project/).

It might be time for a bulk email for the P312 project to re-iterate testing guidance for P312+ undifferentiated people. If we did that, I'd try to insert something like described on the yahoo message:


"If you are P312+ L21- U152- DF27-, this is very important.

Aside from L238, you are quite likely to be DF99+. I guess we don't really know but after the big three of L21, U152 and DF27, it looks like the next mostly likely SNP will be DF99. Some are speculating this will take up all of the rest of (old) P312* people. The only way to know is to the test.

I want to clarify this from a general odds to score a hit (postitive SNP) perspective:

1. L21, U152 and DF27 are very big and could have almost any haplotype. Be sure to test for them if you haven't already.
2. DF99 is your next choice.
3. L238 is a special situation. If you match L238+ peoples' haplotypes, you directly go and test for that.

You can order DF99 or anything above from the Advanced Orders menu after you've logged into your FTDNA account. I believe the price is $39.

I encourage those want to do Advanced Orders SNP testing to not wait. We had a price increase on these about a year ago and I've always heard FTDNA does not make much money on these."

We need to keep DF19 in mind as well though. I'm not certain whether a bulk email is a better idea than contacting individually the approximately 35 or so who have already tested P312**. Once we get a better handle on whether there is one or more STR profiles for DF99, we could start contacting those who fit the profiles.

razyn
11-08-2013, 12:22 PM
There appears to be another small group forming amid the P312** guys -- not DF99, but similarly negative for all the major clades we know much about. If you are about to do a bulk mailing, you might want to consider it. So far it's only known from Geno2 results, both of the guys are on Chris Morley's experimental tree (kits 123629 and N115443), and one (as eores ghost) has been exchanging messages with David Carlisle on the Yahoo P312 group, yesterday and today. He has also ordered Chromo2. The pertinent SNPs (both members of the group have both) are CTS7550 and PF1085.

I'm sure there's a better thread on which to discuss them -- just wanted to flag that because you have mentioned a bulk mailing on DF99, in which these aren't indicated as another P312** possibility.

(edited to correct my mistaken impression that there were three in this group)

Stephen Parrish
11-08-2013, 01:17 PM
There appears to be another small group forming amid the P312** guys -- not DF99, but similarly negative for all the major clades we know much about. If you are about to do a bulk mailing, you might want to consider it. So far it's only known from Geno2 results, both of the guys are on Chris Morley's experimental tree (kits 123629 and N115443), and one (as eores ghost) has been exchanging messages with David Carlisle on the Yahoo P312 group, yesterday and today. He has also ordered Chromo2. The pertinent SNPs (both members of the group have both) are CTS7550 and PF1085.

I'm sure there's a better thread on which to discuss them -- just wanted to flag that because you have mentioned a bulk mailing on DF99, in which these aren't indicated as another P312** possibility.

(edited to correct my mistaken impression that there were three in this group)

I noticed that CTS7550 and PF1085 are recurrent; CTS7550 also appears several levels downstream from R-U106 and PF1085 also appears in haplogroup A.

Stephen

razyn
11-09-2013, 07:56 PM
Yeah, yeah, yeah. But "recurrent" and "unstable" are not synonyms. And the fact that some SNP... oh, say L484, is known to have occurred six or more times in the past 5,000 years within the randomly sampled population of Western Europe -- maybe half a billion births -- doesn't mean it's mutating "frequently." Once it mutates, it is phylogenetically meaningful for the descendants of that mutant guy, as long as he has any. Some of those lines have been fairly successful breeders of sons, for well over a thousand years -- so in those cases, we can still spot a group of the descendants of that specific instance of the "recurrent" mutation.

Not that this is directly to do with DF99, either -- I'm just doing my thing again. These words mean something.

DavidCar
11-10-2013, 04:56 AM
I think the fact that these two SNPs (CTS7550 and PF1085) occur together in two different individuals in P312** confirms the stability of this subgroup. The CTS7550 case in U106 is only in one individual and is listed in the U106 group with a question mark, indicating they're not convinced it is for real there.

lgmayka
11-10-2013, 04:18 PM
Aside from L238, you are quite likely to be DF99+.
So would you suggest that kit 109663 of Poland test DF99 rather than DF19 ?

By the way, I notice that the P312 project has not yet placed him in the correct category.

GoldenHind
11-10-2013, 10:34 PM
So would you suggest that kit 109663 of Poland test DF99 rather than DF19 ?

By the way, I notice that the P312 project has not yet placed him in the correct category.

You are correct, he is currently in the wrong category, which requests he test for DF27, for which he has already tested negative. The problem is that there isn't a category for those who have tested L21-, DF27- and U152-. The discovery of DF99 requires a new category for those who have tested negative for everything but DF19 and DF99 (assuming L238 looks unlikely). Previously they went into the 'please test for DF19' category, as that was the only SNP remaining. The discovery of DF99 has rendered that category obsolete, unless their STR profile suggests they are likely DF19.

In the Polish case you cite, he has no matches at any level, so it is a bit difficult to recommend which of the two he should try first. A second problem is that we have only one confirmed DF99 with STR results (the others come from various projects with anonymous sampling), so while we can say a few people with matching STR profiles are probably DF99+, we have absolutely no idea whether there is any STR signature common to all DF99. One of those who has tested P312** (including DF19-) is a Russian, and from his STR signature he is almost certainly DF99. That might suggest DF99 over DF19 as the first choice for your Polish kit. Probably the best choice would be the new Big Y test, although we don't know for sure whether DF99 is included in it. If it isn't included and he is DF99, the Big Y test would be a giant waste of money. Ordering DF99 and DF19 would be a lot cheaper.

EDIT: I am informed there is a confirmed DF19 from Poland, so we may be back to square one.

GoldenHind
11-15-2013, 04:59 AM
I am aware of nine orders for DF99 from a variety of P312** individuals. One also ordered the Big Y as well. When they are processed, we should know whether DF99 is the final remaining subclade within P312. My guess is that it won't be. We should also have a better idea whether there is a common STR signature for DF99. I doubt there will be, as it appears to be pretty old, though I believe there is at least one STR signature that represents at least a portion of DF99.

greystones22
11-15-2013, 07:40 AM
I am aware of nine orders for DF99 from a variety of P312** individuals. One also ordered the Big Y as well. When they are processed, we should know whether DF99 is the final remaining subclade within P312. My guess is that it won't be. We should also have a better idea whether there is a common STR signature for DF99. I doubt there will be, as it appears to be pretty old, though I believe there is at least one STR signature that represents at least a portion of DF99.

Great stuff!

Fingers crossed for some interesting outcomes

GoldenHind
11-15-2013, 06:48 PM
There appears to be another small group forming amid the P312** guys -- not DF99, but similarly negative for all the major clades we know much about. If you are about to do a bulk mailing, you might want to consider it. So far it's only known from Geno2 results, both of the guys are on Chris Morley's experimental tree (kits 123629 and N115443), and one (as eores ghost) has been exchanging messages with David Carlisle on the Yahoo P312 group, yesterday and today. He has also ordered Chromo2. The pertinent SNPs (both members of the group have both) are CTS7550 and PF1085.

I'm sure there's a better thread on which to discuss them -- just wanted to flag that because you have mentioned a bulk mailing on DF99, in which these aren't indicated as another P312** possibility.

(edited to correct my mistaken impression that there were three in this group)

I have had a look at these two. As far as I can tell, neither has tested for DF27, which isn't included in Geno 2. One of them should test for it, just to eliminate that possibility.

If we were to assume that they are likely DF27- and P312**, it would still be possible for them to be DF99, since they haven't tested for that either. CTS7550 and PF1085 could define a subclade of DF99.

Before we can assume these two SNPs constitute a new subclade under P312, we have to eliminate those two possibilities.

R.Rocca
11-16-2013, 01:44 AM
I see that Penna, kit no. N47555 from NW Italy has ordered DF99. He is one of the ones you suspect based on STR signature, correct?

DavidCar
11-16-2013, 07:38 AM
I have had a look at these two. As far as I can tell, neither has tested for DF27, which isn't included in Geno 2. One of them should test for it, just to eliminate that possibility.

If we were to assume that they are likely DF27- and P312**, it would still be possible for them to be DF99, since they haven't tested for that either. CTS7550 and PF1085 could define a subclade of DF99.

Before we can assume these two SNPs constitute a new subclade under P312, we have to eliminate those two possibilities.

"Eore's Ghost", one of the CTS7550/PF1085 cases, just ordered DF27, DF99 and 111 STRs.

GoldenHind
11-16-2013, 06:53 PM
I see that Penna, kit no. N47555 from NW Italy has ordered DF99. He is one of the ones you suspect based on STR signature, correct?

Correct. I will be surprised if he does not turn out to be DF99. The same applies to two of the others who have placed orders. For most of the remainder, I have no idea what their results will be.


"Eore's Ghost", one of the CTS7550/PF1085 cases, just ordered DF27, DF99 and 111 STRs.

Excellent. That should resolve that question.

I am now aware of 12 DF99 orders.

R. Walker
11-18-2013, 04:35 AM
I don't think my brother, Penna N47555, will be ordering the Big Y or Chromo 2 anytime soon. But I wonder about the value of upgrading from 67 to 111 markers? He really hasn't any close matches, and we are not proving a line or anything. He doesn't mind spending small amounts of money for the research aspects. Just wondering if we should upgrade now that there is a sale on.

GoldenHind
11-18-2013, 06:16 AM
I don't think my brother, Penna N47555, will be ordering the Big Y or Chromo 2 anytime soon. But I wonder about the value of upgrading from 67 to 111 markers? He really hasn't any close matches, and we are not proving a line or anything. He doesn't mind spending small amounts of money for the research aspects. Just wondering if we should upgrade now that there is a sale on.

I'm sure others will disagree with me, but I haven't bothered with upgrading from 67 to 111 markers. My guess is if you don't have any close matches at 67 markers, you won't have any at 111 either. If we get to the point where certain off modal values in the 68 to 111 marker range become significant, I might reconsider, though I might just order those individual markers. 111 markers might be important for those who have a lot of matches at 67 markers.

TigerMW
11-18-2013, 02:15 PM
I don't think my brother, Penna N47555, will be ordering the Big Y or Chromo 2 anytime soon. But I wonder about the value of upgrading from 67 to 111 markers? He really hasn't any close matches, and we are not proving a line or anything. He doesn't mind spending small amounts of money for the research aspects. Just wondering if we should upgrade now that there is a sale on

I'm sure others will disagree with me, but I haven't bothered with upgrading from 67 to 111 markers. My guess is if you don't have any close matches at 67 markers, you won't have any at 111 either. If we get to the point where certain off modal values in the 68 to 111 marker range become significant, I might reconsider, though I might just order those individual markers. 111 markers might be important for those who have a lot of matches at 67 markers.

Okay, I guess I have to take the other side, respectfully. Every situation is different be it the genetic/matching circumstances, passion for the hobby, budget, timing, etc. It's all okay.

What are your closest GD's at 67? If they are at 8-9-10 you might find some strong matches in the 68-111 marker range. This actually happened for me where I had matches from 9 to 7 GD at 67 and one of the worse of that group hit me perfectly in this last panel set.

There is no magic to FTDNA's sequence of STRs. A couple of markers in the 68-111 range may be most important. In the case of DF5+ people, DYS463 turns out to be a pretty good indicator of DF5+ so it can save SNP test exploration $.

TMRCA estimates will be better at 111 markers than at 67.

Matching is important, so this often comes down the chicken and egg thing and that issue is at play all up and down various testing levels. When someone goes first, others will follow but no one wants to be the only person at a certain test level.

Over in the L21 world, we have over 2300 people with 111 STRs. This makes some of the network tree drawing tools much more accurate which indicates the TMRCAs are more accurate.

TigerMW
11-18-2013, 02:20 PM
Has anyone contacted this person? They only have 12 STRs but their SNP testings of the need to try DF99.

78515 Desharnais Jacques DuHorne, bc 1664, Dieppe, FR

P312+, DF19-, DF27-, L176.2-, L2-, L21-, L238-, M153-, M222-, M65-, SRY2627-, U152-, Z196-

GoldenHind
11-18-2013, 07:33 PM
Okay, I guess I have to take the other side, respectfully. Every situation is different be it the genetic/matching circumstances, passion for the hobby, budget, timing, etc. It's all okay.

What are your closest GD's at 67? If they are at 8-9-10 you might find some strong matches in the 68-111 marker range. This actually happened for me where I had matches from 9 to 7 GD at 67 and one of the worse of that group hit me perfectly in this last panel set.

There is no magic to FTDNA's sequence of STRs. A couple of markers in the 68-111 range may be most important. In the case of DF5+ people, DYS463 turns out to be a pretty good indicator of DF5+ so it can save SNP test exploration $.

TMRCA estimates will be better at 111 markers than at 67.

Matching is important, so this often comes down the chicken and egg thing and that issue is at play all up and down various testing levels. When someone goes first, others will follow but no one wants to be the only person at a certain test level.

Over in the L21 world, we have over 2300 people with 111 STRs. This makes some of the network tree drawing tools much more accurate which indicates the TMRCAs are more accurate.

In the DF99 world, we have only one person with any STRs whatsoever (namely myself with 76 markers- 67 from FTDNA plus 9 more from SMGF). There is a probable DF99 with 111 markers, but he hasn't yet ordered the test for it. Once we have some more identified, I will start looking for matching off modals in the 68-111 range.

R. Walker
11-18-2013, 08:21 PM
Re: the query above by Mikewww, my brother has no matches up to 7 steps at 67, one 4 step match at 37. And a couple of 2 steps at 25. that's it. So we'll just wait and see.
Thanks, all.

GoldenHind
11-18-2013, 08:48 PM
Has anyone contacted this person? They only have 12 STRs but their SNP testings of the need to try DF99.

78515 Desharnais Jacques DuHorne, bc 1664, Dieppe, FR

P312+, DF19-, DF27-, L176.2-, L2-, L21-, L238-, M153-, M222-, M65-, SRY2627-, U152-, Z196-

For a couple of reasons, I strongly recommend a DF99 test for him.

R. Walker
11-18-2013, 10:32 PM
GoldenHind said: "For a couple of reasons, I strongly recommend a DF99 test for him."

It is in the works as we speak.

rwrr00a
11-21-2013, 03:35 PM
Today I ordered the FTDNA DF99 test and am crossing my fingers for a positive result, as I'm negative for the other five known subclades of P312, for which I am positive. I also have 76 markers--67 from FTDNA plus 9 more from SMGF, so I will look for yours to compare. Mine are shown on FTDNA's P312 group spreadsheet. My family tree goes back to the 1500s in northern netherlands and so I'm happy to hear there are DF99s from my ancestral homeland.

TigerMW
11-21-2013, 07:41 PM
Today I ordered the FTDNA DF99 test and am crossing my fingers for a positive result, as I'm negative for the other five known subclades of P312, for which I am positive. I also have 76 markers--67 from FTDNA plus 9 more from SMGF, so I will look for yours to compare. Mine are shown on FTDNA's P312 group spreadsheet. My family tree goes back to the 1500s in northern netherlands and so I'm happy to hear there are DF99s from my ancestral homeland.

Thanks, rwrr.

Robert wrote an email broadcast for the prime P312** targets and I submitted it to so it got out to everyone in that group this morning.

DF99 looks very promising.

Telfermagne
11-21-2013, 11:24 PM
I have both a chromo2 test and DF99 test pending, did both to be sure of whatever result. I'm hoping the chromo2 will be done within the next week. Had gotten notification on 10/2 that my sample was being processed, but BritainsDNA had done something fishy with my page, they had altered the order date as 10/9 which I know is not the date that I placed the order (able to be confirmed with bank statements) and is not the date that my sample reached the lab (which was 10/2 per the email they sent) so I'm hoping that they ain't trying to fudge out of providing results within the 6-8 week time frame they allege is the standard. FTDNA states that 12/31 is the expected date for my DF99 result. Overall, with FTDNA's decline in customer service and promptness and BritainsDNA seemingly shady practice I'm about done with genetic genealogy.

GoldenHind
11-22-2013, 08:05 PM
I have both a chromo2 test and DF99 test pending, did both to be sure of whatever result. I'm hoping the chromo2 will be done within the next week. Had gotten notification on 10/2 that my sample was being processed, but BritainsDNA had done something fishy with my page, they had altered the order date as 10/9 which I know is not the date that I placed the order (able to be confirmed with bank statements) and is not the date that my sample reached the lab (which was 10/2 per the email they sent) so I'm hoping that they ain't trying to fudge out of providing results within the 6-8 week time frame they allege is the standard. FTDNA states that 12/31 is the expected date for my DF99 result. Overall, with FTDNA's decline in customer service and promptness and BritainsDNA seemingly shady practice I'm about done with genetic genealogy.

Hang in there, old fellow. I certainly understand your frustration. This hobby on occasion would try the patience of Job. I have come close to throwing in the towel more than once myself. But things have now turned around, and the future looks both interesting and exciting.

GoldenHind
11-22-2013, 09:08 PM
There is interesting news on the DF99 front.

The good news is two results were posted today.

