PDA

View Full Version : A8A?



khanabadoshi
07-23-2015, 04:23 PM
I have done 23andme, Genographic 2.0, DNAtribes, and now ftDNA is in progress. Consistently results for mtDNA is A8A. My maternal lineage is from the Chitral Valley in Pakistan, I can confirm this for at least 5 generations, and probably more -- the valley is extremely isolated and only opened up to outsiders in the past century.

As I understand A haplogroups are most prominent in Native Americans, and particularly A8 is mostly found in Sibera? There does not seem to be much information out there. I was hoping I could gain some clarity here.

EDIT: I thought I should add that the ethnic group is called Kho (colloquially called Chitrali) and they speak a language called Khowari. The language is believed to be the closest living language to Sanskrit. Almost everyone is fluent in Dari as well. They live in proximity to the Kalash, 15 miles south of them. Some amount of Kalash have been absorbed by the Kho. I believe they are similar to Nuristanis in Afghanistan, as the border is a 10 miles to the east. The Wakhan Corridor to Tajikistan and the Pamirs is 60 miles north.

parasar
07-24-2015, 02:55 AM
http://mbe.oxfordjournals.org/content/27/10/2220/F1.medium.gif
Mitogenomic Diversity in Tatars from the Volga-Ural Region of Russia
http://mbe.oxfordjournals.org/content/27/10/2220/F1.expansion.html

haplogroup A8, which is defined now by transition at np 64 and consists of two related groups of lineages—A8a, with control region motif 146-16242 (previously defined as A8 by Derenko et al. [2007]), and A8b, with motif 16227C-16230 ...
A8a is present even in Transylvania at frequency of 1.1% among Romanians, thus indicating that the presence of such mtDNA lineages in Europe may be mostly a consequence of medieval migrations of nomadic tribes from Siberia and the Volga-Ural region to Central Europe


Okunevo: Allentoft sample RISE515 2340-2145 BC A8a 64T, 73G, 146C, 235G, 263G, 663G, 722T, 1438G, 1736G, 4248C, 4824G, 11719A, 12705T, 14766T, 15326G, 16242T, 16290T, 16293C, 16319A

khanabadoshi
07-24-2015, 04:09 AM
I'm a bit of a layman, the numbers hurt my eyes (lol!) -- but, am I to interpret this as: not-so-ancient crusade-era-Siberans went eastwards towards Europe and some detoured into the mountains of the Karakoram?

khanabadoshi
07-24-2015, 04:10 AM
I am getting some PMs and I need to get my post count to 10 to reply.

khanabadoshi
07-24-2015, 04:13 AM
3 more to go.

khanabadoshi
07-24-2015, 04:18 AM
2nd to last .... sorry if this is annoying you!

khanabadoshi
07-24-2015, 04:20 AM
Success!

parasar
07-24-2015, 02:05 PM
I have done 23andme, Genographic 2.0, DNAtribes, and now ftDNA is in progress. Consistently results for mtDNA is A8A. My maternal lineage is from the Chitral Valley in Pakistan, I can confirm this for at least 5 generations, and probably more -- the valley is extremely isolated and only opened up to outsiders in the past century ...

khanabadoshi,

If I may ask, could your please provide information on your paternal ancestry too?
Thanks.

khanabadoshi
07-24-2015, 02:57 PM
khanabadoshi,

If I may ask, could your please provide information on your paternal ancestry too?
Thanks.

It's complicated. I'm going to post the details with timelines that are established for certain.

Paternal grandfather: Baloch
5th generation settled on right bank of Indus across Dera Ghazi Khan and near Muzaffargarh -- between Indus and Chenab rivers; first person settled ~1750 CE, named Wali Khan. Durrani Governer of Multan, Muzaffar Khan Sadozai awarded many Baloch land for military service. Wali Khan's name is recorded in Durrani records, transferred to Sikh Administration then British. This is how we know when he arrived based on the fact it was Afghan rule at the time. Family tree before Wali Khan is unknown.

Paternal grandmother: Kashmiri (born in Srinagar, settled Lahore ~1920 CE)

Maternal grandfather: Baloch (same tribe as paternal)

Maternal grandmother: Born/settled in Peshawar;
her FATHER: Born in Tashkent, Uzbekistan (settled in Peshawar ~ 1910CE) -- [I]Paternally Uzbek (Tashkent), Maternally Kho/Chitrali (Drosh)
her MOTHER: Born in Drosh, Chitral -- Kho/Chitrali; same tribe as her husband's mother

So my maternal grandmother is: 1/4th Uzbek; 3/4th Chitrali

So I should be:

50% Baloch; 25% Kashmiri; 18.75% Kho ; 6.25% Uzbek
Y-DNA: should follow Baloch line (Z-282)
mtDNA: should follow Kho line (A8A)


However, DNA Tribes says I'm a Cochin Jew; Harappa says I'm like 90% Kashmiri; Eurogenes says I'm a Jatt. LOL!

MfA
07-24-2015, 03:20 PM
The thread is about A8a but i like to comment about Z282 here. There are a few Z282+, Z280-, Z284-, M458- samples from Kurdistan and Armenia. Mainstream opinion is that Baloch language bearers immigrated from somewhere around Kurdistan. Some Baloch tribes claim they're Kurdish in origin. However modern Balochs are autosomally autochthonous where they live in Balochistan.

In addition to that samples from Kuwait and UAE (Z282+, Z280-, Z284-, M458-) could be related to Baloch merchants on Persian Gulf.

3. M420>M459>M198>M417>Z645>Z283>Z282-A West Asian cluster
https://www.familytreedna.com/public/r1a/default.aspx?section=yresults

DMXX
07-24-2015, 03:35 PM
Yes. There is also some Z282 in South-Central Asia. A recent West Asian origin for khana's line is quite possible. The Balochi Y-DNA profile looks similar to that of the Brahui with the exception of select lineages which do look quite NW Iranian in origin in a relative sense e.g. (E-V13, increased Y-DNA G frequency), which coincides with their language.

khanabadoshi
07-24-2015, 04:39 PM
The thread is about A8a but i like to comment about Z282 here. There are a few Z282+, Z280-, Z284-, M458- samples from Kurdistan and Armenia. Mainstream opinion is that Baloch language bearers immigrated from somewhere around Kurdistan. Some Baloch tribes claim they're Kurdish in origin. However modern Balochs are autosomally autochthonous where they live in Balochistan.

