PDA

View Full Version : Can I transfer my Ancestry by DNA 2.5 Results to autosomal?



Hando
04-10-2015, 03:59 PM
Hi, I took the Ancestry by DNA 2.5 test in 2008. All it told me was what I already knew. Namely that I was 95% Eurasian. I know you guys get EHG/ANE/EEF autosomal results. Can I transfer my results to something like that? Otherwise, it seems totally useless and a waste of my time and money.
Thanks

Hando
04-12-2015, 08:21 AM
Hi, here are my AncestryByDNA 2.5 results. I am wondering if I can determine what Hunter gatherer, Farmer ANE etc genes I have from these results? Or if I can upgrade my results to something more informative?
Thanks

Ancestry by DNA 2.5

DNA Sequences
These sequences surrounding the SNP are from a reference
database. The SNP is simply indicated in this figure and no
way represents the information developed from your sample.

Marker Number 1113 rs1800498
TACTGTCTGCATTCTAAGATATAAGCATCAAGTGTTTGGAACAGTGCCTG ACACATGGTAAGTCCTTAGTA
TTATTACAGTTATTAGGACTTAGCTGAGCCAGCTCAGGGCCTGTACTGCA GGTCTCAGCTTTATGTGAGCA
AGAGCATTAAGGAATGATGCCTGGATGCCTGGGGGTGTGAAGAAAAGAGC CTTGGGTT[C/T]GACTAGGG
AACCTGGGGCCACTCCTTCCTCTGCTACTAAATCACCAAGTGATCTTGTT CTGTTTTCTTCTCTGACCCTC
CCTAGTTTTGTCCACCCTTGAAATAATCATCTTTCCTTTTCACATTTCAT GCTTACCAAGTACTTGTCACC
TAATTATCTCCTCTCTTGATAAGCTAGATGGTYCCTTCCAGGGCAGCTTA

Marker Number 1116 rs3340
GGTGGAGAGCACTTAAAAACAAAATGAATGATCAATATGAGGGGCCAAAG TCCTTCATTCTTTTTCAAAAC
ATTCCTCAAAACCTTTTTTTTTTTTTTTTTGGTGAAAACCACTTAGAAAT CGAATACGTCCATTTCTTTGT
AAAATAACAATAACGTT[G/A]AAGGCAAAAGCAAGATTCTGTAAACCAACATTGGAAAAGGGGACACAGG
GAGGGGCAGAGGGAAAGGGCCAGATTTTCAACGGTTTCCTCCACATCTGC AGACAAAGGCCCGCCTACTCT

Marker Number 1121 rs2065160
TGCAGTACTGTGACCGCTGCTGTGCTAGCTGCTGATCAAAGAATTACACA GACATTTATAGTCTAAGACAG
GCATGAGAACATCTGAAAACACATTGTAAAGAATGGCCTCTCGATGAGTA AATATGGG[C/T]CAAATGAA
GTAAACAGACTATGCGTAGGTATCATCAAATATAGAGAGAATGAACAGAC CGAAGAAGGGAAATACAAAGA
GGTTTGACGTCCTCACAGCCTAAAAACTAGTGTCTGTTTCCCTTCTTGAA ATGGACATTACTTGGCTAGAA
TTATTTCCTGGAGAAATAAACATATTAGACAGAAATAACCATGCTGGCTA TTGAAATATAGCCAATGAAAA
TATTTGTCTTCACGTAGCA

Marker Number 1122 rs285
CCTGCAAGGGTTTTGCTTAATTCTCAATTCAATGTCTCTTCATCTTTTAG[T/C]AGCTGTGGGGTTTTGT
TGTTGTTCTTCTGTTTTTGCTTAGTATCTGACTA

Genotypes
SAMPLE ID = BNC-131846
GT
#960
CG
#963
CC
#966
PF
#972
TT
#976
TT
#977
TT
#978
TT
#980
TT
#993
CC
#1000
TC
#1029
GG
#1033
AA
#1034
AG
#1035
AG
#1040
GG
#1041
GG
#1048
AA
#1049
AA
#1050
AG
#1053
AG
#1055
AA
#1056
GG
#1057
GG
#1058
GG
#1060
FL
#1062
AA
#1064
AG
#1066
GG
#1075
AA
#1077
GG
#1082
AA
#1084
GG
#1087
AG
#1111
TT
#1113
CC
#1116
TT
#1117
CC
#1120
TT
#1121
TC
#1122
TC
#1124
CC
#1128
GG
#1130
AG
#1136
AA
#1137
GG
#1138
AG
#1139
AA
#1140
GG
#1141
AA
#1146
GG
#1648
CG
#1649
GG
#1650
CC
#1651
CG
#1654
CC
#1658
CG
#1661
TT
#1662
TC
#1663
CC
#1665
CC
#1666
CC
#1668
TC
#1669
CC
#1670
CC
#1671
CC
#1673
TT
#1675
CC
#1677
TC
#1680
CC
#1682
TT
#1683
TC
#1684
CC
#1687
TC
#1688
TC
#1689
TT
#1691
CC
#1692
TC
#1693
TC
#1696
TT
#1698
CC
#1700
TC
#1701
TC
#1702
TC
#1703
TT
#1704
TC
#1705
CC
#1706
TC
#1708
CC
#1709
TC
#1710
CC
#1712
CC
#1713
TT
#1714
TC
#1716
TT
#1717
TT
#1721
AG
#1726
AG
#1728
AA
#1731
AG
#1734
GG
#1739
AG
#1743
GG
#1746
AA
#1747
FL
#1748
GG
#1751
AG
#1752
FL
#1753
AG
#1757
AA
#1759
GG
#1760
AG
#1761
AA
#1762
GA
#1763
GG
#1766
AA
#1767
GG
#1769
TG
#1770
TG
#1771
TT
#1773
TT
#1777
GG
#1778
GG
#1779
AA
#1780
AA
#1782
AG
#1784
GG
#1785
AG
#1786
GG
#1787
AA
#1790
GG
#1791
GG
#1793
AA
#1799
GG
#1801
AA
#1802
AA
#1804
GG
#1805
TT
#1806
TT
#1807
TG
#1809
TT
#1810
GG
#1811
TG
#1814
TT
#1816
CC
#1817
CC
#1818
CG
#1823
CC
#1827
AG
#1828
AG
#1829
AG
#1833
AA
#1837
AA
#1840
AG
#1843
GG
#1844
AA
#1845
GG
#1848
AG
#2071
GG
#2072
PF
#2073
CG
#2075
AG
#2076
AA
#2077
GG
#2078
AG
#2079
AA
#2080
AA
#2081
AG
#2082
AA
#2083
AA
#2084
GG
#2085
AG
#2086
CC
#2087
TC
#2088
CC

paulgill
04-14-2015, 08:35 AM
See if you can upload your raw data to gedmatch.com, it is all free and I think there under eurogene there is a tool that can provide you the results. http://v2.gedmatch.com/login1.php