The bad news is that both were negative. I don't like to mention their names publicaly without their permission, but both are of British ancestry. I thought one of them had at least a 50/50 chance of positive results based on one off modal STR.

We also now know that there is at least one more subclade directly below P312 yet to be identified.

GoldenHind
11-23-2013, 07:33 PM
After four negative results, the first DF99+ came in from FTDNA today. He and I are a GD of 34 @ 66 markers, which reinforces the belief that DF99 is pretty old.
I will contact him to see if he minds if I mention him publicly.

jdean
11-23-2013, 07:52 PM
Great news !!

R.Rocca
11-23-2013, 08:55 PM
After four negative results, the first DF99+ came in from FTDNA today. He and I are a GD of 34 @ 66 markers, which reinforces the belief that DF is pretty old.
I will contact him to see if he minds if I mention him publicly.

Looks like two results now showing in the P312 project. Congrats!

GoldenHind
11-24-2013, 02:28 AM
There are now two positives against five negative results. The latest DF99+ is Telfermagne, whose result I predicted some time ago due his sharing six different off modals with me, some of them pretty rare. We are a GD of 28 @76 markers. Our ancestry comes from neighboring counties in England.

The other DF99+, who has given me permission to discuss his results, is Fimbres, Ysearch 6YD2Z. As I said above, he is a GD to me of 34 @ 66 markers. His ancestry comes from Spain via Mexico, but he says he has traced his ancestry to a Flemish silk merchant who settled in Bilboa, Spain in the 17th century. He has found a legal record which describes his ancestor Juan de Fimbres as a "Flamenco," and he believes he is the Johannes Fimbres who was born in Tilleur near Liege in Belgium c. 1635.

I will have to make a further analysis, but it appears that Fimbres results establish there is no particular STR signature associated with all of DF99, though there certainly is at least one within it.

I hope this will finally be sufficient to get DF99 removed from its status on the ISOGG R1b tree as an SNP "under investigation" to its proper place as a subclade of P312.

The five negative results within P312** conclusively demonstrate there is one or more subclades remaining under P312 which have yet to be identified. Two of those who got negative results are members of a fairly large variety I identifed some time ago, almost all of whom have Welsh or English surnames. There are nine different off modals which distinguish this variety. When their subclade is finally identified, it will be quite substantial.

Telfermagne
11-24-2013, 02:59 AM
Glad to be confirmed DF99+. Finally free of P312**. :)

Telfermagne
11-24-2013, 03:30 AM
I know that it is way to early to give any solid answer about DF99's origin, but since we have 4 Dutch positives (if I recall correctly), plus the Flemish-Mexican, I'm inclined to keep my eyes on the Nordwestblock mystery mayhaps. For those of us with British Isles lines, it might serve to remember William III and the Glorious Revolution. William did not come alone. :P

GoldenHind
12-06-2013, 01:49 AM
I am very pleased to report that DF99 has been removed from the 'under investigation' list on the ISOGG R1b tree and placed as a new subclade under P312 with the designation R1b1a2a1a2f. Whether it will make it on the revised FTDNA tree remains to be seen.

jdean
12-06-2013, 09:08 AM
At last !!

I see they still haven't managed to place DF95 despite ample evidence it's a brother to Z372 under Z18 : )

GoldenHind
12-08-2013, 02:30 AM
Two more DF99+ results today, both predicted. One has ancestry from Scotland, the other from northern Italy.

R. Walker
12-08-2013, 04:20 AM
^ I just posted his results on another thread. What now? Kit # N47555, Penna.
Thanks, R. Walker

GoldenHind
12-08-2013, 04:25 AM
^ I just posted his results on another thread. What now? Kit # N47555, Penna.
Thanks, R. Walker

I hope we will be able before too long to further refine DF99 and identify its sub-structure. Until then, there isn't really anything you can do, unless you want to go big time with FullGenomes or the Big Y.

R. Walker
12-08-2013, 04:53 AM
I hope we will be able before too long to further refine DF99 and identify its sub-structure. Until then, there isn't really anything you can do, unless you want to go big time with FullGenomes or the Big Y.
No those are too pricey. I guess we'll just wait and watch and do piecemeal as it comes along.
How many DF99+ are there now?
Thanks.
R. Walker

Rathna
12-08-2013, 08:34 AM
No those are too pricey. I guess we'll just wait and watch and do piecemeal as it comes along.
How many DF99+ are there now?
Thanks.
R. Walker

Of course it is by chance, but 1 Tuscan out about 50 it is 2%. The case of Penna from Liguria strengthens this trend.
Netherlands with 4 cases out of 500 is at 0.8%.
The origin of R-P312* from the Italian Refugium has been theorized by me from many years besides R1b1*, R-M269*, R-L51*, R-U152*.
About the scarcity of R-L11* I spoke a lot: it is above all from German people (see my friend Ballard positions), but Italy (Tuscany) has the most varied sample known so far (Pistoia province).

P.S. In Tuscany they could be about 36,000.

GoldenHind
12-08-2013, 06:44 PM
How many DF99+ are there now?
Thanks.
R. Walker

From FTDNA we now have four that I know of who have tested positive. In addition to your brother, we have one with ancestry from the north of England, one from Flanders (by way of Spain and Mexico) and one from Scotland. There is another example from central England from Full Genomes. As Rathna mentioned, there were four DF99+ found in a sample of 500 males in Holland. There are two more anonymous DF99+ in the 1000 Genomes Project, one from Tuscany and one from Peru, who may or may not be of Spanish origin. We have also been informed that another study has also found DF99 in Britain, with no further information.

There are still about a half dozen tests pending results at FTDNA.

jdean
12-08-2013, 07:12 PM
From FTDNA we now have four that I know of who have tested positive. In addition to your brother, we have one with ancestry from the north of England, one from Flanders (by way of Spain and Mexico) and one from Scotland. There is another example from central England from Full Genomes. As Rathna mentioned, there were four DF99+ found in a sample of 500 males in Holland. There are two more anonymous DF99+ in the 1000 Genomes Project, one from Tuscany and one from Peru, who may or may not be of Spanish origin. We have also been informed that another study has also found DF99 in Britain, with no further information.

There are still about a half dozen tests pending results at FTDNA.

That's a nice spread, and not bad going either considering how recent testing for DF99 is !!!

Out of curiosity what are your numbers for negative results at the moment ?

R. Walker
12-09-2013, 03:19 AM
Thanks to Rathna and Golden Hind for their replies.:)
R. Walker

GoldenHind
12-09-2013, 06:27 PM
That's a nice spread, and not bad going either considering how recent testing for DF99 is !!!

Out of curiosity what are your numbers for negative results at the moment ?

There are seven DF99- results I am aware of, but only five of those were P312**. The other two are likely to be DF27+. The five who remain P312** all have English, Welsh or Scottish surnames, but this may merely be a reflection of the enormous bias of British ancestry in the FTDNA database. It is too small of a sample to be certain, but at the moment it looks like DF99 will only constitute about a third of the P312** group, which before DF99 was taken out numbered about 35. There is however a very large number in the P312 project who have not yet tested for DF27 and/or DF19.

My guess is that there are probably at least two more subclades yet to be discovered in P312. There are people who probably know the answer to this, but they aren't yet able to go public.

GoldenHind
12-13-2013, 01:13 AM
Two more DF99 results today from individuals who were previously P312**. One, of French ancestry, was negative, the other was positive. The ancestry of the positive example doesn't extend beyond early Pennsylvania. The MDKA is thought to be either Pennsylvania Dutch (ie German), or possibly an Ulster Scot, who were also found in the area. The surname does not appear to be Scottish to me. It looks to me to be either an English surname (after a fairly common English placename), or possibly the anglicised form of a German surname.

It is now pretty clear that there is no STR signature common to all DF99, though there is certainly a strong STR signature within DF99. This reinforces the view that the subclade is pretty old. Since two DF99 individuals are a GD of 34 at 67 markers, there seems to be little reason to doubt it is nearly as old as P312 itself.

GoldenHind
12-18-2013, 08:13 PM
As nearly all of the DF99 orders I know of at FTDNA have been processed, an overview of the results seems appropriate. There are now 8 DF99+ individuals, but as two of them are same surname matches, there are only 6 unique examples. Of the six, two have ancestry from England (Yorkshire and Nottinghamshire), one from Scotland, one from Flanders and one from northern Italy (Liguria). The last has ancestry only to Pennsylvania, with uncertain origins, but after corresponding with him, I think German is the most likely. Operating on that assumption, it is an even split between British and continental ancestry. Taking into account the enormous bias toward the British Isles in the FTDNA database, it seems that DF99 may well be a predominantly continental subclade.

As I mentioned on the P312** thread, it looks at this time that DF99 probably only accounts for 40% or so of the group formerly characterized as P312**. The remaining 60% of P312** appears to be composed of one of more P312 subclades not yet identified.

Looking at the STRs of the six DF99+, all but one have the otherwise rare 12 at DYS389i. This value is only found in about 5% of R1b. The sixth has the modal 13 there. Of the five with 389i=12, all but one also has the off modal 10 at 391, while the other has the modal 11 there. Only the Flemish example has the modal values at both 391 and 389. The question then is whether we are looking at two different divisions of DF99, only one of which has the 10/12 signature, or whether that applies to entire subclade, with the Flemish being an exception. I am inclined toward the former, but it remains speculative at this point, pending further testing to see just how rare modal values at these two markers are within DF99.

Mike W. first identified what he called the 10/12 variety within P312* some time ago. However several of them have tested positive for DF27 or DF19, so it is clear this signature is not unique to DF99. However combined with P312** status, I believe it is strongly indicative of DF99+ status. But even within P312**, 389i=12 does not by itself guarantee a DF99+ result.

Only about half of those in the former P312** group have ordered DF99. Among those who haven't, several have the 10/12 signature. My guess is that all of them would test DF99+. One of them has the BigY on order. The real question is how many of the P312** who don't have the 10/12 signature are also DF99+. I have no idea.

There are another two interesting markers in the DF99 group. Five of the six have higher than the modal value of 13 at 446. As this is a fast mutating marker, I'm not sure how much to read into this, but it seems unlikely to be mere coincidence. At 406S1, the three British plus the likely German have an off modal 11, while the Flemish and Italian have the modal 10. Whether this split is significant remains to be seen.

Finally the GDs within the group are fairly high. Most are a higher GD from each other than they are from the P312 modal. For instance, the likely German is a GD of 36 at 66 markers from the Flemish, while one of the English examples is a GD 34 at 66from the Flemish example. However the German and English examples are themselves a GD of 32 at 66 from each other. Combined with the wide distributuion of the subclade, this suggests to me that DF99 is quite old, possibly not much younger than P312 itself.

R.Rocca
12-18-2013, 08:35 PM
As nearly all of the DF99 orders I know of at FTDNA have been processed, an overview of the results seems appropriate. There are now 8 DF99+ individuals, but as two of them are same surname matches, there are only 6 unique examples. Of the six, two have ancestry from England (Yorkshire and Nottinghamshire), one from Scotland, one from Flanders and one from northern Italy (Liguria). The last has ancestry only to Pennsylvania, with uncertain origins, but after corresponding with him, I think German is the most likely. Operating on that assumption, it is an even split between British and continental ancestry. Taking into account the enormous bias toward the British Isles in the FTDNA database, it seems that DF99 may well be a predominantly continental subclade.

As I mentioned on the P312** thread, it looks at this time that DF99 probably only accounts for 40% or so of the group formerly characterized as P312**. The remaining 60% of P312** appears to be composed of one of more P312 subclades not yet identified.

Looking at the STRs of the six DF99+, all but one have the otherwise rare 12 at DYS389i. This value is only found in about 5% of R1b. The sixth has the modal 13 there. Of the five with 389i=12, all but one also has the off modal 10 at 391, while the other has the modal 11 there. Only the Flemish example has the modal values at both 391 and 389. The question then is whether we are looking at two different divisions of DF99, only one of which has the 10/12 signature, or whether that applies to entire subclade, with the Flemish being an exception. I am inclined toward the former, but it remains speculative at this point, pending further testing to see just how rare modal values at these two markers are within DF99.

Mike W. first identified what he called the 10/12 variety within P312* some time ago. However several of them have tested positive for DF27 or DF19, so it is clear this signature is not unique to DF99. However combined with P312** status, I believe it is strongly indicative of DF99+ status. But even within P312**, 389i=12 does not by itself guarantee a DF99+ result.

Only about half of those in the former P312** group have ordered DF99. Among those who haven't, several have the 10/12 signature. My guess is that all of them would test DF99+. One of them has the BigY on order. The real question is how many of the P312** who don't have the 10/12 signature are also DF99+. I have no idea.

There are another two interesting markers in the DF99 group. Five of the six have higher than the modal value of 13 at 446. As this is a fast mutating marker, I'm not sure how much to read into this, but it seems unlikely to be mere coincidence. At 406S1, the three British plus the likely German have an off modal 11, while the Flemish and Italian have the modal 10. Whether this split is significant remains to be seen.

Finally the GDs within the group are fairly high. Most are a higher GD from each other than they are from the P312 modal. For instance, the likely German is a GD of 36 at 66 markers from the Flemish, while one of the English examples is a GD 34 at 66from the Flemish example. However the German and English examples are themselves a GD of 32 at 66 from each other. Combined with the wide distributuion of the subclade, this suggests to me that DF99 is quite old, possibly not much younger than P312 itself.

Have any additional DF99 kits also ordered Full Genomes or Big-Y?

GoldenHind
12-18-2013, 11:33 PM
Have any additional DF99 kits also ordered Full Genomes or Big-Y?

Other than the P312** probable DF99+ I mentioned above who has the BigY pending, I only know of a confirmed DF99 who has a pending Full Genomes test. I don't like to mention his name on the forum without his permission.

There is also a BigY pending for a P312** DF99-, which hopefully will give us a new subclade under P312.

It is however possible that a DF99 will be identified in one of the many people who have ordered the BigY and who have done little to no SNP testing to date. I have only kept track of orders by those who are (or were) in the P312** category.

Telfermagne
12-18-2013, 11:45 PM
What's the story with the Russian that matched the Y-STR profile? Any news of a DF99 order?

Telfermagne
12-19-2013, 02:28 PM
I think it would be quite interesting if it turns out that DF99 is the Western counterpart to the Northern L238 (DF99 could be an R-P312 clade with a noticeable presence among the founders of the West Germanics, with other lineal bands outside P312. While L238 could be an R-P312 clade with a noticeable presence among the founders of the North Germanics, with other lineal bands outside P312). The Northern tendency of L238 is quite blatant (being near exclusive to Scandinavian countries thusfar, with the exception being a few British positives). The Istvaeonic tendency of DF99 still needs to be further evidenced, however with the current results it seems at the very least promising. Consider the question, what kind of folks were shared between the British Islanders, the Flemish, the Ligurians, the Dutch, and maybe the Germans?

A while back I recall mention of the Romans, which I don't think is a likely case at this point given that most numerous results so far are either British Islander (more specifically English or Lowland Scots, both West-Germanic cultural groups i.e. Anglo-Frisian) or Low Country (the original Dutch results + the FTDNA Flemish-Iberian results).

Besides the Romans, all the folk groups among the + results shared a West Germanic settlement at one point or another in history. E.g. the Anglo-Saxons, Franks, & Dutch were in Britain. The Dutch are the Dutch, and the Flemish are akin to the Dutch. Liguria was overrun by Langobards & Franks at one time. And, Germany like the Netherlands speaks for itself.

castle3
12-19-2013, 07:05 PM
I think it would be quite interesting if it turns out that DF99 is the Western counterpart to the Northern L238 (DF99 could be an R-P312 clade with a noticeable presence among the founders of the West Germanics, with other lineal bands outside P312. While L238 could be an R-P312 clade with a noticeable presence among the founders of the North Germanics, with other lineal bands outside P312). The Northern tendency of L238 is quite blatant (being near exclusive to Scandinavian countries thusfar, with the exception being a few British positives). The Istvaeonic tendency of DF99 still needs to be further evidenced, however with the current results it seems at the very least promising. Consider the question, what kind of folks were shared between the British Islanders, the Flemish, the Ligurians, the Dutch, and maybe the Germans?

A while back I recall mention of the Romans, which I don't think is a likely case at this point given that most numerous results so far are either British Islander (more specifically English or Lowland Scots, both West-Germanic cultural groups i.e. Anglo-Frisian) or Low Country (the original Dutch results + the FTDNA Flemish-Iberian results).

Besides the Romans, all the folk groups among the + results shared a West Germanic settlement at one point or another in history. E.g. the Anglo-Saxons, Franks, & Dutch were in Britain. The Dutch are the Dutch, and the Flemish are akin to the Dutch. Liguria was overrun by Langobards & Franks at one time. And, Germany like the Netherlands speaks for itself.
My surname first appears within 6 miles of several surnames in Cumbria that appear on the L238- list, Telfermagne. Some , including my own, also appear within a few miles of each other in Dumfriesshire. I have medieval charter evidence showing connections between various families, some of whom are DF99-. I'm not claiming they are all closely related, but I believe many, DF99+ & -, have their roots in Flanders.
Bob
PS Several of these surnames wed each other, thus confirming close links. Flemish laws of nobilitas encouraged this behaviour.