I am currently having Z-283 downstream tests done to see if I'm -/+; as of now all I know is that I'm Z93 - and Z-282+. I am not from a Baloch tribe that believes they are actually Kurdish, but we do believe that of all the Iranic and Indian peoples, we were the most closely related. Obviously, time and distance have altered that. However, there is quite a large tribe actually called Kurd. They are Brahui-speaking though.


The general story of the Baloch history is: Form somewhere in NW Iran (due to language similarity with Zend and Kurdish); Mentioned in Shahnama as Baloch, always with another group of people called Koch (Many people think these are the Kurds) The Koch live in the mountains, the Baloch in the plains of the mountains. Some people think the Baloch/Koch(Kurd?) are the Medians and Koch went west, Baloch went east to defend territory. At any rate at some point they are in Kerman; this is attested to by the Arabs who describe them as thieves (almost all Baloch tribal names have meanings like "Blackfoot", "Tiger", "Robber" etc). The Baloch claim a local ruler named Abdulshams demanded 44 girls from each bolak (tribe); the Baloch sent 44 boys dressed as girls and fled. The ruler released the boys, but pursued the Baloch. Whether this is true or not the 44 tribe names are established from here. My tribe is in this list. The Baloch are now in Sistan and many historians assume due to Mongol incursions they migrated South and East into Makran and Kech. This is 11-12th century. Many locals become absorbed into the Baloch -- these are the Makrani Baloch -- coastal areas. At some point the natives of Kalat called upon a group of people to retake the area -- the people that arrive are the Brahui. They take control of the central area and the Baloch tribes move north to the Sulaiman mountains, leave the Makrani behind at the coast with the Brahui separating them in the middle. These Baloch are called Sulaimani Baloch and are considered unmixed. At the Sulaiman range is where the Pashtun are encountered, many fights over territory ensue and continued even until recently amongst certain tribes. Essentially, where the Baloch did settle was considered homeland of the Pashtun. All other natives at this point, Sindhi, Jatt, locals of Makran, or Punjab are called Jaghdal. Their language is referred to as Jaghdali. The Baloch of the time believed everyone from Sindh to Punjab to be of the same ethnic group. At this point all tribes are well established and which tribes are mixed and aren't is common knowledge. A major tribe of later importance in history is the Dodai -- they are paternally Sindhi. This is common knowledge to all Baloch, but not to most others, not even Sindhis. This is relevant in terms of DNA lineages, because they are a major tribe with many sub-tribes. Anyways, Mir Chakar Khan is the King in the 15th century, the Baloch have not yet crossed the Indus River in all this time. The Langah King of Multan asks the Dodai tribe for assistance against the Arghun Turks. They go, and are awarded large tracts of land, most of which is across the Indus from the Pashtuns. Babar seeks assistance from Mir Chakar and receives it. During Babar's assault, the Baloch faction into 2 groups -- One on Babar's side one against. Mir Chakar Khan's Rind tribe opposes the Lashari tribe. This ensues into civil war lasting 15 years after Babar gains Delhi. This war is complicated by Turks, Sindhis and Humayun. In all these battles, sides constantly change and the soldiers of the armies are comprised mainly of Baloch. The Lasharis sub-tribe become the Legharis --- who if you know Sindhi history, later come to rule Sindh under the Talpur dynasty. Hence, the large presence of Sindhi/Baloch tribes in Sindh. Mir Chakar assists Humayun after he is loses his throne, taking him to Shah Tamshap of the Persians. As some may know, Tamshap is at this point vigorously pro-Shia and forcing conversions. Prior to this Iran is Sunni. In return for supplying troops, Humayun must become Shia. He does so, as such most of the Mughal empires aristocracy from this point forward is Shia (ie. Nizam of Hyderabad is a good example). I'm sidetracking.... SO they return back and there is an influx of Persians into Punjab area, hence, many people of Multan and such having Irani surnames. Humayun wins back the throne and Mir Chakar is gifted huge amounts of land in Okara, Punjab. To this day his descendants live there. In this entire saga, 90% of the Baloch crossed the Indus River with Mir Chakar. Most settled in South Punjab, some turned back and recrossed the river, wanted to be near the mountains. This story is widely revered amongst the Baloch but its a double edged sword, the common saying being: Those who crossed the river became Jaghdal, those who didn't stayed Baloch. However, the fact remains is the majority of the original tribes are actually in Punjab, and that is why even though the Baloch were not in the scene of South Asia until the 1500s, there is quite a presence of their DNA amongst the Punjabis and Sindhis.

I blahed a lot, but I figured it's a good idea to give a general history of the group that Harrapa assigns all a percentage of but no one knows about.

surbakhunWeesste
07-24-2015, 04:48 PM
It's complicated. I'm going to post the details with timelines that are established for certain.

Paternal grandfather: Baloch
5th generation settled on right bank of Indus across Dera Ghazi Khan and near Muzaffargarh -- between Indus and Chenab rivers; first person settled ~1750 CE, named Wali Khan. Durrani Governer of Multan, Muzaffar Khan Sadozai awarded many Baloch land for military service. Wali Khan's name is recorded in Durrani records, transferred to Sikh Administration then British. This is how we know when he arrived based on the fact it was Afghan rule at the time. Family tree before Wali Khan is unknown.

Paternal grandmother: Kashmiri (born in Srinagar, settled Lahore ~1920 CE)

Maternal grandfather: Baloch (same tribe as paternal)

Maternal grandmother: Born/settled in Peshawar;
her FATHER: Born in Tashkent, Uzbekistan (settled in Peshawar ~ 1910CE) -- [I]Paternally Uzbek (Tashkent), Maternally Kho/Chitrali (Drosh)
her MOTHER: Born in Drosh, Chitral -- Kho/Chitrali; same tribe as her husband's mother

So my maternal grandmother is: 1/4th Uzbek; 3/4th Chitrali

So I should be:

50% Baloch; 25% Kashmiri; 18.75% Kho ; 6.25% Uzbek
Y-DNA: should follow Baloch line (Z-282)
mtDNA: should follow Kho line (A8A)


However, DNA Tribes says I'm a Cochin Jew; Harappa says I'm like 90% Kashmiri; Eurogenes says I'm a Jatt. LOL!

I saw your gedmatch results, pretty interesting.

I have few questions for you if you don't mind answering them.

What does your family identify as(ethnicity wise)?
What's your mother tongue or language spoken at home and what's the culture like?
Do you plan on testing either of your parents or grandparents?

parasar
07-24-2015, 05:03 PM
I am currently having Z-283 downstream tests done to see if I'm -/+; as of now all I know is that I'm Z93 - and Z-282+. I am not from a Baloch tribe that believes they are actually Kurdish, but we do believe that there of all the Iranic and Indian peoples, we were the most closely related. Obviously, time and distance have altered that. However, this is quite a large tribe actually called Kurd. They are Brahui-speaking though.


The general story of the Baloch history based is: Form somewhere in NW Iran (due to language similarity with Zend and Kurdish); Mentioned in Shahnana as Baloch, always with another group of people called Koch (Many people think these are the Kurds) The Koch live in the mountains, the Baloch in the plains of the mountains. Some people thing the Baloch/Koch(Kurd?) are the Medians and Koch went west, Baloch went east to defend territory. At any rate at some point they are in Kerman; this is attested to by the Arabs who describe them as thieves (almost all Baloch tribal names have meanings like "Blackfoot", "Tiger", "Robber" etc). The Baloch claim a local ruler named Abdulshams demanded 44 girls from each bolak (tribe); the Baloch sent 44 boys dressed as girls and fled. The ruler released the boys, but pursued the Baloch. Whether this is true or not the 44 tribe names are established from here. My tribe is in this list. The Baloch are now in Sistan and many historians assume due to Mongol incursions they migrated South and East into Makran and Kech. This is 11-12th century. Many locals become absorbed into the Baloch -- these are the Makrani Baloch -- coastal areas. At some point the natives of Kalat called upon a group of people to retake the area -- the people that arrive are the Brahui. They take control of the central area and the Baloch tribes move north to the Sulaiman mountains, leave the Makrani behind at the coast with the Brahui separating them in the middle. These Baloch are called Sulaimani Baloch and are considered unmixed. At the Sulaiman range is where the Pashtun are encountered, many fights over territory ensue and continued even until recently amongst certain tribes. Essentially, where the Baloch did settle was considered homeland of the Pashtun. All other natives at this point, Sindhi, Jatt, locals of Makran, or Punjab are called Jaghdal. Their language is referred to as Jaghdali. The Baloch of the time believed everyone from Sindh to Punjab to be of the same ethnic group. At this point all tribes are well established and which tribes are mixed and aren't is common knowledge. A major tribe of later importance in history is the Dodai -- they are paternally Sindhi. This is common knowledge to all Baloch, but not to most others, not even Sindhis. This is relevant in terms of DNA lineages, because they are a major tribe with many sub-tribes. Anyways, Mir Chakar Khan is the King in the 15th century, the Baloch have not yet crossed the Indus River in all this time. The Langah King of Multan asks the Dodai tribe for assistance against the Arghun Turks. They go, and are awarded large tracts of land, most of which is across the Indus from the Pashtuns. Babar seeks assistance from Mir Chakar and receives it. During Babar's assault, the Baloch faction into 2 groups -- One on Babar's side one against. Mir Chakar Khan's Rind tribe opposes the Lashari tribe. This ensues into civil war lasting 15 years after Babar gains Delhi. This war is complicated by Turks, Sindhis and Humayun. In all these battles, sides constantly change and the soldiers of the armies are comprised mainly of Baloch. The Lasharis sub-tribe become the Legharis --- who if you know Sindhi history, later come to rule Sindh under the Talpur dynasty. Hence, the large presence of Sindhi/Baloch tribes in Sindh. Mir Chakar assists Humayun after he is loses his throne, taking him to Shah Tamshap of the Persians. As some may know, Tamshap is at this point vigorously pro-Shia and forcing conversions. Prior to this Iran is Sunni. In return for supplying troops, Humayun must become Shia. He does so, as such most of the Mughal empires aristocracy from this point forward is Shia (ie. Nizam of Hyderabad is a good example). I'm sidetracking.... SO they return back and there is an influx of Persians into Punjab area, hence, many people of Multan and such having Irani surnames. Humayun wins back the throne and Mir Chakar is gifted huge amounts of land in Okara, Punjab. To this day his descendants live there. In this entire saga, 90% of the Baloch crossed the Indus River with Mir Chakar. Most settled in South Punjab, some turned back and recrossed the river, wanted to be near the mountains. This story is widely revered amongst the Baloch but its a double edged sword, the common saying being: Those who crossed the river became Jaghdal, those who didn't stayed Baloch. However, the fact remains is the majority of the original tribes are actually in Punjab, and that is why even though the Baloch were not in the scene of South Asia until the 1500s, there is quite a presence of their DNA amongst the Punjabis and Sindhis.

I blahed a lot, but I figured it's a good idea to give a general history of the group that Harrapa assigns all of a percentage of but no one knows about.

Thanks for testing. It could really help to resolve the IE migration issues and R1a's part in it. The Koch just means mountain I think - like Kush, Kuh, Koh, etc.
Kurdgali would surprisingly be a Dravidian tongue and Jaghdali is Jatki.

If you are not planning a complete scan after the Z283 downstream tests, I would recommend a Y-STR analysis too.

Edit: One Pakhtoon and one Uzbek from Afghanistan were found to be Z282+ in Underhill's dataset:
Afghanistan, Pachtoun Z282 15 ND 14 17 24 11 11 13 10 ND 11 14 14 11 20 17 15 23 12
Afghanistan, Uzbek Z282 15 12 13 18 25 11 11 13 10 10 11 15 14 11 20 15 15 23 13
http://www.anthrogenica.com/showthread.php?3795-Split-The-Yuezhi-Who-Were-They&p=67884&viewfull=1#post67884

surbakhunWeesste
07-24-2015, 05:20 PM
Thanks for testing. It could really help to resolve the IE migration issues and R1a's part in it. The Koch just means mountain I think - like Kush, Kuh, Koh, etc.
Kurdgali would surprisingly be a Dravidian tongue and Jaghdali is Jatki.