Telfermagne
12-19-2013, 09:53 PM
My surname first appears within 6 miles of several surnames in Cumbria that appear on the L238- list, Telfermagne. Some , including my own, also appear within a few miles of each other in Dumfriesshire. I have medieval charter evidence showing connections between various families, some of whom are DF99-. I'm not claiming they are all closely related, but I believe many, DF99+ & -, have their roots in Flanders.
Bob
PS Several of these surnames wed each other, thus confirming close links. Flemish laws of nobilitas encouraged this behaviour.

I think Flanders, Belgium and the Netherlands (all 3) are areas to keep an eye on.

GoldenHind
12-19-2013, 11:18 PM
What's the story with the Russian that matched the Y-STR profile? Any news of a DF99 order?

I am 99% certain that the Russian P312** in question would test DF99+, but no order from him as yet. After the holidays, I will try once again to convince him to order it. If he does in fact test DF99, I think it will be very important to the history of the subclade.

GoldenHind
12-19-2013, 11:31 PM
I think Flanders, Belgium and the Netherlands (all 3) are areas to keep an eye on. The Low Country settlement in the Isles would be a bit hard to pick a part though without clear hereditary documents for each and every family (like with your example) as the Anglo-Saxons & Franks were involved in joint invasions in the early middle ages then there were Franks & Flemmings among the Normans, then there was completely independent Flemish & Dutch settlement in urban areas (various engineers and trades folk).

Based on our current knowledge, Holland would appear to be the hotspot for DF99. It was a little over 4% of P312 there in the Genes of the Netherlands study. Yet we don't have a single identified DF99 from Holland in the FTDNA database- just the ones from Flanders. Since it appears that DF99 is probably fairly rare everywhere, it may require extensive regional DNA surveys to determine its distributuion. I'm not sure we can be too certain of much based on the handfull we currently know about. We keep flirting with Iberia, but can't find one we can actually attribute to that area. I do think we can be fairly sure DF99 is not going to be very strong in Ireland, considering the enormous number of people of Irish descent in the FTDNA database and their virtual complete absence from the P312** category.

Having said that, I do think it's quite possible that there is a Germanic and/or Nordic element within DF99. But at this point I'm not certain that will apply to the entire subclade. It is probably old enough to have a foothold in various ethnicities. But this is very premature, and awaits further data.

jdean
12-20-2013, 12:30 AM
I am 99% certain that the Russian P312** in question would test DF99+, but no order from him as yet. After the holidays, I will try once again to convince him to order it. If he does in fact test DF99, I think it will be very important to the history of the subclade.

Perhaps a small fundraiser is in order ?

castle3
12-20-2013, 04:03 AM
Sadly, I don't have many S389+ or L624+ results to compare with. All I understand is that they are found in more numbers in Scotland. If I knew all the surnames it'd be fascinating to see if there was a connection, as observed in DF99-. I'm keeping an open mind regarding all this, but felt in was important to show those who might not know that several of these surnames lived within 3 miles of each other in approx. c1200.
I get curious when I see coincidences!

Rathna
12-20-2013, 09:29 AM
Having said that, I do think it's quite possible that there is a Germanic and/or Nordic element within DF99.

I think that your hypothesis is out of any sound reasoning about genetics, i.e. Mutation Rate, STRs values and all the sciences like history, geography, linguistics and all the other ones.
I gave a glance to the R-DF99+ haplotypes on the FTDNA Project.
Penna is the only one to have:
DYS385b=15
DYS447=24
DYS570=14
DYS438=11
DYS413=21
DYS446=13
and other values are shared with a few others, probably for convergent mutations. To think that the Italian Penna had something in common with the others of a supposed German origin (i.e.in these last 1500 years) is out of any reasoning as to genetics.
The Full Y (or also a Big Y) will demonstrate this surely.

Rathna
12-20-2013, 10:21 AM
I think that your hypothesis is out of any sound reasoning about genetics, i.e. Mutation Rate, STRs values and all the sciences like history, geography, linguistics and all the other ones.
I gave a glance to the R-DF99+ haplotypes on the FTDNA Project.
Penna is the only one to have:
DYS385b=15
DYS447=24
DYS570=14
DYS438=11
DYS413=21
DYS446=13
and other values are shared with a few others, probably for convergent mutations. To think that the Italian Penna had something in common with the others of a supposed German origin (i.e.in these last 1500 years) is out of any reasoning as to genetics.
The Full Y (or also a Big Y) will demonstrate this surely.

Between Penna (N47555) and Hatton (27064) there are 27 mutations out of 67 markers.
(454x27) : 134= 91,477611
91,5x2,5 (we know now that the usual Mutation Rate is under a factor of about 2.5 as to aDNA data and also Big Y) = 228,75
i.e. between Penna and Hatton there will be at least 57 SNPs of difference in the Big Y and you'll probably realize that were Northern Europeans to derive from Southern ones, as it is in my theory of the Italian Refugium.

Rathna
12-20-2013, 10:59 AM
A while back I recall mention of the Romans, which I don't think is a likely case at this point given that most numerous results so far are either British Islander (more specifically English or Lowland Scots, both West-Germanic cultural groups i.e. Anglo-Frisian) or Low Country (the original Dutch results + the FTDNA Flemish-Iberian results).

Besides the Romans, all the folk groups among the + results shared a West Germanic settlement at one point or another in history. E.g. the Anglo-Saxons, Franks, & Dutch were in Britain. The Dutch are the Dutch, and the Flemish are akin to the Dutch. Liguria was overrun by Langobards & Franks at one time. And, Germany like the Netherlands speaks for itself.

I apologize with GoldenHind, but I wrote my letter after having read this post. GoldenHind was more cautious in his statements.

Rathna
12-20-2013, 11:53 AM
If you look at these two haplotypes:

6YD2Z Fimbres Tilleur, Flanders
13 24 14 11 11 11 12 12 10 13 13 29 16 9 10 11 11 25 15 19 29 15 16 16 17 11 11 20 23 16 15 17 17 35 41 12 12 12 12 14 11 9 15 16 8 10 10 8 10 11 23 23 15 10 12 12 14 8 22 20 12 11 13 11 11 12 11
HM33V Fimbres Mexico
13 24 14 11 11 11 12 12 11 13 13 29 16 9 10 11 11 25 15 19 29 15 16 16 17 11 11 20 23 15 15 17 17 35 41 12 12 12 12 14 11 9 15 16 8 10 10 8 10 11 23 23 15 10 12 12 14 8 22 20 12 11 13 11 11 12 11

they have 2 mutations out of 67 markers. I.e. with the usual Mutation Rate:
(454x2):134=6,77x25=about 169 years. But this is what the former says:

"If you google "Juan de Fimbres" in "books" you will find that Juan de Fimbres was a Flemish silk merchant based in Bilboa (Basque country). He had a patnership with others from Holland and Flanders but separated in 1674 to create his own enterprise. He is the first Fimbres in the historical record and some Fimbres now in N. Mexico and SW US claim Basque heritage which would fit with progeny from Juan".

How many years ago did the two lines separate?
Of course in recent times the usual Mutation Rate fits more.

P.S. I make you note the mutation in DYS439. This is one of the markers that let me make the theory of the mutations around the modal. Who knows how many times has happened the mutation from 12 to 11 and vice versa and only rarely a mutation for the tangent to 10 or a mutation from 12 to 13 and vice versa and rarely from 13 to 14?

Telfermagne
12-20-2013, 02:29 PM
I apologize with GoldenHind, but I wrote my letter after having read this post. GoldenHind was more cautious in his statements.

EDIT: Seems my comments on the Northwest block option were made elsewhere. So it is understandable that you would think that the aforesaid (about West Germanics) was the only option I had to offer - it is not, and it is not my most favoured even. And I do admit that the presentation was poorly worded, busy week and addled-brains. end EDIT

Telfermagne
12-20-2013, 02:55 PM
Speaking of GDs, 61 out of 76 YSTRs match between me and the Russian (who even though has not tested for DF99, was identified as a strong candidate for a + result by GoldenHind).

If this calculator is sound: http://dna-project.clan-donald-usa.org/tmrca.htm
then, the most tenable TMRCA is 130 generations ago (97.7% Cumulative), a less tenable but still plausible TMRCA is 97 generations ago (75.9% Cumulative). Bronze Age territory. Which leads me to the Northwest Block, which I regretfully neglected to mention much earlier in this thread.



If Myers was correct in 2010 (about the distribution of P312 and it being centered around the Rhine) and the age of DF99 is nearish to P312 itself, it seems likely to mirror P312 in being concentrated around the Rhine basin. Go figure the Netherlands is a potential hot spot at this point from what little information we have at this juncture. Now, one must ask - why would a clade that seems likely to be strong around the Rhine and Netherlands be shared between English, Lowlands Scots, Dutch, Flemish, Germans and Ligurians?

It could be that there was a Bronze Age Northwest Block event to assist in the spread of DF99, as for why it would be in Liguria - at the Bronze Age there could have been a band that migrated along the Rhine and through the Piedmont into Liguria. Or, it could be that the DF99ers already present around the Rhine got absorbed by such groups as the Franks, then dispersed (even into Liguria). Keep in mind that these two options are not mutually exclusive, both could have occurred and a third, fourth, fifth, etc. could have occurred in conjunction (e.g. a North band of DF99 and a South band of DF99 to be discerned further as more subclades are discovered).

Defining Northwest Block -

http://en.wikipedia.org/wiki/Nordwestblock

"The Nordwestblock (English: "Northwest Block"), is a hypothetical cultural region, that several 20th century scholars propose as a prehistoric culture, thought to be roughly bounded by the rivers Meuse, Elbe, Somme and Oise (the present-day Netherlands, Belgium, northern France and western Germany) and possibly the eastern part of England during the Bronze and Iron Ages (3rd to 1st millennia BC, up to the gradual onset of historical sources from the 1st century)."

Additional comments on GDs, since they have been referenced at some point:

The GDs only show how closely related currently tested individuals are - for all we really know there could be floaters out there with closer GDs, we have no way of knowing unless they test some day.

And, GDs do not necessarily exclude physical events as migrations. I can have a GD of 58 with an individual and my forefathers could have still taken part in the same migration event (an example of this in history, US colonies - not all the US colonials were recent relatives, many were completely unrelated for thousands of years yet took part in the same migratory event. This can apply to Franks. And it can apply to possible Northwest Block bands. Etc.).

Rathna
12-20-2013, 04:32 PM
Telfermagne, amongst other things we are waiting for our Chromo2 from 2 months and half, helas!
About your hypothesis of the Northwest Block, everything is subdue to the interpretation of the Mutation Rate. I did some hypotheses about future Full Y and also Big Y. These results will be the definitive proof as to whether I am right or wrong.

Telfermagne
12-20-2013, 05:25 PM
Telfermagne, amongst other things we are waiting for our Chromo2 from 2 months and half, helas!
About your hypothesis of the Northwest Block, everything is subdue to the interpretation of the Mutation Rate. I did some hypotheses about future Full Y and also Big Y. These results will be the definitive proof as to whether I am right or wrong.

Got my Chromo2 results, they also confirmed DF99+ with S11987+ (same SNP different name).

My full results:

CTS10149+, CTS11468+, CTS11575+, CTS11948+, CTS11991+, CTS12057+, CTS12633+, CTS12773+, CTS1738+, CTS2134+, CTS2254+, CTS2286+, CTS2480+, CTS2569+, CTS2664+, CTS3229+, CTS3315+, CTS3316+, CTS3358+, CTS3654+, CTS3818+, CTS3844+, CTS4293+, CTS4437+, CTS4740+, CTS4944+, CTS5139(+), CTS5248+, CTS524+, CTS543+, CTS6327+, CTS6348+, CTS6376+, CTS6383+, CTS6445+, CTS7206+, CTS7301+, CTS7604+, CTS7659+, CTS7922+, CTS7941+, CTS8627+, CTS8728+, CTS9200+, CTS9556+, CTS9760+, F1794+, L1002+, L1013+, L1053+, L1084+, L1098+, L1105+, L1118+, L1123+, L1129+, L1130+, L1137+, L1143+, L1145+, L1150+, L1179+, L1220+, L132+, L1345+, L1350+, L1352+, L265+, L278+, L320+, L352+, L438+, L440+, L468+, L470+, L479+, L498+, L508+, L543+, L58+, L604+, L741+, L752+, L757+, L768+, L773+, L822+, L82+, L875+, L882+, L969+, M213+, M235+, M294+, M299+, M415+, M42+, M523+, M526+, M74+, P128+, P131+, P135+, P139+, P140+, P141+, P142+, P143+, P151+, P158+, P159+, P160+, P163+, P224+, P225+, P226+, P229+, P230+, P232+, P233+, P234+, P236+, P239+, P242+, P244+, P245+, P280+, P282+, P284+, P285+, P294+, P295+, P297+, P305+, P310+, PAGE081+, PAGE083+, PF1030+, PF1067+, PF1081+, PF1252+, PF1253+, PF1416+, PF1695+, PF1911+, PF256+, PF2592+, PF2615+, PF2617+, PF2619+, PF2621+, PF2622+, PF2624+, PF2626+, PF2629+, PF2651+, PF2653+, PF2655+, PF2658+, PF2660+, PF2677+, PF2679+, PF2683+, PF2684+, PF2685+, PF2688+, PF2690+, PF2700+, PF2702+, PF2704+, PF2709+, PF2716+, PF2718+, PF2722+, PF2734+, PF2736+, PF2737+, PF2739+, PF2742+, PF2747+, PF2748+, PF2760+, PF2762+, PF2775+, PF3495+, PF3500+, PF4432+, PF5459+, PF5461+, PF5480+, PF5495+, PF5857+, PF5861+, PF5865+, PF5869+, PF5870+, PF5872+, PF5873+, PF5885+, PF5887+, PF5893+, PF5898+, PF5908+, PF5912+, PF5914+, PF5917+, PF5923+, PF5927+, PF5936+, PF5940+, PF5941+, PF5945+, PF5949+, PF5953+, PF5957+, PF5958+, PF5964+, PF5966+, PF5977+, PF5980+, PF5981+, PF5982+, PF6016+, PF6040+, PF6047+, PF6055+, PF6056+, PF6063+, PF6065+, PF6079+, PF6082+, PF6114+, PF6115+, PF6116+, PF6129+, PF6136+, PF6143+, PF6145+, PF6242+, PF6246+, PF6249+, PF6252+, PF6258+, PF6263+, PF6265+, PF6267+, PF6269+, PF626+, PF6271+, PF6272+, PF6399+, PF6409+, PF6410+, PF6419+, PF6429+, PF6430+, PF6432+, PF6434+, PF6435+, PF643+, PF6443+, PF6451+, PF6463+, PF6467+, PF6469+, PF6471+, PF6475+, PF6481+, PF6484+, PF6487+, PF6495+, PF6497+, PF6506+, PF6507+, PF6524+, PF6528+, PF653+, PF6541+, PF679+, PF733+, PF744+, PF825(+), PF834+, PF869+, PF948+, S10738+, S11330+, S1159+, S11638+, S116+, S11987+, S12547(+), S128+, S138+, S1572+, S16059+, S163(+), S19777+, S1984(+), S19862(+), S1+, S2017+, S20246+, S20315+, S26361+, S26903+, S27544+, S27668+, S349+, S3509+, S351+, S3848+, S3+, S4276+, S4888+, S4+, S6378+, S8235+, S8709+, S8889+, S9041+, S9158+, S932+, S959+, SRY10831(+), V102+, V104+, V126+, V168+, V186+, V187+, V221+, V226+, V231+, V241+, V244+, V29+, V41+, V52+, V9+, YSC0167+, YSC0186+, YSC0203+, YSC0227+, YSC1297+, Z1244+, Z2032+

Rathna
12-20-2013, 05:49 PM
I don’t understand why you received your results and I not:

Sorry, there are no results available at the moment

Telfermagne
12-20-2013, 06:12 PM
I don’t understand why you received your results and I not:

Sorry, there are no results available at the moment

I had sent them an email about two days ago enquiring about why there was a delay. They seem to be back logged. As for the description of results, they assert that R-S116 is Bell Beaker, they don't explain their reasoning from what I read so far which is disappointing. For DF99 they don't have any information aside from the S11987 + result and a list of figures for R-S116* in the world and Isles.

In the Isles R-S116* (meaning not belonging to their published subclades, so this could include DF99+ and DF99- results) makes up 14% in England North (excluding Yorkshire), 13% in Southwest England, 12% Scotland-Central, 11% England Southeast, 10% Scotland North West, 10% England Central, 10% England West, 8% England Yorkshire, 8% Ulster, 8% Leinster, 7% Scotland West, 6% Munster, 6% Connacht, 5% Wales.

Worldwide distribution they have - Spanish 35%, French 32%, Norwegian 10%, Scottish 10%, Dutch 7%, English 7%, Germans 7%, Irish 6%, Italians 5%, Polish 1%, Balkan 0.5%, Russian 0.5%.