If you are not planning a complete scan after the Z283 downstream tests, I would recommend a Y-STR analysis too.

In which language?

Koch in a 'general' Iranic term means to move/migrate as in Kochai/ Kochaidal the Pashtun nomads.

parasar
07-24-2015, 06:06 PM
In which language?

Koch in a 'general' Iranic term means to move/migrate as in Kochai/ Kochaidal the Pashtun nomads.

The Arabs used Bulus and Kufs together. We see the same in Shahnameh as Baloch and Koch. In both instances the latter are noted as mountain dwellers. Kuh, Koh, Ko are terms used for mountains (cf. Persian koh-i-noor, Dravidian ko) so I think the Arab writers and Ferdausi are using the generic term to describe the mountain dwelling Baloch - likely the Brahui.

khanabadoshi
07-24-2015, 07:00 PM
I saw your gedmatch results, pretty interesting.

I have few questions for you if you don't mind answering them.

What does your family identify as(ethnicity wise)?
What's your mother tongue or language spoken at home and what's the culture like?
Do you plan on testing either of your parents or grandparents?

My father's line ethnically defines itself as Baloch despite living in a Saraiki speaking area. Until my Grandfather (the gentleman in my avatar) the family spoke Balochi of the Eastern Hill dialect. My Grandfather grew up speaking Saraiki and understanding Balochi. My father can understand basic Balochi, but ONLY of tribes near us. All the Baloch of the Deras (Ghazi Khan, Fateh Khan, Ismail Khan) until Multan call themselves Baloch no matter what language they speak. This is also true of all Pashtuns who speak Saraiki. Despite common language, everyone in this mixed area is aware of who is what, and still considers them as such. This is especially because despite being in Punjab or Khyber Pakhtunkwa we are right next to the border of Balochistan and the Dera Bugti is very close and we interact a lot. All Bugtis can speak Saraiki (this maybe surprising to some of you, considering how separatist the Bugtis are) and the eastern dialects of Balochi are 30-40% intelligible to a Saraiki speaker. Additionally, all Tumandars of Saraiki or Pashto speaking Baloch tribes attended the grand jirga of the Khan of Kalat, despite language. Being between many languages obviously means we speak many of them; To put this in perspective, if I drive 30 miles west, Balochi is the main language; 30 miles northwest Pashto is; 30 miles northeast; Punjabi; All the way north until Hindko is Saraiki; and 100 miles South is Sindhi. So unlike the majority of Pakistan we DO NOT define who we are by language at all. There is no importance given to retaining language. The general rule of thumb being speak the language where you live. An example, My uncle's father had a job in Gurdaspur before partition, my uncle grew up there for 5-6 years; he learned and spoke Punjabi -- extremely, unusual for where we live -- he cannot speak Saraiki at all. He still speaks Punjabi despite the fact that none of his immediate family, the tribe, or anyone in our town really does. And no one cares....in fact, when he married, his wife learned Punjabi for him and she forgot Saraiki LOL! Ok, so that's the father's side. Majority speaks Saraiki, some older folks speak Balochi. Culturally, we maintain the tribal sardari system (jirgas/chief's ruling binding), dance dochapi(jhumar), wear specific turban for the tribe, eat a lot of Sajji, and extreme Burqa/Pardah. So much so that I have never seen a woman besides my own family in my town -- even in my own family, I do not know how some of my cousins look (not exaggerating). If I am about to enter my own home and a woman's calls out from inside that she is unrelated and not covered, I do not enter. In Fort Munro -- 70 miles west the people live on various levels of the mountain and hills. If you are walking on lower land and look up towards the home of a person and a woman can be seen, you will shot at from the men above. Crazy! Besides this, we are not strongly Baloch in terms of certain cultural aspects...but this is already too long. My Kashmiri grandmother's side of the family's influence is weak; despite the fact that my grandmother's sister married my grandfather's brother as well. So 2 Kashmiri sisters married 2 Baloch brothers. However, in my generation, we have little relations with the exception of some 2nd cousins.

OK my mother's family. My Maternal grandfather worked/lived in Peshawar. Got married. My Grandmother was his 2nd wife. As such, my mother was raised in Peshawar until the age of 16, then moved to my father's town. She can speak Dari and Urdu, was fluent in Pashto, but now only understands it. She never spoke Saraiki but she can understand it. All the Chitrali family members (there are a lot, intermarrying for generations) can speak Dari; as such most of the Uzbeks don't speak Khowari; the family itself defines itself as Uzbek and considers Dari their first language. All of my Grandmother's brothers speak Dari, Pashto, Khowari, Urdu, and Hindko fluently. Some speak Uzbeki. The women speak mostly Dari and Urdu, some speak Pashto. Everyone understands Hindko as many of the women married Hindko men. The entire Peshawar family knows my entire Baloch family. After my grandfather's marriage, every winter 50-100 of the Peshawaris (as we call them) would come and stay. As such even though my siblings and I are the only ones related to them, my entire Baloch khandan knows most of my Uzbek khandan. Due to this occuring for many years (until my grandfather passed away) many of the Uzbeks also can speak or understand Saraiki. My father knew all my grandmother's brothers well before he married my mother.

So lots of languages all over the place.

As for my little family specifically: I was born in the US. My parents didn't care to teach me any language, as explained above. I speak Urdu the best. I understand Saraiki well. I understand Punjabi because many Pakistanis in the US speak it. I know a few blips here and there of chitrali. My grandmother and mother yell at me in Dari, and I reply in Urdu. My father speaks Saraiki when he is excited, happy, or mad -- or with his brothers and sisters. He generally speaks in Saraiki or Urdu to my mom, and my mom replies in Urdu. We all have a basic understanding of each of the langauges even if we can only speak one. I myself, can get the basic sense of what someone is saying in Balochi. I can also tell what part of Balochistan you might be from based on your accent. All my family in general is very mixed up. My cousins or uncles married: Turk, Syrian, Jordanian, British, Ivory coast, Afghani, Punjabi, Muhajir women -- pretty much all of them understand Urdu and basic Saraiki now. My British aunt lived in Pakistan for 6 years in the village.... she understands Saraiki better than I do! Culturally, we are very much united by Islam, pretty much all it takes to be accepted; we joke in Saraiki, make friends in Punjabi, recite poetry in Farsi, eat Uzbeki Mantu and Saukash, lecture one another in Urdu, learn in English, wear the real pakol, a chitrali topi, with the woolen vest, and ultimately we laugh.