Rathna
12-20-2013, 06:18 PM
If my hypotheses are true, that the S SNPs are classified in series (but I am not at home now and I haven't my documents), also S11638 should be under S116 (P312). Of course we should compare your data with other S116 or, better, S11987.

castle3
12-21-2013, 01:37 PM
It's almost 'mission impossible' trying to separate the various 'tribes' that overlayed each other in what we now call Belgium & eastern Normandy. Take Caux, for example: the Caletes dwelt in a region that was predominantly Belgic Celt. Waves of Danes, Norwegians & others also swept through the region, along with the Franks & others.
I have a very similar BDNA Bell Beaker S116 percentages map as described by Telfermagne. I'm DF99- & also S389+. Hopefully more results will pour in after Xmas & give us something more solid to deal with. Personally, the only plus I can think of is that having a very rare S389+ will hopefully be useful when (or if!) others are found.

GoldenHind
12-21-2013, 07:40 PM
I had sent them an email about two days ago enquiring about why there was a delay. They seem to be back logged. As for the description of results, they assert that R-S116 is Bell Beaker, they don't explain their reasoning from what I read so far which is disappointing. For DF99 they don't have any information aside from the S11987 + result and a list of figures for R-S116* in the world and Isles.

In the Isles R-S116* (meaning not belonging to their published subclades, so this could include DF99+ and DF99- results) makes up 14% in England North (excluding Yorkshire), 13% in Southwest England, 12% Scotland-Central, 11% England Southeast, 10% Scotland North West, 10% England Central, 10% England West, 8% England Yorkshire, 8% Ulster, 8% Leinster, 7% Scotland West, 6% Munster, 6% Connacht, 5% Wales.

Worldwide distribution they have - Spanish 35%, French 32%, Norwegian 10%, Scottish 10%, Dutch 7%, English 7%, Germans 7%, Irish 6%, Italians 5%, Polish 1%, Balkan 0.5%, Russian 0.5%.

I wonder just exactly what they include as S116*? Are DF27 XZ196 and DF19 part of their published subclades? Some of those percentages look very odd to me, and are considerably different from what is seen in the FTDNA database. The 35% in Spain is an example. Iberia is pretty well represented in the FTDNA database, but I an not aware of a single example who is DF99 or P312**, They may well exist, but if they are as much as 35%, they must be well hidden. Perhaps they include more as S116** than DF99 and P312**?

Also I am unclear what the percentages represent- the percentage of all samples, all of R1b, or just of P312/S116?

Did they provide a map of the distribution of S116* in the British Isles?

GoldenHind
12-22-2013, 02:05 AM
I wonder just exactly what they include as S116*? Are DF27 XZ196 and DF19 part of their published subclades? Some of those percentages look very odd to me, and are considerably different from what is seen in the FTDNA database. The 35% in Spain is an example. Iberia is pretty well represented in the FTDNA database, but I an not aware of a single example who is DF99 or P312**, They may well exist, but if they are as much as 35%, they must be well hidden. Perhaps they include more as S116** than DF99 and P312**?



A possible solution has occurred to this quandry has occurred to me. Since BritainsDNA is unlikely to have a large number of Iberian samples in their own database, they probably used another study. My guess is that it is one which didn't test for much of DF27, etc., probably done before the fairly recent discovery of DF27. The same may well apply to some of their other percentages from the continent. Without knowing what they relied on in compiling the percentages from the continent, I wouldn't put too much faith in them.

DavidCar
12-23-2013, 04:48 AM
"Eore's Ghost", one of the CTS7550/PF1085 cases, just ordered DF27, DF99 and 111 STRs.

David,
My tests for kit N115443 came back negative for , DF27-, DF99-, L21-;
Below are the partial results from the STR 111 tests (just missing one panel). Could you share this with the folks like Golden Hind?

Cheers.

DavidCar
12-23-2013, 04:53 AM
Note: In the Yahoo P312 Group Files section there is a folder intended for uploading and collecting P312 Chromo2 raw data for use by anyone trying their hand at making sense of the numbers. There's not much there at the moment.

castle3
12-23-2013, 10:48 AM
Note: In the Yahoo P312 Group Files section there is a folder intended for uploading and collecting P312 Chromo2 raw data for use by anyone trying their hand at making sense of the numbers. There's not much there at the moment.

David, see my last post on the DF99- thread. There are several of us who are DF99- with strong geographical links to Cumbria and Dumfriesshire. I have charter evidence linking some of them.

Bob

Telfermagne
12-23-2013, 01:52 PM
Note: In the Yahoo P312 Group Files section there is a folder intended for uploading and collecting P312 Chromo2 raw data for use by anyone trying their hand at making sense of the numbers. There's not much there at the moment.

I'll upload mine sometime today. Thanks for posting this.

GoldenHind
12-23-2013, 07:42 PM
David,
My tests for kit N115443 came back negative for , DF27-, DF99-, L21-;
Below are the partial results from the STR 111 tests (just missing one panel). Could you share this with the folks like Golden Hind?

Cheers.

Thanks very much for this information. Eores Gnost has now been added to the P312** section in the P312 project results pages. He appears to be a member of a fairly large STR cluster within P312** which had previously escaped my notice, as I believe only one of them was previously listed as P312**. There are now three of them there, and there appears to be quite a few more who fit this profile.

I will look into this and post a mention on the more appropriate P312** thread.

As far as I can tell, Eores Ghost does not have a Ysearch entry. Would you ask him to upload his results there? That would be helpful in identifying this cluster.

EDIT: I believe I have found Eores Ghost Ysearch ID. I have now looked into this cluster sand posted some further comments on the P312** thread.

Telfermagne
12-30-2013, 10:31 PM
Reorganizing/summarizing my thoughts on the DF99 matter (If there is an error in reasoning, then say so and offer a solution - reasons for a contrary conclusion.):

First, DF99/S11987 + results and likely candidates -

After considering the FTDNA database, Genomes of the Netherlands Project, and the Crowdfunding DNA Project, this is the DF99/S19987 tally: 4 Dutch, 4 British Islander, 1 Flemish, 1 Ligurian, 1 Tuscan, 1 either English or German, and 1 European-Peruvian (likely Spanish but could be Italian, German or other Euro). Other likely candidates: A Russian from the FTDNA database.

Second, Y-STR comparison (FTDNA STRs only, excluding my extra markers from SMGF) -

Me vs. the Russian line: 52 out of 67 Y-STRs match
Me vs. the Scottish line: 51 out of 67 Y-STRs match
Me vs. the Ligurian line: 47 out of 67 Y-STRs match
Me vs. the Nottinghamshire line: 46 out of 67 Y-STRs match
Me vs. the Flemish-Spanish line #1: 46 out of 67 Y-STRs match
Me vs. the Flemish-Spanish line #2: 45 out of 67 Y-STRs match
Me vs. the Pennsylvanian (either British or German descent): 43 out of 67 Y-STRs match

Third, TMRCA -

I am utilizing: http://dna-project.clan-donald-usa.org/tmrca.htm

Me vs. the Russian line:
97.6%-95% @ 127 generations-118 generations
Me vs. the Scottish line:
97.7%-94.9% @ 135 generations-125 generations
Me vs. the Ligurian line:
97.5%-95% @ 166-156 generations
Me vs. the Nottinghamshire line:
97.6%-95% @ 175-164 generations
Me vs. the Flemish-Spanish line #1:
97.6%-95% @ 175-164 generations
Me vs. the Flemish-Spanish line #2:
97.5%-94.9% @ 183-172 generations
Me vs. the Pennsylvanian line (either British or German descent):
97.4%-95.2% @200-190 generations

Fourth, extrapolations (these are by no means rigorous and are susceptible to change) -

Let's assign a value of 25 years for a generation, a very liberal rule of thumb.

With a generation assigned as such, a TMRCA could be between:

3175-2950 years before the birth of my genetic signature and the birth of the Russian's genetic signature.
3375-3125 years Scottish line
4150-3900 years Ligurian line
4375-4100 years Nottinghamshire line
4375-4100 years Flemish-Spanish line #1
4575-4300 years Flemish-Spanish line #2
5000-4750 years Pennsylvanian line (either British or German descent)

From FTDNA FAQ: a genetic distance of 3-4 with 67 STR testers indicates a common ancestor in less than 15 generations/recent genealogical times. So, my unique STR signature could have been around for 15 generations. With that in mind, and the 25 year rule of thumb for a generation, the birth of my unique STR signature could have been 375 years before my birth (around 1614 A.D.).

If a common ancestor between me and the Russian line lived 3175-2950 years before the birth of my unique Y-STR signature, then that ancestor could have lived 1561 BCE to 1336 BCE. If a common ancestor between me and the Scottish line lived 3375-3125 years before the birth of my unique Y-STR signature, then that ancestor could have lived 1761 BCE to 1511 BCE. I am willing to bet that Me, the Russian and the Scot belong to our own clade of DF99/S11987.

Since the time period could span 1761 BCE to 1336 BCE, the Wessex and Hilversum cultures of Britain, Netherlands, and Belgium could be candidates for the spread of our unknown subclade of DF99 (these cultures had wide trade links with the rest of Europe importing amber from the Baltic, gold from Brittany, daggers and beads from Mycenaean Greece, etc. the Russian line could be linked to the Baltic trading of these cultures).

castle3
01-03-2014, 12:07 PM
I noticed that the R1b-S116 HG percentages map supplied by BDNA showed France and Spain at levels over 30%, with several other countries at between 5% - 10%. I noticed that Poland scored 1%. That reminded me of a theory which was discussed many years ago in which Ranulf le Meschin's line had Polish ancestry prior to the family arriving in Normandy. From memory (!) I recall some thought the 'Meschin' epithet was derived from the Polish 'Mieszko' .
I didn't research any of the above, so can't vouch for its veracity, but thought it might explain some Polish links.

GoldenHind
01-03-2014, 07:29 PM
If a common ancestor between me and the Russian line lived 3175-2950 years before the birth of my unique Y-STR signature, then that ancestor could have lived 1561 BCE to 1336 BCE. If a common ancestor between me and the Scottish line lived 3375-3125 years before the birth of my unique Y-STR signature, then that ancestor could have lived 1761 BCE to 1511 BCE. I am willing to bet that Me, the Russian and the Scot belong to our own clade of DF99/S11987.

Since the time period could span 1761 BCE to 1336 BCE, the Wessex and Hilversum cultures of Britain, Netherlands, and Belgium could be candidates for the spread of our unknown subclade of DF99 (these cultures had wide trade links with the rest of Europe importing amber from the Baltic, gold from Brittany, daggers and beads from Mycenaean Greece, etc. the Russian line could be linked to the Baltic trading of these cultures).

If you are looking at genetic distance alone, you need to look at those of everyone who is DF99+ to each of the others, and not just that of yourself. For instance, my closest GD by a wide margin to anyone in the group is to the Scot (18 @ 67). Assuming the Russian is in fact DF99+ (in my opinion a near certainty), I believe it is noteworthy that you and I, who have ancestry from neighboring counties in England, are a closer GD to the Russian than to each other.

I also think that looking at shared off modals is as least as important, if not more important, than genetic distance in analyzing clusters within DF99.

We really need much more data before we can start making sense of all this. I suspect the distribution in Britain will be an important indicator. Unfortunately many of the P312** who will likely test DF99+ are people with English surnames who don't have ancestry beyond the USA, so it may be some time before we can get a feel for that.

I am hopeful however that we may be able to begin defining DF99 subclades within the next few months.

GoldenHind
01-03-2014, 07:40 PM
I noticed that the R1b-S116 HG percentages map supplied by BDNA showed France and Spain at levels over 30%, with several other countries at between 5% - 10%. I noticed that Poland scored 1%. That reminded me of a theory which was discussed many years ago in which Ranulf le Meschin's line had Polish ancestry prior to the family arriving in Normandy. From memory (!) I recall some thought the 'Meschin' epithet was derived from the Polish 'Mieszko' .
I didn't research any of the above, so can't vouch for its veracity, but thought it might explain some Polish links.

I think you can safely dismiss that theory. Ranulf le Meschin's father was Ranulf de Briquessart, who succeeded his father, Anschetil, as hereditary viscount of Bayeux. Anschetil is the Norman version of the Scandinavian personal name Asketill.

Telfermagne
01-22-2014, 11:05 PM
EDIT

Bad question, removed

GoldenHind
02-01-2014, 12:08 AM
I am aware of three pending DF99 tests at FTDNA whose results should be very informative. All three were recruited to test for it based on both their STR signatures and previous SNP testing, which in combination suggests a good chance of getting positive results.

The first is the Russian P312** who has been mentioned before. I will be very surprised if he gets negative results.

The second is a Norwegian whose Geno 2 test failed to turn up any SNPs below P310/L11. That doesn't rule out DF27 however, so I am not as confident in predicting his result.

The third is an American with undoubted British ancestry who has a fair number of matches in both his surname project and a couple of other surname projects as well. He has tested negative for DF27, L21 and U152, and doesn't appear likely to be DF19 or L238. That leaves DF99 or P312** as most probable. I give him better than a 50/50 chance of testing positive. If that turns out to be the case, it seems highly probable that his 67 marker matches will be DF99 as well, as they match the same signature. Perhaps the subclade will turn out to be less rare in Britain than first thought.

There is also a confirmed DF99+ who has a test pending with FullGenomes and a highly likely DF99 who has the BigY pending.

When all of this is in, we should know a lot more about DF99 than we do now.

GoldenHind
02-07-2014, 12:06 AM
I am aware of three pending DF99 tests at FTDNA whose results should be very informative. All three were recruited to test for it based on both their STR signatures and previous SNP testing, which in combination suggests a good chance of getting positive results.

The first is the Russian P312** who has been mentioned before. I will be very surprised if he gets negative results.



The results for the Russian came in today, and as predicted, he is DF99+. I don't like to mention his name without permission, but I think I can say he is a member of an aristocratic Russian family which claims to be descended from a Scandinavian Rus.

jdean
02-07-2014, 12:44 AM
The results for the Russian came in today, and as predicted, he is DF99+. I don't like to mention his name without permission, but I think I can say he is a member of an aristocratic Russian family which claims to be descended from a Scandinavian Rus.

Marvellous news, thanks for the update !!!

rms2
02-08-2014, 04:25 PM
The results for the Russian came in today, and as predicted, he is DF99+. I don't like to mention his name without permission, but I think I can say he is a member of an aristocratic Russian family which claims to be descended from a Scandinavian Rus.

I can read the name he lists for his y-dna mdka on the public R-P312 Project web site: Velyaminov. :)

There have been a number of famous Russians with that surname, and it has a geographic connection to Moscow.

Don't know about the supposed Scandinavian Rus connection, but it's definitely an old Russian surname.

BTW, since he lists the middle name of his mdka, you can also tell the name of his mdka's father, which means the listed mdka is not really the mdka at all, since Russian middle names indicate the name of one's father. Fyodor should be the mdka, but the project member probably does not have much info on him, so he lists Fyodor's son Danila instead.

rms2
02-09-2014, 03:38 PM
There's a village called Velyaminovo (http://goo.gl/maps/hO7sw) just northwest of Moscow that is probably connected to the surname Velyaminov. It probably grew up as part of the family estate, since it looks like the Velyaminovs were boyars.

1381 1383

I've never been there, but I've been to Zelenograd, which I really liked.

GoldenHind
02-14-2014, 01:11 AM
I have been in touch with a researcher who has constructed an extremely interesting provisional DF99 tree, based on the STRs of those who have been identifed as DF99+.

He calculates the MRCA of the entire group at just under 200 generations. Depending on the number of years used per generation, and rounding off, this would suggest the subclade was born sometime around 3000 to 4000BC. This tends to confirm earlier estimates that the subclade is quite old, probably not much younger than P312 itself.

He calculates the MRCA of the Russian and an English DF99+ (Telfermagne, with ancestry from Yorkshire) at 48 generations. Assuming somewhere between 25 and 30 years per generation, that would put their MRCA living somewhere in the general vicinity of 550 to 800 AD, or even later if a shorter number of years per generation is used. I think it is highly unlikely that Temfermagne's Yorkshire ancestors are from Russia. I suppose it is possible that the Russian's ancestry is ultimately of English origin, but that seems to me to be fairly low on the probability scale. I think it is far more likely that their MRCA was living somewhere which provided population inflow to both northern England and Russia in that time frame.

R. Walker
02-14-2014, 02:19 AM
So where does that leave the Tuscan and the Ligurian?

GoldenHind
02-14-2014, 06:27 PM
So where does that leave the Tuscan and the Ligurian?

I wish I knew the answer to that question. I would be very interested to know how close they are to each other, and where they fit in the DF99 tree with relation to the others.

As for the Tuscan, his DF99 status comes from the 1000 Genomes Project. Those samples are anonymous, and I am told their STRs, which are necessary for this sort of calculation, are unknown.

As for the Ligurian, who I know is of special interest to you, the person who compiled the chart for some reason forgot to include him. I have asked that his data be included in any future revisions. However in looking at the chart, I would estimate that the MRCA of the Ligurian with the British group to be greater than 70 generations, so probably in excess of 2000 YBP. How much in excess I am unable to estimate, as I don't have the abilities of the person who created the chart..

rms2
02-16-2014, 02:54 PM
Any idea how big a clade DF99 is? Any recruiting for it going on?