The family commonly tells any man who marries a woman from our family, "Don't assume a baby isn't yours if doesn't look like you or her...in fact, you should assume it isn't yours if it does! [Everyone laughs]

OK I think I answered everything and more.


Wait. woops. Yes, my only grandparent alive is my maternal grandmother, I do plan on testing her and her brothers. I can also test my maternal grandfather's brother. I may do my father as well to get my paternal grandmother's mtDNA line. See where that Kashmiri goes.

khanabadoshi
07-24-2015, 07:13 PM
Thanks for testing. It could really help to resolve the IE migration issues and R1a's part in it. The Koch just means mountain I think - like Kush, Kuh, Koh, etc.
Kurdgali would surprisingly be a Dravidian tongue and Jaghdali is Jatki.

If you are not planning a complete scan after the Z283 downstream tests, I would recommend a Y-STR analysis too.

Edit: One Pakhtoon and one Uzbek from Afghanistan were found to be Z282+ in Underhill's dataset:
Afghanistan, Pachtoun Z282 15 ND 14 17 24 11 11 13 10 ND 11 14 14 11 20 17 15 23 12
Afghanistan, Uzbek Z282 15 12 13 18 25 11 11 13 10 10 11 15 14 11 20 15 15 23 13
http://www.anthrogenica.com/showthread.php?3795-Split-The-Yuezhi-Who-Were-They&p=67884&viewfull=1#post67884



When I get my results I will let you guys know and you can advise me what to do next!
So based on the populations that are z-282+ does that fit well for Baloch or does it lead one to conclude other origins?

Also, I'm fairly certain Kush (ie. Hindu Kush) means kill/killer not mountain. Like Khudkush (suicide, "self-kill"). Hindukush is named such, because it prevented Indians invading north and made it easy for the north to invade south.

khanabadoshi
07-24-2015, 07:16 PM
The Arabs used Bulus and Kufs together. We see the same in Shahnameh as Baloch and Koch. In both instances the latter are noted as mountain dwellers. Kuh, Koh, Ko are terms used for mountains (cf. Persian koh-i-noor, Dravidian ko) so I think the Arab writers and Ferdausi are using the generic term to describe the mountain dwelling Baloch - likely the Brahui.

I am presently surprised that you knew about the terms used! Bulus/Kufs and Baloch/Koch. Very few people read up on these little histories!

khanabadoshi
07-25-2015, 07:01 PM
My R-Z283 downstream results for analysis by you interested folks!

http://i.gyazo.com/06a20da75b055577d39753b4a267c73e.png
https://i.gyazo.com/184a82d930881366111a79d631fde796.png
https://i.gyazo.com/424f9d407d7b9e63af0af1cbeb69aa71.png
https://i.gyazo.com/02505a339882fe9e2bfa83228d58491e.png

MfA
07-25-2015, 07:12 PM
It's inline with West Asian branch of Z282* SNP wise so far. Do you have any STR results, What's your kit number?

khanabadoshi
07-25-2015, 07:57 PM
It's inline with West Asian branch of Z282* SNP wise so far. Do you have any STR results, What's your kit number?

Kit number of ftdna or gedmatch? And no I don't think so... basic geno2.0 and 23andme tests are snp results I believe? Should I do a str test?

parasar
07-25-2015, 08:20 PM
My R-Z283 downstream results for analysis by you interested folks!

http://i.gyazo.com/06a20da75b055577d39753b4a267c73e.png
https://i.gyazo.com/184a82d930881366111a79d631fde796.png
https://i.gyazo.com/424f9d407d7b9e63af0af1cbeb69aa71.png
https://i.gyazo.com/02505a339882fe9e2bfa83228d58491e.png
Perfect!
Z283/Z282+ Z280-
A Xiaohe related line perhaps. The Xiaohe are known to be Z93- which if we play the odds almost certainly would make them Z283+.
We did not know the Z280 or Z92 status of the other two Z282+ Afghans. Your result makes it likely that they too could be Z280-.

khanabadoshi
07-25-2015, 08:38 PM
Perfect!
Z283/Z282+ Z280-
A Xiaohe related line perhaps. The Xiaohe are known to be Z93- which if we play the odds almost certainly would make them Z283+.
We did not know the Z280 or Z92 status of the other two Z282+ Afghans. Your result makes it likely that they too could be Z280-.

Well I'm glad my results are of use. You'll have to excuse me while I go google, "Xiaohe" hahahahah!

parasar
07-25-2015, 09:44 PM
When I get my results I will let you guys know and you can advise me what to do next!
So based on the populations that are z-282+ does that fit well for Baloch or does it lead one to conclude other origins?

Also, I'm fairly certain Kush (ie. Hindu Kush) means kill/killer not mountain. Like Khudkush (suicide, "self-kill"). Hindukush is named such, because it prevented Indians invading north and made it easy for the north to invade south.

That Hindu Killer reference is indeed noted by Ibn Batutah:

"After this I proceeded to the city of Barwan, in the road to which is a high mountain, covered with snow and exceedingly cold; they call it the Hindu Kush, i. e. Hindoo-slayer, because most of the slaves brought thither from India die on account of the intenseness of the cold ... I then went on to Kabul, which was once a large city; but is now, for the most part, in ruins. It is inhabited by a people from Persia whom they call the Afghans. Their mountains are difficult of access, having narrow passes. These are a powerful and violent people; and the greater part of them highway robbers. Their largest mountain is called the mountain of Solomon. It is said that when Solomon had ascended this mountain, and was approaching India from it, and saw that it was an oppressive country, he returned refusing to enter it. The mountain was therefore called after his name: upon this the king of the Afghans resides."

MfA
07-25-2015, 09:50 PM
Kit number of ftdna or gedmatch? And no I don't think so... basic geno2.0 and 23andme tests are snp results I believe? Should I do a str test?