GoldenHind
02-16-2014, 06:54 PM
Any idea how big a clade DF99 is? Any recruiting for it going on?

Since it is so new, I can only speak provisionally. DF99 appears to be relatively small compared to the much larger subclades of L21, DF27 and U152. My guess is that it may be a little smaller than DF19 and a little larger than L238. The best evidence we have is from the Netherlands study, which found four DF99+ in a sample of 500 males. DF99 was 1.5% of R1b and and a little over 4% of P312. There is no reason to believe these amounts will necessarily be similar for other regions of Europe. Like other P312 subclades, it is probably much more frequent in some areas than others.

Recruiting has been a challenge. Part of the problem is identifying likely candidates for testing. While there is a very strong STR signature which appears to only apply to a very small segment within DF99, there doesn't appear to be any sure way of spotting probable members of the subclade. From the nine DF99 for whom we have STR markers, we can say that almost all of them have the otherwise rare 12 at DYS389i, and most of them also have 391=10. However some DF99 have neither of these, and the combination does appear rarely in other subclades.

I have been contacting various possible DF99 candidates individually and have had some success in getting orders. I have also found some inexplicable resistance to ordering it, as well as some from whom I get no response.

Short of another large scale study like that in the Netherlands (incidentally the Brabant study has been requested to reanalyze their P312* samples for DF99), I can only think of two other options to increase the number of people who test for it. One is the offer of a free test, which Henry had a great deal of success with for DF27 and George with DF19. However this requires a source of funds. The second is a new deep clade R1b test from FTDNA which is affordable and includes DF99.

Telfermagne
02-18-2014, 04:26 PM
If anyone is good with Russian translations, some posts about DF99 and Velyaminov-Vorontsov are here: http://forum.molgen.org/

Included in the posts is the TMRCA chart GoldenHind posted in addition to a few more.

My google translate operation doesn't translate Russian into English very well, so I had a difficult time making sense of the conversations. For some reason direct links to the specific thread is not working, so on the main page search for DF99 and it should lead to a series of posts in the thread titled "Варяжский князь Шимон Африканович".

From my last attempt at making sense of the conversation it seems that the various Velyaminov-Vorontsov branches (in addition to other branches by other surnames like Aksakov) have diverse Y-DNA origins, leading to an assertion that the Simon Afrikan figure could be a "mythical ancestor" developed to legitimize various claims in aristocratic Russian society (perhaps akin to the traditions in N & NW Europe where mythical heroes like Odin are claimed as ancestors as a tactic to legitimize rule).

It would seem that in addition to DF99, various Velyaminovs and Vorontsovs also bear haplogroup I1, N1c1, and R1a clades. So it seems to be a situation similar to those claiming Rurik dynasty descent (Monomakhoviches being N1c1, others like the Olgoviches being split between R1a and R1b clades).

Rathna
02-22-2014, 04:12 PM
Amongst the about 2000 samples released by Chromo2 there are also 4 DF99/S11987: 612, 614, 615, 1896, but, even though they demonstrate the relatively high presence of this haplogroup in the Isles (if the most part of the people tested come from there), it seems also that they have a very low variance, thus a recent presence there:

CTS6498: 615
S16136: 612, 614, 1896
S23540: 612, 614, 1896

GoldenHind
02-22-2014, 07:59 PM
Amongst the about 2000 samples released by Chromo2 there are also 4 DF99/S11987: 612, 614, 615, 1896, but, even though they demonstrate the relatively high presence of this haplogroup in the Isles (if the most part of the people tested come from there), it seems also that they have a very low variance, thus a recent presence there:

CTS6498: 615
S16136: 612, 614, 1896
S23540: 612, 614, 1896

Thanks very much. That is extremely interesting. With the caution that this is all still very provisional, one can make several observations:

Although I doubt the BritainsDNA samples can be considered random and may not necessarily be British, a comparison of 4 DF99 out of 2000 samples there against 4 out of 500 in the Netherlands study suggests DF99 may be four times more common in Holland than in Britain.

The data you quote tends to confirm my preliminary view that DF99 is divided into two distinct subclades. So far, the British DF99 cluster together into a separate group from most of the others, although I am unable to say exactly where our Ligurian fits in. Oddly enough, the Russian is definitely part of the British group, which suggests to me either that he has British origins, or that this group derives from a common source which appears to have entered Britain at a fairly late date, possibly some time after 500 AD.

rms2
02-22-2014, 08:07 PM
Those four may be the Dutch DF99+ men. Chromo2 included data from the 500 Dutch Genomes thing, so my guess is those four are in fact the Dutch DF99ers. That number four just seems too big a coincidence to me.

Rathna
02-22-2014, 09:23 PM
Those four may be the Dutch DF99+ men. Chromo2 included data from the 500 Dutch Genomes thing, so my guess is those four are in fact the Dutch DF99ers. That number four just seems too big a coincidence to me.

Of course we don't know, but they write that "These are the Chromo2 Y genotypes for 2000 anonymised individuals", and probably they are the customers. We can see that there isn't Telfermagne (who probably has no mutation under DF99/ S11987) as I wasn't amongst the R-Z2110, but probably because our results were released too late. It would be paradoxical that they have used the Dutch samples, who served only for recruiting the SNPs to test, as if Geno 2.0 had used the Sardinians of Francalacci.
We could study the haplotypes of the 9 known DF99, but I don't dare to publish them here after the warnings of AJL. The discourse should be another: that probably the scarcity of SNPs for DF99 was already in the Dutch samples, which could have the same origin, and this cannot exclude that many other SNPs are in loci not tested. It would be absurd that an haplogroup so old has so few SNPs whereas we have seen how many L11 have.

GoldenHind
02-23-2014, 12:19 AM
Those four may be the Dutch DF99+ men. Chromo2 included data from the 500 Dutch Genomes thing, so my guess is those four are in fact the Dutch DF99ers. That number four just seems too big a coincidence to me.

I wasn't aware the Dutch results were included in the BritainsDNA data. If that is the case, I suspect you are correct.

I should perhaps modify my previous post. I do not discount the possibility that future DF99 will be identified who may well have entered Britain at a much earlier date that that I mentioned. I was only referring to the three British DF99 currently known, who appear to be on the same branch as the Russian. The current data suggests that DF99 is about as old as P312 itself, so it would be premature to be dogmatic about its history and distribution

GoldenHind
02-23-2014, 12:30 AM
The discourse should be another: that probably the scarcity of SNPs for DF99 was already in the Dutch samples, which could have the same origin, and this cannot exclude that many other SNPs are in loci not tested. It would be absurd that an haplogroup so old has so few SNPs whereas we have seen how many L11 have.

There is no doubt that there are a large number of SNPs below DF99. A number have already been identified, but unfortunately they are only known to be currently available by testing with FullGenomes. There is one confirmed DF99 who has a test pending there, so if his results become public, we should learn a lot more about its substructure. There is also a BigY test pending for someone who is highly likely to be DF99+. I have no idea how informative those results may be.

razyn
02-23-2014, 03:09 AM
Those four may be the Dutch DF99+ men. Chromo2 included data from the 500 Dutch Genomes thing, so my guess is those four are in fact the Dutch DF99ers. That number four just seems too big a coincidence to me.

Are you alluding to this bit from the BISDNA web page about their new test?


Chromo2 YDNA tests over 15,000 Y chromosome markers, more than any other product on the market. The markers have been carefully selected to be most informative, and as free from duplication as possible. They have been hand picked from the 1000 Genomes Project, 500 Dutch Genomes and from a selection of high value personal genomes, many from our own research. (Boldface for emphasis is mine.)

I don't think that suggests that this spreadsheet of results from 2,000 (or actually 1,999) Chromo2 tests includes any results from the earlier Dutch project -- from which (among other sources) they selected useful-looking markers to be tested on the chip they were designing.

However, you may have some other reason for thinking that, of which I haven't heard.

Rathna
02-23-2014, 03:44 AM
There is no doubt that there are a large number of SNPs below DF99. A number have already been identified, but unfortunately they are only known to be currently available by testing with FullGenomes. There is one confirmed DF99 who has a test pending there, so if his results become public, we should learn a lot more about its substructure. There is also a BigY test pending for someone who is highly likely to be DF99+. I have no idea how informative those results may be.

I think that there is another explication as to the supposed few mutations of these haplotypes. If we take into account the two Fimbres (277715 and 29073), who belong clearly to the same haplotype, we can see that they have only 2 mutations out of 67 markers, thus on average they should be separated from less than 200 years, but perhaps they are more.
Apart the fact that there are haplotypes which mutate slower that others, it is clear that this depends also from the number of meyoses: the rare haplotypes mutate slower, when they survived, the most diffused mutate faster because only a few lines survive which cumulate all the mutations of their own descent: we can see this in the knots of an haplogroup, where many mutations are cumulated.
Of course after the Big Y or the Full Y, as GoldenHind said, we'll be able to say something more careful.

VinceT
02-23-2014, 05:04 AM
The variants found in the ~500 Dutch samples sequenced by the GoNL (Genome of the Netherlands) Project were used as a resource for the Chromo2 chip design. It's highly unlikely that the same samples were tested with the Chromo2 chip.

rms2
02-23-2014, 05:06 PM
They wouldn't have to have been tested by BDNA and the Chromo2 chip to be included in the data, would they?

But maybe these are four different DF99+ specimens. Odd that there were four in the Dutch sample and exactly the same number in the BDNA release.

Would someone kindly post a link to those BDNA results?

GoldenHind
02-23-2014, 11:33 PM
Would someone kindly post a link to those BDNA results?

Someone posted a link to it on the Z253 thread. It was said to be an extremely large file, so I didn't download it.

Presumably Rathna has a link to it.

razyn
02-23-2014, 11:46 PM
Would someone kindly post a link to those BDNA results?

https://www.britainsdna.com/download/C2_2000.zip

When unzipped, this is a 93 Mb Excel file (.xlsx) that takes a while to populate, unless you have a lot of RAM (over 4 GB would be good -- and a pretty recent version of Excel). It's a simple spreadsheet, but with ~ 2,000 columns and over 14,000 rows.

VinceT
02-24-2014, 12:20 AM
^ see above

GoldenHind
03-02-2014, 08:45 PM
With regard to the issue of the 2000 Chromo2 results discussed above and the question of whether the four DF99 samples were merely poached from the Genes of the Netherlands study, the consensus seems to be that they are in fact from BritainsDNA customers. If the suggestion by rms that these are actually incorporated from the Netherlands study, that would mean that zero DF99 were found in Britain in the Chromo2 results.

Either way, I think this is pretty good evidence that DF99 is much more common in Holland than in Britain.

rms2
03-04-2014, 03:37 PM
I can confirm that those four DF99+/S11987+ results are current BDNA Chromo2 customers and not the four Dutchmen from the Genomes of the Netherlands study. I wrote Dr. Jim Wilson and asked him about it. :)

GoldenHind
03-07-2014, 02:19 AM
As I have said before, the current indications are that DF99 is a very old subclade of P312. As such, I suspect it has a substructure as complex as those in DF27, L21 and U152, but it will likely take a while to get caught up.

Thanks to information received from a number of different individuals, we can now start on the process of identifying DF99 subclades.

The first I will refer to as Group A. It is defined by the SNP S23540 (21783573A>C).

Below that is a further subclade under Group A which I will call Group A1. It is defined by the SNP S16136 (14539162G>A) in addition to the above. It has been found in multiple samples from the Genes of the Netherlands study, a Tuscan sample in the 1KG Project, and samples 612, 613 and 1896 in the recently released BDNA Chromo 2 results. There is apparently at least one in the Dutch sample who is positive for S23540 but not for S16136, which establishes their relative positions.

There is another completely separate subclade which to date is defined by two SNPs and one INDEL, which I will call Group B. One FGC sample of English ancestry (namely myself) and a 1KG Project sample from Peru all share the following SNPs, but none of those in Group A or A1.
FGC846 (4199952T>C), FGC847 (14008320G>C), and FGC896 (2324593AT>A), and probably a further SNP and two further INDELs as well.

Finally there is a singleton from the Chromo 2 results (615) who does not have either of the SNPs in Group A and A1, but is positive for CTS6498 (16940903A>C). As this also shows up in several other haplogroups besides R, it may not be significant.

Unfortunately it is not possible at this time to say if any of the identified DF99+ samples in the FTDNA database fall into any of these categories. None of the above are offered by FTDNA. If Telfermagne, who tested with Chromo 2, ever gets his raw data file, we should be able to at least determine whether he has either of the SNPs from Group A and A1. Finally there is a highly probable DF99+ who has the BigY pending, but it is unknown whether any of the above SNPs will be included in the test.

At least we are making some progress.

EDIT: I neglected to mention that there is also a confirmed DF99+ who is in the latest round at Full Genomes. My guess is that he is likely to be a part of Group A, but in any case his results should be helpful.

GoldenHind
03-07-2014, 09:33 PM
Two more results today from those recruited from the P312** list whose STRs showed at least a reasonable chance of positive results, and both are indeed DF99+.

Both only have ancestry to the USA. However the first is undoubtedly of Pennslyvania Dutch origin. The family has 18C origins in that state, and the EKAs of his two 67 matches, also from Pennsylvania, were named Ulrich and Matthias. A previous DF99+ also appears to have Pennsylvania Dutch origins. For those unfaniliar with the term, this refers to 18C settlers to Pennsylvania who came from Germany rather than Holland. In this case "Dutch" seems to be a corruption of "Deutsch." According to Wikipedia, they came primarily from the present day German states of Rheinland-Pfalz and Baden-Württemberg. I have a feeling this group could be a good source for DF99 prospects.

The second has a fairly common English (ie Anglo-Saxon) placename for a surname, but says there is a family tradition they came to the US from Wales. As there are a couple of places of that name near the Welsh/English border, this is certainly a possibility.

Telfermagne
03-08-2014, 09:35 PM
Sent bDNA another message about my missing raw data file. On the 27th of February they stated it would be uploaded within 24/48 hours. I called balls to that upon reading and was proven right by the wait that has brought me to the 8th of March. :P Not happy with bDNA right now.

VinceT
03-09-2014, 12:36 AM
It took about 3 to 4 weeks before they uploaded mine.

Telfermagne
03-09-2014, 01:55 PM
It took about 3 to 4 weeks before they uploaded mine.

Where did you access yours from? Was it emailed or in its own tab like the "genetic signature" tab?

VinceT
03-09-2014, 07:47 PM
"Raw YDNA" will appear below your ordered test.
1596

Telfermagne
03-10-2014, 06:12 PM
Finally got my raw data from bDNA.
Negative for CTS6498
Negative for S16136
Negative for S23540

GoldenHind
03-10-2014, 07:01 PM
Finally got my raw data from bDNA.
Negative for CTS6498
Negative for S16136
Negative for S23540

Exactly as I anticipated. Now we know for sure that you aren't one of the four DF99 included in the 2000 recently released Chromo2 results, as each of them was positive for at least one of those. So you are not part of Group A, mentioned above.

I would be willing to wager that, along with me and the Peruvian, you are part of Group B. I am told that none of the SNPs in Group B are included on the Chromo2 chip. I strongly suspect the Russian and the Scot will also be in Group B, as the four of us are the only DF99 identified so far who share the same unique STR signature.

I think the next step is to see if YSEQ might be interested in offering them.

Telfermagne
03-11-2014, 03:14 AM
To add, if I belong to group B (and likewise the Russian DF99) then we'd form our own sub-branch of group B while GoldenHind and the Scottish line form their own sub-branch of group B. The reasoning (this is contingent upon the accuracy of the TMRCA chart provided earlier in the thread and at the Russian molgen forum): all four of us as a whole have an alleged common ancestor at 69 generations. GoldenHind and the Scottish line have a common ancestor at 59 generations that is not shared with myself or the Russian. The Russian and I share a common ancestor at 48 generations that is not shared with GoldenHind or the Scottish line.

DF99 emerged then A & B. A emerged then A1 & A2. B emerged then B1 & B2. And a whole load of other sub-branches if one accepts that there's a new SNP ever 1.5 generations.

Telfermagne
03-11-2014, 03:35 PM
I've done an adjustment of the estimated time frame for a common ancestor for myself and the Russian DF99. Please point out any mistakes that I might have missed, am not the best at reasoning and figure the more eyes the better.

In the Occidental world an average generation is 20 to 30 years. The TMRCA chart demonstrates that the Russian DF99 and myself share a common ancestor 48 generations ago, i.e. that there was a common ancestor 48 generations before my birth and 48 generations before the birth of the Russian DF99. I do not know when the Russian DF99 was born, I only know when I was born, so the estimation is limited to the one side that I can provide. I was born in the year 1989 but close enough to January 1st, 1990 so that I might as well figure back from the year 1990.

The defined generation is the range 20 to 30 years. If a common ancestor lived 48 generations from my emergence, then that common ancestor lived 1,440 to 960 years before my emergence. 1,440 years before my emergence (1990) is the year 550 A.D., and 960 years before my emergence (1990) is the year 1030 A.D.

Now I ask, “what was going on in England and Russia from 550 A.D. to 1030 A.D.?”.

Webb
03-11-2014, 06:09 PM
I would say German incursions closer to 550 A.D., Viking incursions somewhere in the middle, and Norman incursions closer to 1030. The key probably being Viking as that would best explain a possible split, one group going to Britain and one group becoming the Rus in Russia. Just an opinion.

rms2
03-11-2014, 06:24 PM
. . .

Now I ask, “what was going on in England and Russia from 550 A.D. to 1030 A.D.?”.

Anything is possible, but if you want some support for the Viking idea, you will need to find some DF99 somewhere in Scandinavia. Time to recruit some Scandinavians and test them for DF99.

Webb
03-11-2014, 07:34 PM
Anything is possible, but if you want some support for the Viking idea, you will need to find some DF99 somewhere in Scandinavia. Time to recruit some Scandinavians and test them for DF99.

And that is a tough one as it seems testing is slow to catch on there. Germany, Scandinavia, France and Eastern Europe seems to be lagging behind in the curiosity department. I know France because of the whole lab procedure thing, but with the number of Americans claiming Scandinavian, German, and Eastern European origin I would hope the craze to find your origins would start to catch on.

rms2
03-11-2014, 08:11 PM
It can be done, but the interested parties will need some money to offer free tests. That is the only way, believe me.

GoldenHind
03-11-2014, 11:54 PM
The question of whether DF99 is present in Scandinavia, and if so, in what proportion, is an intriguing question. It is certainly a possibility. The Old Norway Project showed there was a large amount of P312* in the Norway coastal samples, with lesser amounts in Sweden. However that category also incorporated DF27(XSRY2627), DF19 and P312**(XDF99).

Recruiting people with Scandinavian ancestry is something I would very much like to do. Unfortunately, unlike the case with some other subclades, no one has come forward with an offer to finance "free" tests.

Another difficulty is the scarcity of people of Scandinavian Ydna ancestry in the FTDNA database. The last I looked, the number of those in the FTDNA database with Ydna ancestry from the British Isles and Ireland was around 75,000, while the total from Denmark, Sweden and Norway was around 5000. Secondly, current indications are that DF99 is a fairly rare group. It only accounts for .8% in the Netherlands study, and Holland is much richer in R1b than Scandinavia. So if one assumes DF99 is present in the same proportion of P312 in Scandinavia as in Holland, there might be only a couple of dozen DF99 out of those 5000. Not quite looking for a needle in a haystack, but not far removed.

Finally, likely candidates are not easy to identify. The Scandinavians don't seem to be the enthusiastic DNA testing junkies that are present in some other R1b subclades. Many of them have only 12 markers and have done no SNP testing. Unlike L238, it is extremely difficult to identify probable DF99 from 12 markers. Although there is a strong STR signature within DF99, it appears to only apply to a small portion of the subclade, and that requires 67 markers plus one from the 68-111 marker group to identify. The most I can say at this point is that the otherwise rare 389i=12 seems to be standard in DF99. However it is found, even if rarely, in other R1b subclades, so it is far from a sure bet. Still, if someone were to come forward with an offer to finance DF99 teats for Scandinavians who have 389i=12, I would be delighted to try to contact them.

There is a Norwegian who has a DF99 test pending. His results are due today. Based on his Geno 2 result and STRs, I think he has a better than 50/50 chance of getting positive results, but there is no guarantee. Also there is some question how long his ancestors have been in Norway.

Telfermagne
03-11-2014, 11:59 PM
Anything is possible, but if you want some support for the Viking idea, you will need to find some DF99 somewhere in Scandinavia. Time to recruit some Scandinavians and test them for DF99.

DF99 from Scandinavia is a must, I agree. If in the event DF99 doesn't turn up in Scandinavia I'm running some other options, among them is a medieval ancestor from the Low Countries, Anglo-Saxon can still be a possibility (there were Anglo-Saxons among the Varangian guard post-Norman invasion, just not as common as the typically thought of Kievan Rus).

Another option: Even though the ancestor seems to be medieval, the migration might not necessarily have had to been.
Medieval ancestor (let's say Northern Germany or Netherlands), sires a family that keeps reproducing over time but doesn't leave far from the point of origin. Then by the time of the early modern period there's a local cluster that's distantly related on the Y-Chromosome; the common ancestor is so far back that it's been forgotten about, the group considers its members as "non-family". One man from this group goes to England, for whatever reason (commerce, diplomacy, tourism, religious reasons related to Protestant Reformation etc.). Another man from this group goes to Russia for whatever reason (commerce, diplomacy, tourism, religious reasons related to Protestant Reformation e.g. Volga Germans etc.). Both lines emigrate and take up new residency at their respective destinations, the result is one English family and one Russian family with a common medieval ancestor from outside both England and Russia but are not necessarily connected to a medieval population movement.

GoldenHind
03-17-2014, 10:07 PM
Another DF99+ result this weekend. He has ancestry only to late 17th century Virginia, but presumably of English origin, though with a surname from a French personal name apparently introduced to England by the Normans. The surname is fairly widespread in England, though oddly seems to have its highest concentration in opposite ends of the country: Devon and Northumberland.

GoldenHind
04-05-2014, 07:45 PM
Two new DF99 results have come in.

The Norwegian, who believes his ancestor came to Norway as a Hugenot refugee in the 17C, tested negative.

The other tested positive. He does not have ancestry beyond the USA, but has an English surname, which according to the British surname profiler, had its highest concentration in the east Midlands in the 1881 census.

apmarkey
04-14-2014, 08:09 PM
hello,

I am also DF99+, my results just came in today. My STR values also match a Mer(c)kel, Miracle, Markel, among other variations, as well as a Long, who is a 67 match to a Fisher who is also DF99+. While my earliest known ancestor lived in Maryland, for all intents and purposes he may as well be considered Pennsylvania Dutch (Deutsch). I have come across several life events occurring at German Baptist churches, and many of his children migrated to parts of Pennsylvania for 2 to 3 generations

GoldenHind
04-14-2014, 11:44 PM
hello,

I am also DF99+, my results just came in today. My STR values also match a Mer(c)kel, Miracle, Markel, among other variations, as well as a Long, who is a 67 match to a Fisher who is also DF99+. While my earliest known ancestor lived in Maryland, for all intents and purposes he may as well be considered Pennsylvania Dutch (Deutsch). I have come across several life events occurring at German Baptist churches, and many of his children migrated to parts of Pennsylvania for 2 to 3 generations

There are a couple of more in that group who have DF99 tests pending. I have little doubt they all will test positive, although it is possible in R1b to have 67 marker matches between people of different subclades. Since some of this group are a GD of 6 at 67 markers to some of the others, I suspect their common ancestor lived in Germany some time prior to their coming to America.

Webb
04-15-2014, 03:01 AM
There are a couple of more in that group who have DF99 tests pending. I have little doubt they all will test positive, although it is possible in R1b to have 67 marker matches between people of different subclades. Since some of this group are a GD of 6 at 67 markers to some of the others, I suspect their common ancestor lived in Germany some time prior to their coming to America.

I think I might disagree with you on this one. All of my 37 marker matches are Z220 confirmed or have the distinguishing markers indicating Z220. If your snp is at least 2000 years old then there is a very good chance you match your 37 marker matches outside the genealogical time frame. These are important clues.

GoldenHind
04-15-2014, 06:23 PM
I think I might disagree with you on this one. All of my 37 marker matches are Z220 confirmed or have the distinguishing markers indicating Z220. If your snp is at least 2000 years old then there is a very good chance you match your 37 marker matches outside the genealogical time frame. These are important clues.

I'm not certain which of my two assertions you are disagreeing with, but I suspect the first.

1) It is possible in R1b to have a 67 marker match (by which I meant a GD of 8 or less at 67) with someone who is in a different R1b subclade. A number of people have reported this over the years.

2) Since a number of people in this group have different surnames and a GD of 6 or 7 at 67 markers from the others, it is likely their last common ancestor lived in Germany before these families emigrated to America. I gather that the MRCA of two people who are a GD of 6 at 67 markers might have lived as much as 24 or more generations ago. It appears that the ancestors of this group came to America from Germany in the early 18th century. So while it may not be impossible, I think the odds are against everyone in this group being the descendant of a single emigrant who lived 300 years ago.

EDIT: I have just checked on Ysearch, and one person in this group of DF99 Pennslyvania Dutch is a GD of 13 at 67 markers from one of the others, and a GD of 17 at 93 markers from another one.

Webb
04-15-2014, 07:13 PM
I'm not certain which of my two assertions you are disagreeing with, but I suspect the first.

1) It is possible in R1b to have a 67 marker match (by which I meant a GD of 8 or less at 67) with someone who is in a different R1b subclade. A number of people have reported this over the years.

2) Since a number of people in this group have different surnames and a GD of 6 or 7 at 67 markers from the others, it is likely their last common ancestor lived in Germany before these families emigrated to America. I gather that the MRCA of two people who are a GD of 6 at 67 markers might have lived as much as 24 or more generations ago. It appears that the ancestors of this group came to America from Germany in the early 18th century. So while it may not be impossible, I think the odds are against everyone in this group being the descendant of a single emigrant who lived 300 years ago.

EDIT: I have just checked on Ysearch, and one person in this group of DF99 Pennslyvania Dutch is a GD of 13 at 67 markers from one of the others, and a GD of 17 at 93 markers from another one.

Sorry I didn't clarify. I am disagreeing on the 67 marker match statement about having a GD of 6 or 7. I would imagine that if DF99 is greater than 2000 years old then most GD's up to 10 share a common ancestor at least back to 1000 A.D., give or take. I say this because, it would be worth it to contact those more distant matches to see if they would be willing to test for DF99. I am pretty passionate about this topic as the admin. for my surname project does not think anything outside the FTDNA calculated timeframe is useful. I have 22 matches at 37 markers with four different surnames. Again, they are all Z220. Two confirmed and the other two surnames have the three markers that typically defines this snp, and they are a 67 marker match with the second family. Wilder, Vander Hoeven, Robinson, and Holland. Robinson is not confirmed Z220, but matches me again at 67 with half of the 37 marker matched Wilder's. Holland matches Vander Hoeven at 67. Vander Hoeven is confirmed Z220. So you can see how important this clue is as it shows a split with the Dutch families of Holland and Vander Hoeven at around 1060, according to Mark Jost. It is also why I get passionate about the discussion of Flanders and the Flemish and how they relate to P312 and U106.

apmarkey
04-15-2014, 11:48 PM
I go from 200 matches at 12 markers, to 7 at 67, and 1 at 111 - a Merkel. There's nothing in between 12 and 67.

Telfermagne
04-16-2014, 02:36 PM
Got a message from BritainsDNA:



Dear Seth,
We are writing with an update on your Chromo2 YDNA results. The initial results from Chromo2 tests have allowed us to learn a huge amount, and using this new data, our geneticists have been able to extend and refine the subtypes on the Y chromosome tree. As a result of this ongoing research, we have upgraded approximately 250 Y-SNP markers to subtype status, adding further definition to many customers’ results.

As part of this work, we have been able to further define your YDNA subtype. Please note that your genetic signature may also have changed, as we have reviewed some Y-SNPs to improve the positive vs. negative allele clustering, and removed some Y-SNPs altogether, after discovering they were not working properly.

Your updated YDNA subtype and genetic signature are now available via your myDNA account. Please log in to view.

Best wishes,

The BritainsDNA Team

Seems that they finally accepted DF99/S11987 as a descendant of P312/S116. Nowt else has changed in the report except for this:


Subtype

Your subtype is R1b-S11987
Your S11987 subtype was recently discovered using Chromo2, so its distribution is not yet understood. You may carry markers that further define your subtype, but do not yet appear on our tree. You will find these in your genetic signature.

All the Regional Distribution ect. is reflective of the R-S116* result as opposed to the S11987 result.

GoldenHind
04-19-2014, 05:20 PM
Two new DF99 results came in, and both were positive. One has English ancestry in Kent. The other has ancestry only to early 18C Virginia, but with an English surname which seems to have its greatest concentration in East Anglia.

GoldenHind
04-25-2014, 07:17 PM
There is both good and bad news on the DF99 front.

The good news is that DF99+ results were posted to day for another person with Pennsylvania Dutch ancestry. This one has traced his ancestry to 17C Germany. There seems to be a number of people with similar surnames in the USA. I wonder if they are related to the German Chancellor?

The bad news is that DF99 is not included in FTDNA's new haplotree, which was released today. That will only make it even more difficult to persuade people to test for DF99. I'm not the slightest bit surprised, especially as the discovery DF99 was only announced last summer. It's not much of a consolation, but DF99 is not the only P312 subclade to be excluded from the new FTDNA tree.

GoldenHind
05-01-2014, 07:24 PM
The last of the pending DF99 orders for someone of Pennsylvania Dutch ancestry came in today, and, as expected, the results were positive.

I am only aware of one more pending order for DF99, from someone of Welsh ancestry who has the characteristic DYS389i=12. He has tested negative for all other currently known SNPs below P312. While to date this rare STR value appears to be modal for DF99, it does appear occasionally in other P312 subclades, so his result will be very interesting.

Telfermagne
05-02-2014, 12:24 AM
Seems if the PA Dutch trend continues we ought to be lookin' at some native born Alsatians and folks from the Rhineland-Palatinate for prospective candidates. It would be interesting to see how the British results fit in with the PA Dutch over time.

GoldenHind
05-09-2014, 10:45 PM
The bad news is that DF99 is not included in FTDNA's new haplotree, which was released today. That will only make it even more difficult to persuade people to test for DF99. I'm not the slightest bit surprised, especially as the discovery DF99 was only announced last summer. It's not much of a consolation, but DF99 is not the only P312 subclade to be excluded from the new FTDNA tree.

I have emailed FTDNA to request they add DF99 to their new tree, pointing out that there are now 18 individuals who have tested positive for it and that it has been on the ISOGG tree for several months. Since it's discovery was only announced last August, and that FTDNA only began offering it last November, it is probably not too surprising that they overlooked it. However its omission from the tree will obviously be a hindrance to encouraging new people to order it.

They responded that they are aware of "certain differences" between their new tree and that of ISOGG, and that my request had been forwarded to their "Ytree team for their consideration." Considering what a mess their new tree is, I expect their team will have their hands full for some time.

I did the same for L238, with the same response. However, unlike DF99, L238 has been known for at least four years.

GoldenHind
05-10-2014, 06:20 PM
I am only aware of one more pending order for DF99, from someone of Welsh ancestry who has the characteristic DYS389i=12. He has tested negative for all other currently known SNPs below P312. While to date this rare STR value appears to be modal for DF99, it does appear occasionally in other P312 subclades, so his result will be very interesting.

The person with Welsh ancestry I mentioned above received his DF99 result today in a remarkably fast turn around, and his result was positive. This is the first DF99 in Wales or even in the western portion of Britain.

I am not aware of any further DF99 orders pending at the moment.

GoldenHind
05-17-2014, 06:23 PM
Some good and bad news on the DF99 front.

In checking today, I was astonished to see that FTDNA has added DF99 to their new tree! However they are not classifying it as a terminal SNP, and DF99+ individuals are still classified as P312 for their terminal SNP.

Although they seem to have positioned it accurately, they are recommending DF99+ individuals order L238. Apparently they have't yet worked out that DF99 and L238 are parallel SNPs and mutually exclusive.

Still, I suppose it is progress of a sort.

jdean
05-18-2014, 02:44 PM
Marvelous news, even with the slight glitch which I'm sure will be fixed shortly.

Well done !!!

Also this gives me real hope that DF49 and Z2961 will be added in the not too distant future, they are considering the case at the moment.

Anybody know if DF27 has been brought up yet ?

Stephen Parrish
05-18-2014, 03:37 PM
Marvelous news, even with the slight glitch which I'm sure will be fixed shortly.

Well done !!!

Also this gives me real hope that DF49 and Z2961 will be added in the not too distant future, they are considering the case at the moment.

Anybody know if DF27 has been brought up yet ?

DF27+ has not appeared yet.

Stephen

apmarkey
05-18-2014, 08:26 PM
I notice the other DF99+ kit in my 67 marker matches has his terminal listed as DF99. however mine is still P312. but progress still.

GoldenHind
05-20-2014, 05:42 PM
I notice the other DF99+ kit in my 67 marker matches has his terminal listed as DF99. however mine is still P312. but progress still.

On checking, i noticed that another of your 67 marker matches who has tested DF99+ has his terminal SNP listed as M269. Progress seems to come in extremely small steps.

GoldenHind
06-11-2014, 01:29 AM
Some bits of news on the DF99 front.

First results have come in for someone with ancestry from Cornwall who had previously tested negative for all other known P312 subclades. He is DF99- as well, so now joins the list of those who are P312**- i.e. negative for all known P312 subclades. This is a fairly substantial group, and is almost entirely, with a couple of exceptions, of British origin. Many of them are of Welsh or Scottish origin. There is no doubt that there is still a large group of P312 whose subclade has not yet been discovered, or if it has, is being kept private.

Secondly DF99 has been ordered by someone with ancestry dating to the 16th century in the Zurich area of Switzerland. I have virtually no doubt his results will be positive.