I meant your FTDNA number, but nevermind that since you haven't done STR test yet.
At this point since Z282* is itself not much specific, I think you should get 67 markers STR test from FTDNA so that you can know your clade whether it's connected to West Asian Z283* or W-Central European specific. 2 Afghans samples that Parasar mentions are likely to be derived from the Slavic lines and not derived from a single common recent founder but at different times from one another.
http://www.anthrogenica.com/showthread.php?3795-Split-The-Yuezhi-Who-Were-They&p=67877&viewfull=1#post67877

Once you get your clade thanks to STR results, you can move to one of the FullGenome tests or BigY.



BTW Y-DNA specific talk should move to its own spin-off thread so that it could take more attention from R1a nerds.

Sein
07-25-2015, 09:50 PM
That Hindu Killer reference is indeed noted by Ibn Batutah:

"After this I proceeded to the city of Barwan, in the road to which is a high mountain, covered with snow and exceedingly cold; they call it the Hindu Kush, i. e. Hindoo-slayer, because most of the slaves brought thither from India die on account of the intenseness of the cold ... I then went on to Kabul, which was once a large city; but is now, for the most part, in ruins. It is inhabited by a people from Persia whom they call the Afghans. Their mountains are difficult of access, having narrow passes. These are a powerful and violent people; and the greater part of them highway robbers. Their largest mountain is called the mountain of Solomon. It is said that when Solomon had ascended this mountain, and was approaching India from it, and saw that it was an oppressive country, he returned refusing to enter it. The mountain was therefore called after his name: upon this the king of the Afghans resides."

This is one of the older references to Pashtun people ("Afghans").

parasar
07-25-2015, 09:55 PM
Well I'm glad my results are of use. You'll have to excuse me while I go google, "Xiaohe" hahahahah!

http://www.anthrogenica.com/showthread.php?2573-New-DNA-Papers-General-Discussion-Thread&p=65658&viewfull=1#post65658

khanabadoshi
07-25-2015, 10:13 PM
I meant your FTDNA number, but nevermind that since you haven't done STR test yet.
At this point since Z282* is itself not much specific, I think you should get 67 markers STR test from FTDNA so that you can know your clade whether it's connected to West Asian Z283* or W-Central European specific. 2 Afghans samples that Parasar mentions are likely to be derived from the Slavic lines and not derived from a single common recent founder but at different times from one another.
http://www.anthrogenica.com/showthread.php?3795-Split-The-Yuezhi-Who-Were-They&p=67877&viewfull=1#post67877

BTW Y-DNA specific talk should move to its own spin-off thread so that it could take more attention from R1a nerds.

Once you get your clade thanks to STR results, you can move to one of the FullGenome tests or BigY.


I just ordered the y111; I have nothing else do with my hard earned cash. LOL. And I'm sure a mod can split the thread or something?

paulgill
07-25-2015, 10:36 PM
I just ordered the y111; I have nothing else do with my hard earned cash. LOL. And I'm sure a mod can split the thread or something?


Why would you buy Y-DNA111 for $359 when you can get BIG Y for $488.75? BIG Y covers over 400 STRs and it is on sale, the sale ends today, regular $575 with coupon 15% of thus for only $488.75. Use discount code Jam15P and get BIG Y for only $488.75.

khanabadoshi
07-25-2015, 10:38 PM
Why would you buy Y-DNA111 for $359 when you can get BIG Y for $488.75? BIG Y covers over 400 STRs and it is on sale, the sale ends today, regular $575 with coupon 15% of thus for only $488.75. Use discount code Jam15P and get BIG Y for only $488.75.

Well, I better go cancel that order now. THANKS!

khanabadoshi
07-25-2015, 10:56 PM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.

I've e-mailed them, let's see.

jesus
07-25-2015, 11:00 PM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.
Do the 12 str test, I think you have to call them for that test since it's not available online.

paulgill
07-25-2015, 11:17 PM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.

I've e-mailed them, let's see.


Coupon was for Jerusalem, Jam15. another one for STRs is Jam30, I guess. But you can also get 12 STRs for $ 59 and there may be a discount for that too. and then order the BIG Y. Discount coupon Jam30 for y37, y67 & y111.

If discount coupons have expired then there is no reason to rush for it as you have other options. FullGenomes.com Y Elite 2.0 will give more and better STRs, full Y lineage plus full maternal line. and there WGS 2x=$225, 10x=$675 and 30x=$1850 will give you everything that you will ever need. http://www.anthrogenica.com/showthre...-Pilot/page109

https://www.fullgenomes.com/news/

parasar
07-26-2015, 12:31 AM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.

This is another code - Jerusalem2015
Try giving them a call as this is an "upgrade" code so may not work on initial orders.

paulgill
07-26-2015, 01:38 AM
This is another code - Jerusalem2015
Try giving them a call as this is an "upgrade" code so may not work on initial orders.

Sorry, I may have given the old coupon code.

paulgill
07-26-2015, 01:50 AM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.

I've e-mailed them, let's see.

Sorry, I may have given the old coupon code. Use the Code Parasar gave, today is the last day and it should work, and if it does not then send them another email giving the details, mentioning these both coupon codes and also your effort to to order 12 STRs that failed and they should let you order them tomorrow, and talk to the supervisor and/or manager, if needed.

paulgill
07-26-2015, 04:33 AM
Evidently I am not eligible for the Big Y until I have had an STR test done first. It doesn't even allow me to choose the test.

I've e-mailed them, let's see.

In case you happen to consider any of these, 4 X been added only today.

Whole genome products:

2x coverage = $225
4x coverage = $325
10x coverage = $675

Use codes:

2x:
WGS-2xcoverage
4x:
WGS-4xcoverage
10x:
WGS-10x

30x: $1850

khanabadoshi
07-27-2015, 05:35 PM
ftDNA isn't budging and won't cancel my order. I don't have the will to fight this, I have exams in 2 weeks. I'll eat the loss, but gain some STRs. I'm sorry I failed you, my noble posters... I feel like I have disappointed you as if you were my Father. LOL!

In other news, my full sequence mtDNA should be complete in 2-3 weeks. I'll post that here.