Finally it has been brought to my attention that due to some technical glitch at FTDNA, it is difficult if not impossible, at least for some people, to order DF99 from their FTDNA personal haplotree page. I have brought this to FTDNA's attention, and they tell me, perhaps not surprisingly, that they are flooded with emails at the moment, so it will be some time before they can look into this. I have sent out a large number of emails to numerous people urging they test for DF99, and this has resulted in very few orders. I wonder if these technical difficulties are at least in part responsible for the poor response?

GoldenHind
06-27-2014, 12:27 AM
Three DF99 test results have come in recently, all negative. Two were of Iberian origin, and had already tested DF27+, so the DF99- result was no surprise. They fell prey to the omission of DF27 from FTDNA's new tree, and followed their recommendations for testing DF99.

The third is an American with a likely Scottish surname. He has tested negative for everything now except DF27 and L238. Based on his markers, he is highly unlikely to be L238+..

Telfermagne
06-27-2014, 02:34 AM
FTDNA seems to have gone to hell in a hand basket. The omission of DF27 on their tree is inexcusable, plus they're still dropping the ball in terms of assigning terminal SNP. Still showing P312 as terminal SNP despite a DF99+ result being indicated by a green colored DF99 and a DF99+ in the SNP list. I've attempted to contact FTDNA repeatedly to no avail. It is understandable that providing a resource like this is a difficult task (the union of marketing, scientific analysis, & administration), however some of these issues can be solved by merely paying attention to detail. It's not like folks are suggesting convoluted conclusions with questionable premises, the suggestions are closer to 4 follows from the addition of 2 and 2. Mayhaps if they spent less time with playing the commercial, seminar & conference end, and focused more on the science end things would get done.

It's not like the enterprise is McDonalds, this is a specialized hobby so inherently it will not attract the same quantity customer base as more common marketplace items. FTDNA needs to focus on satisfying its legitimate customers rather than attempting to play the used car lot salesmen angle.

GoldenHind
06-27-2014, 05:53 PM
FTDNA seems to have gone to hell in a hand basket. The omission of DF27 on their tree is inexcusable, plus they're still dropping the ball in terms of assigning terminal SNP. Still showing P312 as terminal SNP despite a DF99+ result being indicated by a green colored DF99 and a DF99+ in the SNP list. I've attempted to contact FTDNA repeatedly to no avail. It is understandable that providing a resource like this is a difficult task (the union of marketing, scientific analysis, & administration), however some of these issues can be solved by merely paying attention to detail. It's not like folks are suggesting convoluted conclusions with questionable premises, the suggestions are closer to 4 follows from the addition of 2 and 2. Mayhaps if they spent less time with playing the commercial, seminar & conference end, and focused more on the science end things would get done.

It's not like the enterprise is McDonalds, this is a specialized hobby so inherently it will not attract the same quantity customer base as more common marketplace items. FTDNA needs to focus on satisfying its legitimate customers rather than attempting to play the used car lot salesmen angle.

FTDNA seems to be completely overwhelmed by the multitude of problems caused by the adoption of their new tree.

There are now 19 people in the P312 Project who have tested DF99+. I believe all but one of them have had their DF99+ result from a test done with FTDNA. Yet only five of this group have been given DF99 as a terminal SNP by FTDNA. Nine are still classified as P312, and another five as M269. The reasons for the difference in treatment are inexplicable to me.

I have also recently been informed that an L238+ person contacted FTDNA to ask them to change his P312 classification. He received his L238+ result from another genetic testing company, so perhaps that might seem understandable. They suggested he confirm his L238 status by ordering it from FTDNA. He then pointed out to them that his L238+ result was confirmed in his Big Y results. At last report, FTDNA is still refusing to budge.

Telfermagne
06-30-2014, 02:23 AM
Stunned to see that FTDNA finally corrected my Y page to R-DF99.

GoldenHind
07-06-2014, 06:13 PM
Some bits of news on the DF99 front.



Secondly DF99 has been ordered by someone with ancestry dating to the 16th century in the Zurich area of Switzerland. I have virtually no doubt his results will be positive.



The results have come in for the person with ancestry dating back to the 16th century in the Zurich area, and as expected, they were positive.

R.Rocca
07-08-2014, 01:28 AM
The Big-Y results are now complete for the following DF99+ kit:

Kit no. 323935, Francesco Canato, Vicenza, Veneto, Italy

GoldenHind
07-09-2014, 05:18 PM
The Big-Y results are now complete for the following DF99+ kit:

Kit no. 323935, Francesco Canato, Vicenza, Veneto, Italy

He is now the third known DF99 in Italy, along with one from Liguria and an anonymous one from Tuscany from the 1KG project. I wonder if it is a coincidence that all three are from the north of Italy, or whether it will be found in other parts of Italy as well? It is beginning to look like a pattern.

I have checked his markers and saw that he has no matches above 12 markers. He does have the characteristic 389i=12, found in nearly all DF99+ whose markers are known, as well as 391=10, a not uncommon pattern in DF99, but one which is found in other P312 subclades as well.

EDIT: I checked the genetic distance between him and the DF99 from Liguria: GD 27 at 67 markers. Obviously they are not closely related. I suppose there are a number of possible explanations why this is the case.

R. Walker
07-10-2014, 02:57 AM
Thanks GoldenHind, I have been lurking here. (Ligurian's sister) FTDNA still has him as R-P 312. Even though it has been over 6 months since his DF99 results came back. Glad you are following all this.

Telfermagne
07-11-2014, 12:55 PM
On Y-Full it looks like there's four small subgroups of DF99, I'm curious who all offers these branches. If I recall right BritainsDNA's Chromo2 has 2 of them (I turned out to be negative for the ones that Chromo2 tests for).

http://www.yfull.com/tree/R1b1a2a1a2f/

YF01806 n/a new
NA20783 TSI

And

HG02008 PEL
YF01418 n/a

GoldenHind
07-13-2014, 08:57 PM
On Y-Full it looks like there's four small subgroups of DF99, I'm curious who all offers these branches. If I recall right BritainsDNA's Chromo2 has 2 of them (I turned out to be negative for the ones that Chromo2 tests for).

http://www.yfull.com/tree/R1b1a2a1a2f/

YF01806 n/a new
NA20783 TSI

And

HG02008 PEL
YF01418 n/a

Actually what is represented here is the two different branches of DF99. See my post #175 on page 18 of this thread.

HG02008 is the anonymous DF99 from Lima, Peru in the !KG project. YF01418 is a submission to Yfull of the results of a DF99 test with FullGenomes, (namely mine). Yfull has spotted three SNPs in common in these two samples, which they label Y-2832, Y2833 and Y2834.

NA20783 is the anonymous DF99 from Tuscany and YF01806 is another DF99 who has submitted his FullGenomes results to Yfull for analysis. Neither sample has any of the three SNPs mentioned above. Apparently they have yet to spot nine SNPs shared by these two samples, but not found in either of the first two mentioned above. Two of the nine are S16136 and S23540, which are included in the Chromo 2 test. Three of the four anonymized DF99s in the data released from the Chromo 2 were positive for these two SNPs. (Information from Greg M of FullGenomes). We don't know if the fourth is positive for any of the three SNPs in the first branch, because they aren't tested in Chromo 2.

I am not aware of any company which is offering testing for any of these SNPs below DF99 on an a la carte basis. If anyone knows otherwise, I would be grateful to hear about it.

It looks to me like DF99 divided into at least two branches at a very early date.

GoldenHind
07-17-2014, 12:56 AM
The map of DF99 with known ancestry in Europe on the P312 and Subclades Project shows what appears to be something of a pattern. It begins in the Scotland in the north, then runs down the eastern portion of England (though there is one in north Wales), then crosses the channel near the Rhine, proceeding down the Rhine to Switzerland, and finally jumping across the Alps to northern Italy.

This pattern is reinforced by other evidence. We known from the Genes of the Netherlands project that DF99 is present in that country. There are several DF99 who are of Pennsylvania Dutch origin, but don't have an ancestral location beyond the USA. However it is known that the bulk of those settlers came from the old Rhineland Palatine area, which formerly was much larger than the present German state of Rheinland-Pfalz. There are also several DF99 with presumed English origins, and some of them have surnames which are regional in England, with a location in the area of East Anglia, the East Midlands and the home counties.

I tried to post a copy of the map here, but it is beyond my technical capabilities. Perhaps someone more adept than myself could do so.

I emphasize that this data is preliminary, and I certainly wouldn't suggest that DF99 didn't spread beyond this area. The DF99 from Moscow is certainly proof of that. We have no idea how far west and east, north or south the subclade will be found. However I suspect that this pattern isn't merely coincidental.

Telfermagne
07-17-2014, 11:33 AM
Later on I can get the map posted here, I've been tryin' to get a group MRCA done so far it's lookin' close to what MitchGlitch yielded (roughly 137 generations, coincides with the Chalcolithic). If the distribution clues keep piling up in line with the current pattern I'd start lookin' into what common population(s) there were between the Alps, Rhine, and Britain during the Chalcolithic.

For the Russian, I find it interesting that all the estimates for TMRCA continue to put a hypothetical common ancestor between him and myself around 52 generations ago. At first I thought MitchGlitch might have been underestimating until I made an average between the various TMRCA estimates and got 52.2758621 generations (approx 384 A.D. to 635 A.D.). I'd presume that it's likely that the Russian is ultimately of Western origin, so I'd have to ask myself what Western populations were in contact with Russians during the early middle ages?

To get the TMRCA I did the following:

TMRCA A (incl. multicopy markers): 42.204568 generations
TMRCA B (excl. multicopy markers): 33.9174675 generations (outlier, so excluded from average)
TMRCA Ca (incl. multicopy markers): less than 45.5 generations (91 Tr. Event) to 58.5 generations (117 Tr. Event)
TMRCA Cb (excl. multicopy markers): less than less than 43 generations (86 Tr. Event) to 57 generations (114 Tr. Event)
TMRCA Da MLTMRCA (incl. multicopy markers): 59 generations
TMRCA Db MLTMRCA (excl. multicopy markers): 53 generations
TMRCA E: 48 generations

Set of numbers (excl. outlier): [45.5, 46, 46.5, 47, 47.5, 48, 48.5, 49, 49.5, 50, 50.5, 51, 51.5, 52, 52.5, 53, 53, 53.5, 54, 54.5, 55, 55.5, 56, 56.5, 57, 57.5, 58, 58.5, 59]

29 #s total. Sum = 1516. Mean = 52.2758621. Range = 13.5. Minimum = 45.5. Maximum = 59.

Scratchwork:

According to Dr. Kenneth Nordtvedt, MLTMRCA = n/2M. The variable (n) is the genetic distance between two samples. The variable (M) is the total of marker mutation rates. We have tested for 76 of the same Y-STRs, and I will be doing two calculations. Calculation A will not exclude multicopy markers and Calculation B will exclude multicopy markers.

TMRCA A:
(n): 60 out of 76 Y-STR values are identical. 15 out of 16 differentiating markers are one step differences and 1 out of 16 differentiating markers is a 2 step difference. The genetic distance is therefore a value of 17, and as such (n) = 17.

(M): Example - “M would be total mutation rate for your 76 markers. Just as an example, let's say average marker had mutation rate of 1/304. Then M = 76 times 1/304 = 1/4 = 0.25” (Nordtvedt). Now, at 67 Y-STRs the rate per marker is 0.0028 (McDonald). At 118 Y-STRs the rate per marker is 0.0025 (McDonald). Since the number of STRs in my case is not precisely 118 or 67, yet rests in between those values, I will use an average rate per marker for my calculation which is 0.00265. (M) = 76/1 * 0.265/100 = 20.4/100 = 0.2014.

Since MLTMRCA = n/2M, MLTMRCA = 17/2*0.2014 = 17/0.4028 = 42.204568 generations.

TMRCA B:
(n): After excluding multicopy markers there remains 58 Y-STR values. 47 out of 58 Y-STR values are identical. 10 out of 11 of the differentiating markers are one step differences and 1 out of 11 of the differentiating markers is a 2 step difference. The genetic distance is therefore a value of 12, and as such (n) = 12.

(M): Since the total number of markers is less than 67, but greater than 37 an average between the Y-37 and Y-67 rates per marker will be used. At 67 Y-STRs the rate per marker is 0.0028 (McDonald). At 37 Y-STRs the rate per marker is 0.0033 (McDonald). The average mutation rate is then 0.00305. (M) = 58/1 * 0.305/100 = 17.69/100 = 0.1769.

Since MLTMRCA = n/2M, MLTMRCA = 12/2*0.1769 = 12/0.3538 = 33.9174675 generations.

TMRCA Ca&Cb:
Using: http://dna-project.clan-donald-usa.org/tmrca.htm

*Note the utility yields the number of Transmission Events along with the cummulative probability that the number of transmission events is less than a certain value (McDonald 2014). The number of Transmission Events is twice the number of generations (McDonald 2014). So, to get the number of generations divide the number of Tr. Event by 2.

Incl. Multicopy Markers - When looking at cummulative probabilities of 80% or greater, the TMRCA is a span of less than 45.5 generations (91 Tr. Event) to 58.5 generations (117 Tr. Event).
Excl. Multicopy Markers - When looking at cummulative probabilities of 80% or greater, the TMRCA is a span of less than 43 generations to 57 generations.

TMRCA Da&Db:
http://www.dnacalculator.org/tmrcaCalculator.php

TMRCA E:
MitchGlitch who yielded a value of 48 generations.

Telfermagne
07-17-2014, 01:08 PM
I've attached the map of current Old World DF99 distribution. If the Chalcolithic group TMRCA holds out as more positive lineages are found, and later distribution follow the current beginnings of a pattern, then it seems that R-DF99 coincides a bit with the Rhine-Dutch-Austrian Beaker movement (even though there's overlap between beaker movements as of now I doubt maritime since there's not yet been a native Iberian DF99, the only Iberian has been from a Flemish merchant family).

An overlay of the DF99 map from FTDNA and a Beaker culture diffusion map has also been attached to this message.


The original beaker diffusion map:
http://upload.wikimedia.org/wikipedia/commons/thumb/2/22/Beaker_culture_diffusion.svg/383px-Beaker_culture_diffusion.svg.png

GoldenHind
07-17-2014, 11:53 PM
Perhaps I should emphasize that the DF99 data is still very preliminary. Next month will be the one year anniversary of the discovery of DF99, and it was some time after that FTDNA began offering testing for it. There is a great deal of catching up with the other P312 subclades needed. Thus any discussion should be regarded as somewhat speculative.

I have also noticed a possible correlation between the currently known distribution DF99 and the Rhenish Beakers. By this I only mean to say that DF99 might have been an element in the Rhenish Beakers. As for the Beaker map, there is one in Jean M's book Ancestral Journeys (at p.159) which has a number of important differences. For instance she shows Rhenish Beakers spreading into northern Jutland and southern Norway. It looks like she characterizes the Beakers on the upper Rhine, where it looks like DF99 certainly is present, as Eastern rather than Rhenish.

However it would be truly remarkable if DF99 remained largely in place without being dislodged by the various movements of peoples during the Migration Age. Many have suggested a likely Rhenish Beaker origin for L21, arguing that they were largely displaced by the intrusion of various Germanic tribes following the collapse of the Roman empire. In Britain L21 appears to be concentrated in the west. Again it has been suggested that they were pushed westwards by the Anglo-Saxons. Based on current data, this doesn't appear to be the case with DF99. Even at this preliminary point, I would have to say that the distribution of DF99 is considerably different than that of L21, although L21 is so widespread there is obviously some overlap. It seems to me that one or the other must be incorrect as a model for Rhenish Beakers.

rms2
07-19-2014, 12:51 PM
I think one of the reasons Jean Manco and others have suggested Rhenish Beaker as the main source of L21 in the Isles, as opposed to Iberian Beaker, is the relative scarcity of DF27 in the Isles. Another reason, of course, is the presence of Rhenish Beaker artifacts in the Isles, which identifies it as the main source of Beaker there. A third reason is the connection some scholars, like David Anthony, have made between Beaker and Italo-Celtic languages.

In the Isles L21 is obviously concentrated in the West, but there is really no place in the Isles where L21 is not very frequent. Its ebb frequencies do in fact occur in the places in SE England most heavily settled by the Anglo-Saxons, but even there it runs around 15%. The relative distributions of L21, U106, and I-M253 in the Isles do seem to strongly suggest that the latter two advanced in what became England at the expense of L21. If one substitutes the term "Anglo-Saxons" for U106 and M253, and "Britons" for L21, their relative distributions make pretty convincing historical sense.

IMHO, prior to the arrival of the Anglo-Saxons, mainly in the immediate post-Roman Period, L21 was as frequent in what is now England as anyplace else in the Isles, or nearly so.

It is interesting to follow the progress of DF99. Honestly, I'm not sure what to make of it thus far. I like what Telfermagne has done with his maps, and I think Beaker is a good guess, but then I think I see a general connection between P312 as a whole and the Beaker Folk.

R.Rocca
07-19-2014, 01:56 PM
When we take testing bias into account (75K FTDNA Y-DNA customers from the Isles), it could be that DF99 didn't play an important role in any of the early P312 migrations into Britain. Considering that four continental samples are now close to the Alps, perhaps we need to consider a frequency peak and possibly an origin there with a very mild expansion afterwards. I don't think Swiss, Austrian and northern Italian FTDNA kits even add up to 5K samples.