After I do get my YDNA-111 and mtDNA, I will require detailed guidance of what to do next; what that means and it's significance; where to get it from and why; and how to not lose 100s of dollars. Thank you.

parasar
07-27-2015, 07:41 PM
correct me if im wrong, but whats the point of looking at your y dna and mtdna in so much detail? think about it, you have 4 grandparents and 8 great grandparents, 16 g-great grandparents, 32 g-g-great grandparents, 64, 128 and so on ancestors each coming from a possibly different line which will have the same impact as your direct paternal and maternal line. so whats so special about it?

in actual fact we all have most y dna haplogroups present within ourselves ( the ones that are present in your homeland ofcourse)

It all depends on the objective.

For folk who know that all eight of their great grandparents are from a close knit population (as in my case), autosomal DNA will just confirm the population and location which they already know.

Y-DNA and mtDNA can serve to establish long term migrations in a very discreet manner.

In khanabadoshi's case both his Y and mtDNA are atypical for his location. His mtDNA A8a is indicating a Siberian connection.

His yDNA is even more interesting (to me) as it belongs to a major haplogroup the origins of which, and the whole IE issue itself, is yet to be resolved. To some it shows a European connection. To others it indicates a West Asian connection. I believe that Z283 is of Siberian origin, and moved west, with Z93 for the most part staying back. What we know with good confidence is that both Z283 and Z93 emerged together. So a comparison with European and West Asian types could clarify the nature of khanabadoshi's Y-line.

On another matter, we can't keep expanding our lineages into the past (4, 8, 16, 32, ... etc) as they are not independent. In fact, going back just a few generations they would be related. In my caste group about 70% of males are R1a1 with another 20% R2. So just my Y line would establish much of our caste's ancestry - going back 4000 years for R1a1-Y9, 5000 years for R1a1-L657, Z93, Z645, and about 20000 years back for R.

Additionally, in the past populations were quite isolated and we have evidence of whole massive regions carrying the same Y-line.

paulgill
07-28-2015, 12:22 AM
ftDNA isn't budging and won't cancel my order. I don't have the will to fight this, I have exams in 2 weeks. I'll eat the loss, but gain some STRs. I'm sorry I failed you, my noble posters... I feel like I have disappointed you as if you were my Father. LOL!

In other news, my full sequence mtDNA should be complete in 2-3 weeks. I'll post that here.

After I do get my YDNA-111 and mtDNA, I will require detailed guidance of what to do next; what that means and it's significance; where to get it from and why; and how to not lose 100s of dollars. Thank you.


I said talk to the customer services supervisor or manager and try to change the order to 12 or 37 STRs and they may agree, and if they don't, never ever recommend FTDNA to anyone or give your business to them again. You are not on any project there else you could get the project administrator involved.

paulgill
07-28-2015, 12:34 AM
Understood, but answer me this, let's say there's R1b, I1a, I1b, E1b1b, j2a, present within my country and ethnic group as of sampling etc, and my direct line is R1a, would that mean there's a high chance I have ancestry from those haplogroups too?

If those people do marry out of their Haplogroups, then yes, but the contribution be temporary and only to the aDNA soup, which will disappear in 6 to 8 generation by marrying into unrelated group. But the yDNA lineage is permanent, and is retained by the males, so also is the mtDNA lineage for females.

parasar
07-28-2015, 01:04 AM
Understood, but answer me this, let's say there's R1b, I1a, I1b, E1b1b, j2a, present within my country and ethnic group as of sampling etc, and my direct line is R1a, would that mean there's a high chance I have ancestry from those haplogroups too?

No doubt.

khanabadoshi
07-29-2015, 02:37 AM
I said talk to the customer services supervisor or manager and try to change the order to 12 or 37 STRs and they may agree, and if they don't, never ever recommend FTDNA to anyone or give your business to them again. You are not on any project there else you could get the project administrator involved.

A project manager did reach out to me. After much deliberation and discussion of my goals and/or the significance of my results to people who have a scientific stake in the R group, I decided to go ahead with the YDNA-111 and most likely do the Big Y afterwards. Luckily for me, I don't spend much money beyond rent, food, and practice exams; I figured what's a paycheck or 2 for science?

After I do get my YDNA-111 results, then we'll have a mass discussion whether doing any further testing is useful or worth it. If so, then I'll take the best option by consensus. I really do appreciate you looking out for me though! It's easy to screw up in these matters and blow a lot of money -- I can afford this screw up, if it turns out to be one, but not next time!

khanabadoshi
07-29-2015, 05:27 PM
sent message

I PMed ya!

khanabadoshi
07-31-2015, 08:55 AM
Since this thread is actually about A8a... I saw DMXX mention something called JamesLick. I went ahead and tried it out. Here are the results. Perhaps, it'll be meaningful to some of you.

https://i.gyazo.com/e9cacd1497d75ae22a6691a60a8c290a.png
https://i.gyazo.com/7cc4a268958cedc70d7be2e6efe1a1cf.png

Well that might be too small to read... let's see what I can do.
Just right click and view image the sucker. It'll be clear.

DMXX
07-31-2015, 09:42 AM
Very interesting. I'm somewhat surprised to note the mutations are all on HVR1, although that doesn't appear to have much bearing on the classification. Probably just a coincidence.

khanabadoshi
08-12-2015, 10:06 AM
I got mtDNA Full Sequence results. I've been kicked out of the A8a club; back to regular old A8!

For your viewing leisure, some salient data for you good folks to interpret and explain:

https://i.gyazo.com/f6ff20cc411ab3033394ed0c38628768.png

https://i.gyazo.com/91c3f6a400591a6aec14140d231f52d8.png

https://i.gyazo.com/65e216a6d3ac351efc943c3adce0f66b.png

Gisele H
09-20-2015, 05:03 PM
Is it not likely that the 16289.1T is really 16290T which is expected in haplogroup A? This would mean that the insertion was a 'C' at or after site no. 16290.

lgmayka
09-24-2015, 11:08 PM
I got mtDNA Full Sequence results. I've been kicked out of the A8a club; back to regular old A8!
My project has two members belonging to A8 (https://www.familytreedna.com/public/polish?iframe=mtresults). (Their HVR1 results match.)

khanabadoshi
09-27-2015, 12:01 AM
Is it not likely that the 16289.1T is really 16290T which is expected in haplogroup A? This would mean that the insertion was a 'C' at or after site no. 16290.