Telfermagne
07-19-2014, 03:21 PM
When we take testing bias into account (75K FTDNA Y-DNA customers from the Isles), it could be that DF99 didn't play an important role in any of the early P312 migrations into Britain. Considering that four continental samples are now close to the Alps, perhaps we need to consider a frequency peak and possibly an origin there with a very mild expansion afterwards. I don't think Swiss, Austrian and northern Italian FTDNA kits even add up to 5K samples.

That's what I'm thinking too, DF99 was bound to be found in some British Isles samples because of the sheer numbers of test subjects with origins there. I think that it is important to track the current continental numbers, with how comparatively few test subjects there are from outside of the Isles the number of continental DF99 is rivaling the Isles DF99 which leads me to think that as time goes on and more folks from the Alps & Rhine and such test there's going to eventually be more Alpish & Rhenish DF99 than British.

rms2
07-19-2014, 04:30 PM
Honestly, it occurs to me that DF99 looks like it could have traveled with L2 and in the British Isles have been part of the Belgic incursions and settlements that occurred in about the 1st century BC. That would explain its current scarcity in western Britain and in Ireland, its presence among Dutch and Belgians, and its presence in the neighborhood of the Alps.

Of course, Goldenhind is right to caution that not enough is known about DF99 yet.

Telfermagne
07-19-2014, 05:33 PM
Good catch! It would be interesting to see how this all plays out, I think we'll be waiting quite the long while since we're a very obscure clade and deep-Y testing isn't very popular in the market (most folks seem interested in FF/RF autosomal).

castle3
07-19-2014, 06:20 PM
I was assigned a Beaker Folk ancestry a while ago by BritainsDNA. I'm DF99-. Like Telfermagne, I also noticed the Beaker Folk hot-spot over what was, in Medieval times, part of Flanders. Research suggests that people bearing my surname lived cheek-by-jowel with Flemings in Cumbria in the 13th C. I've also found several examples of Flemings being recorded as Normans - despite some original docs naming them as Flemings!
Anyway, great thread.
Cheers,
Bob

GoldenHind
07-19-2014, 06:59 PM
When we take testing bias into account (75K FTDNA Y-DNA customers from the Isles), it could be that DF99 didn't play an important role in any of the early P312 migrations into Britain. Considering that four continental samples are now close to the Alps, perhaps we need to consider a frequency peak and possibly an origin there with a very mild expansion afterwards. I don't think Swiss, Austrian and northern Italian FTDNA kits even add up to 5K samples.

If I had to guess, and I emphasize this is highly speculative in the face of very preliminary data, I would suggest a possible origin or at least an expansion point somewhere along the upper Rhine. I would not be a bit surprised if the greatest concentration (such as it is) turns out to be somewhere along the central Rhine. There is pretty good evidence that to date DF99 has one of its strongest points among early German settlers to America, such as the Pennsylvania Dutch. Most of these people are said to have come from the old Palatine area along the Rhine, an area considerably larger than the current German state of Rheinland-Pfalz, which even included part of present day Alsace. What I don't know is whether this group comprises a disproportionate part of the Germany database in FTDNA, and if that is the case, whether DF99 would be found at similar levels in other parts of Germany.

GoldenHind
07-19-2014, 07:03 PM
Honestly, it occurs to me that DF99 looks like it could have traveled with L2 and in the British Isles have been part of the Belgic incursions and settlements that occurred in about the 1st century BC. That would explain its current scarcity in western Britain and in Ireland, its presence among Dutch and Belgians, and its presence in the neighborhood of the Alps.

Of course, Goldenhind is right to caution that not enough is known about DF99 yet.

Can anyone comment on the distribution of L2 in Britain?

alan
07-19-2014, 07:26 PM
My rule of thumb if you want to compare frequency fairly with the continent in hobby databases I notionally keep the continental number as it is and divide the isles one by 100. I am not saying that is accurate but its a lot close to the truth than just looking at the databases and ignoring the gigantic isles bias. The isles sampling is so big that it can easily pick up a few individual of any y line even if they are a just a fraction of one percent.


That's what I'm thinking too, DF99 was bound to be found in some British Isles samples because of the sheer numbers of test subjects with origins there. I think that it is important to track the current continental numbers, with how comparatively few test subjects there are from outside of the Isles the number of continental DF99 is rivaling the Isles DF99 which leads me to think that as time goes on and more folks from the Alps & Rhine and such test there's going to eventually be more Alpish & Rhenish DF99 than British.

razyn
07-19-2014, 08:29 PM
I think one of the reasons Jean Manco and others have suggested Rhenish Beaker as the main source of L21 in the Isles, as opposed to Iberian Beaker, is the relative scarcity of DF27 in the Isles.

This sort of thinking -- and I'm not sure if it's really Jean's, or even yours -- is predicated on a projection backward in time of the modern (high) frequency of DF27 in Iberian populations. However, it looks to me as if a great deal of that frequency consists of young subclades of DF27. I don't think there's yet much justification for thinking DF27 was any stronger in Iberia than anywhere else in Europe, at the time of the Beaker [complex of things that last a long time underground] blossoming, say 4.5 kybp. Some DF27 subclades have had a good breeding-of-sons record in Iberia since, roughly, the 8th century AD. Prior to that, I don't think we know. Some of the male Beaker folk may have been DF27 -- and/or vice versa... It's more complicated, and more interesting, than any map of it you've seen yet.

And I realize that does not on the face of it appear to be about DF99. Just responding to it here because I see it here.

Jean M
07-19-2014, 08:55 PM
When we take testing bias into account (75K FTDNA Y-DNA customers from the Isles), it could be that DF99 didn't play an important role in any of the early P312 migrations into Britain.

I agree entirely.


Honestly, it occurs to me that DF99 looks like it could ... have been part of the Belgic incursions and settlements that occurred in about the 1st century BC. That would explain its current scarcity in western Britain and in Ireland, its presence among Dutch and Belgians, and its presence in the neighborhood of the Alps.

There are problems with a link to the Belgae. The Belgae count as a considerable incursion into the Isles (most probably the Fig Bolg in Ireland were Belgae). They had no special dispensation from the incoming Anglo-Saxons to remain in position in southern England. On the contrary they were most likely among the crowd described by Gildas fleeing west or overseas. Nor do I know of any particular link between the Belgae and the Alps. Maybe I have missed something there.

On the present pattern described above (which I realise is very preliminary), DF99 looks like the descendants of a Celt who happened to be part of the fusion that created the Jastorf Culture. He could have been an iron-worker who saw an eager market. Just guessing. If his descendants chose to remain in the rump of the Proto-Germanic community which developed West Germanic, the present pattern can be explained.

Jean M
07-20-2014, 12:11 AM
Of course there are other possible scenarios, one of which GoldenHind hinted at i.e. entry into Scandinavia with Bell Beaker. Lack of it in Scarndinava now would not rule that out, given the fact that there was an exodus from Scandinavia to Jastorf due to climate change.

Telfermagne
07-20-2014, 03:01 AM
I just realized something with the TMRCA averages I'm working on, when getting the "average" I forgot to consider the probabilities for each generation on the individual to individual comparison. So the average I presented is non-weighted, which it shouldn't be (or so I think atm; the "event" with the higher probability ought to contribute more towards the average than the "event with the lower probability).

Webb
07-20-2014, 03:45 AM
You are correct. There was a Flemish contingent with the Norman army. They were led by William's son, whose mother was the Duchess of Flanders. We tend to get wrapped up with the modern relationship of Flanders with the Netherlands and in actuality the Dukes of Flanders trace their line back to the Franks.

Webb
07-20-2014, 03:55 AM
Sorry, my above post was in reply to Bob's further above post. I hit the wrong butto. Button, sheesh.

Jean M
07-20-2014, 11:11 AM
For the Russian, I find it interesting that all the estimates for TMRCA continue to put a hypothetical common ancestor between him and myself around 52 generations ago. ... (approx 384 A.D. to 635 A.D.). I'd presume that it's likely that the Russian is ultimately of Western origin, so I'd have to ask myself what Western populations were in contact with Russians during the early middle ages?


The common ancestor does not have to be a person who was in contact with Russians. He just has to have a descendant at some point who moved to Russia. Lots of Germans did so in the 18th century.

R.Rocca
07-20-2014, 12:37 PM
Of course thee are other possible scenarios, one of which GoldenHind hinted at i.e. entry into Scandinavia with Bell Beaker. Lack of it in Scandinavia now would not rule that out, given the fact that there was an exodus from Scandinavia to Jastorf due to climate change.

Any exodus would have affected all P312 equally and yet we still find other clades in Scandinavia, so I don't think I see this as a viable scenario (yet).

Jean M
07-20-2014, 12:54 PM
Any exodus would have affected all P312 equally and yet we still find other clades in Scandinavia, so I don't think I see this as a viable scenario (yet).

I understand perfectly. I agree with you if it turns out that DF99 is a large clade which would have had many members scatted through the Jastorf Culture. In that case we would expect some of them to have moved north into Scandinavia as farming became viable there once more. So we would find DF99 among the North Germanic speakers, as well as the West Germanic.

What we seem to have at the moment is West Germanic only. That suggests to me a small clade.

Telfermagne
07-20-2014, 01:53 PM
The common ancestor does not have to be a person who was in contact with Russians. He just has to have a descendant at some point who moved to Russia. Lots of Germans did so in the 18th century.

It's not likely that we'll get a complete answer about the Russian's origins. Another scenario involves what I've been able to gather since the time I've found out about the match a year or so ago:

1.) The person himself claims an earliest known ancestor in 15th Century Moscow, but this is contested.
2.) The general consensus among members on a relevant Russian board is that his branch is not of the legitimate branch of that family-name.
3.) A particular member, the manager of the kit, mentioned that in the 1730's a non-paternal event occurred, causing another genetic-schism in the family. This interloper I'd suspect is German, or English.

My previous response on the matter was presenting just one alternate case, of other options, on the chance that no one has any idea what is actually going on with this family (I have a habit of using stronger language than what actually represents my beliefs, but I figure to go with just gettin' the junk out into written form quickly then get back to whatever else I want to do; representing full agnosticism can be a lengthy verbal process. "Is maybe might be also kind of happen to be this sometimes but might not always" vs. "is or is not"). Some of the other options have been stated here on this board, others in private email correspondences. Right now I don't feel up to consolidating all that has been said on this particular matter.

Jean M
07-20-2014, 03:45 PM
My previous response on the matter was presenting just one alternate case, of other options, on the chance that no one has any idea what is actually going on with this family (I have a habit of using stronger language than what actually represents my beliefs, but I figure to go with just gettin' the junk out into written form quickly then get back to whatever else I want to do; representing full agnosticism can be a lengthy verbal process. "Is maybe might be also kind of happen to be this sometimes but might not always" vs. "is or is not").

I know what you mean. :) Don't worry. I didn't intend to come across as criticizing. I'm only on this thread because my name came up.

GoldenHind
07-20-2014, 05:44 PM
Of course thee are other possible scenarios, one of which GoldenHind hinted at i.e. entry into Scandinavia with Bell Beaker. Lack of it in Scarndinava now would not rule that out, given the fact that there was an exodus from Scandinavia to Jastorf due to climate change.

There are some indications that DF99 may be present in Scandinavia. The problem is that DF99 is relatively rare everywhere, and the Scandinavian database at FTDNA is comparatively small. I have identified a small number of Scandinavians whose markers suggest there is a good chance that they may be DF99. Unfortunately, in most cases, it is not possible to confidently predict DF99 status from STR markers alone. There is someone of Norwegian ancestry who is a good candidate, but he never responded to an offer of a free DF99 test. I have also identified a couple of likely DF99 people of English ancestry whose surnames derive from Scandinavian personal names, such as Osborn from Asbjorn and Haldane from Halfdan. The evidence is hardly conclusive, but the possibility remains open.

GoldenHind
07-20-2014, 05:57 PM
The common ancestor does not have to be a person who was in contact with Russians. He just has to have a descendant at some point who moved to Russia. Lots of Germans did so in the 18th century.

Here is an interesting phenomena which needs to be considered. Telfermagne and I have earliest known ancestors, long before the Industrial Revolution, in neighboring counties in England (Yorkshire and Nottinghamshire). Yet both of us are a closer genetic distance to the Russian than we are to each other.

Incidentally, I think there is no chance that DF99 will turn out to be a large clade, at least when compared with L21, U152 and DF27. I do think it is possible that it will turn out to be more numerous than L238 though.

Telfermagne
07-20-2014, 06:24 PM
Has anyone been able to find a step by step tutorial on calculating group genetic distance (more than two individuals)? I've found bits and pieces but am having trouble figuring out the N value for TMRCA = N/M where N = variance from the modal and M = mutation rate per marker. I know there's calculators that do group TMRCA but I want to try it by hand to double check the calculators.

I'm trying to use Nordtvedt's "sum of marker variances = M G, where M = sum of marker mutation rates and G = TMRCA in generations (Nordtvedt 2008). Therefore G = the sum of marker variances divided by the sum of marker mutation rates."

Nordtvedt, Kenneth. 2008. Re: [DNA] TMRCA formula. Post #2. URL: http://archiver.rootsweb.ancestry.com/th/read/GENEALOGY-DNA/2008-04/1208981125

I'm going to use the TMRCA that MitchGlitch yielded over at http://forum.molgen.org/ and use Nordtvedt's "sum of marker variances = M G" then try various guesses at getting an N value and compare against that value gotten from MitchGlitch's G value then use that new N value to get a TMRCA to compare against the one suggested by MitchGlitch.

EDIT:

NVM I think I can use Excel's VARP function to get N. Since I'm stuck with Chromebook I'll have to do this by hand, if I'm right it should be (number - AVERAGE(number1,number2,...))^2/n

http://www.ehow.com/how_2105535_use-excels-varp-function.html

NVM again, I think Googlesheets can do VARP. Gonna try this out.

Telfermagne
07-20-2014, 11:01 PM
I've been havin' some crap luck with group TMRCA without the use of the various calculators. I'm not sure of what my error is so I'm posting my scratchwork here for review:


According to Dr. Kenneth Nordtvedt the sum of marker variances = M G, where M = sum of marker mutation rates and G = TMRCA in generations (Nordtvedt 2008). Therefore G = the sum of marker variances divided by the sum of marker mutation rates. The calculation is considering only the 67 Y-STRs that all 19 individuals have had tested (some have tested as many as 111 Y-STRs). Since there are 67 Y-STRs being compared, the mutation rate per marker will be 0.0028 (McDonald).

Finding (N): N = the sum of marker variances. Var(x) = Σx2p − μ2

Probability = probabilities here are always between 0 and 1, and reflect how often a marker is expected to change if I am not mistaken. This seems synonymous with mutation rate per marker. Therefore, p will be equal to 0.0028.

Expected Value (weighted mean):
1.) List the value of differences from the modal
15, 13, 13, 12, 11, 15, 16, 17, 15, 16, 14, 13, 10, 10, 10, 11, 19, 17, 16, 17.
2.) Multiply each value by their probability to get
0.042, 0.0364, 0.0364, 0.0336, 0.0308, 0.042, 0.0448, 0.0476, 0.042, 0.0448, 0.0392, 0.0364, 0.028, 0.028, 0.028, 0.0308, 0.0532, 0.0476, 0.0448, 0.0476.
3.) Sum them up to get 0.784.

Variance:
1.) Square the values of difference from the modal
225, 169, 169, 144, 121, 225, 256, 289, 225, 256, 196, 169, 100, 100, 100, 121, 361, 289, 256, 289.
2.) Multiply by their probability to get
0.63, 0.4732, 0.4732, 0.4032, 0.3388, 0.63, 0.7168, 0.8092, 0.63, 0.7168, 0.5488, 0.4732, 0.28, 0.28, 0.28, 0.3388, 1.0108, 0.8092, 0.7168, 0.8092
3.) Sum them to get Σx2p. Such a sum is 11.368.
4.) Subtract the square of the expected value which is the weighted mean^2, therefore subtract 0.784^2 = 0.614656.
5.) 11.368 - 0.614656 = 10.753344, therefore N = 10.753344

This is a sample of a population, therefore divide N by N-1
So, G = N/N-1 divided by M
and N = 10.753344 & M = 0.0028
Since G = 10.753344/9.753344 divided by 0.0028
then 1.10252893777 divided by 0.0028
Therefore, 393.760334918. Since a generation is held to be 25-30 years multiply result by these to get 9,844 ypb to 11,813 ybp. which doesn't seem to make any sense at all given what is known about the history of R-P312 .

VinceT
07-21-2014, 01:45 AM
You should use the sample variance (VAR function) rather than the population variance (VARP function), since the former adjusts for sample bias by implementing Bessel's correction.

http://en.wikipedia.org/wiki/Bessel%27s_correction
http://en.wikipedia.org/wiki/Variance#Population_variance_and_sample_variance
http://www.excelfunctions.net/variance-in-excel.html (http://en.wikipedia.org/wiki/Variance#Population_variance_and_sample_variance)