I was hoping someone smart would answer your query and then I'd figure out what this means -- through osmosis. LOL.


My project has two members belonging to A8 (https://www.familytreedna.com/public/polish?iframe=mtresults). (Their HVR1 results match.)

These 2 members are my only matches with mtDNA :D

Gisele H
09-27-2015, 09:24 AM
[QUOTE=khanabadoshi;111131]I was hoping someone smart would answer your query and then I'd figure out what this means -- through osmosis. LOL.

Well, my question was rhetorical. :-) 16289.1T means a 'T' after site no. 16289:


1111111111-1111111111111
6666666666-6666666666666
2222222222-2222222223333
8888888889-9999999990000
1234567890-1234567890123
ACAAACCTATCCCCCCCTTAACAG

The CRS has:


11111111111111111111111
66666666666666666666666
22222222222222222223333
88888888899999999990000
12345678901234567890123
ACAAACCTACCCACCCTTAACAG

Gisele H
09-28-2015, 01:27 AM
Whomever told you that you had 16289.1T in a haplogroup A8 sequence erred and this error will certainly affect your ability to find "matches". The mutation is 16290T, instead, like in other haplogroup A sequences. Of 22,525 complete sequences yours is closest to a Ket one. It's differences from the rCRS are as follows (from Mitotool):

AY519486.1 64, 73, 146, 263, 309+C, 315+C, 523-524d, 663, 722, 750, 1438, 1736, 2706, 4248, 4769, 4824, 6779, 7028, 8794, 8860, 9007, 11719, 12705, 14766, 15229, 15326, 16223, 16242, 16290, 16293C, 16319

Your missing 16223T is a mystery but does not affect the classification.

khanabadoshi
09-28-2015, 02:01 AM
Whomever told you that you had 16289.1T in a haplogroup A8 sequence erred and this error will certainly affect your ability to find "matches". The mutation is 16290T, instead, like in other haplogroup A sequences. Of 22,525 complete sequences yours is closest to a Ket one. It's differences from the rCRS are as follows (from Mitotool):

AY519486.1 64, 73, 146, 263, 309+C, 315+C, 523-524d, 663, 722, 750, 1438, 1736, 2706, 4248, 4769, 4824, 6779, 7028, 8794, 8860, 9007, 11719, 12705, 14766, 15229, 15326, 16223, 16242, 16290, 16293C, 16319

Your missing 16223T is a mystery but does not affect the classification.

FTDNA classified me as A8; later A8a; then after full sequence mtDNA reclassified me as A8. You think they made a mistake on the full sequence?

Gisele H
09-28-2015, 03:40 AM
FTDNA classified me as A8; later A8a; then after full sequence mtDNA reclassified me as A8. You think they made a mistake on the full sequence?

Based upon the current definitions at Phylotree, your sequence belongs to A8a. The Ket sequence was also classified as A8a by Mitotool.

http://www.phylotree.org/tree/subtree_N.htm

parasar
01-23-2016, 05:25 PM
Came across this reported mtDNA A from Bengal:
http://voices.nationalgeographic.com/2015/04/21/genographic-southeast-asia/
"I am a Bengali Indian, with both parents born in what is now Bangladesh. While my paternal line is H1* common among S Asians, my Mitochondrial DNA is ‘A” as tested by 23andme Lab in USA. This haplogroup is common among certain native Americans who had crossed over from NE Asia during the ice age. I was surprised by my MT DNA which showed an amazing length of distance travelled down South from Siberia down to S Asia."

Gisele H
01-23-2016, 06:10 PM
Came across this reported mtDNA A from Bengal:
http://voices.nationalgeographic.com/2015/04/21/genographic-southeast-asia/
"I am a Bengali Indian, with both parents born in what is now Bangladesh. While my paternal line is H1* common among S Asians, my Mitochondrial DNA is ‘A” as tested by 23andme Lab in USA. This haplogroup is common among certain native Americans who had crossed over from NE Asia during the ice age. I was surprised by my MT DNA which showed an amazing length of distance travelled down South from Siberia down to S Asia."

It is very unlikely that haplogroup A originated in Siberia, however. In fact, I think it is more likely that it was carried to Siberia from the region around Tibet. It appears to have definitely been carried to India by Tibeto-Burman speakers.

parasar
01-23-2016, 07:07 PM
It is very unlikely that haplogroup A originated in Siberia, however. In fact, I think it is more likely that it was carried to Siberia from the region around Tibet. It appears to have definitely been carried to India by Tibeto-Burman speakers.

I doubt that is the case for all downstream A, but such an origin for N-A overall is possible.

A8 for example I think came from Siberia (Kets, Okunevo, Sakhas, etc.).
http://mbe.oxfordjournals.org/content/suppl/2010/03/01/msq065.DC1/mbe-09-0851-File007.xls

Gisele H
01-24-2016, 02:32 AM
A8 for example I think came from Siberia (Kets, Okunevo, Sakhas, etc.).
http://mbe.oxfordjournals.org/content/suppl/2010/03/01/msq065.DC1/mbe-09-0851-File007.xls

The lineages classified as A8b on that spreadsheet are now A10.

Determining the source of A8 would make an interesting study but one would have to include the Ainu (Horai)/Okhotsk (Sato) and Lebanese (Badro) A8 sequences. There was also something different about the bronze age Okunevo crania (Kozintsev) and nuclear DNA (Allentoft) which would have to be factored in. Also, I wonder if the distribution of A8 could be supportive of Burusho-Yeniseian linguistic theories.

Gisele H
04-02-2016, 04:32 AM
The type of haplogroup A sequence found in the Pazyryk samples is also A8.

MfA
07-09-2017, 12:41 PM
I just noticed your line is under YP4858 with a Syrian.


This seems like another Mitanni lineage, TMRCA fits, Kurdish Z282 is also under the same clade. Anyone know who're the other gentlemen id:YF08495, id:YF04246?

https://abload.de/img/mitanni_z282mfyhs.png

khanabadoshi
07-09-2017, 12:58 PM
I just noticed your line is under YP4858 with a Syrian.


This seems like another Mitanni lineage, TMRCA fits, Kurdish Z282 is also under the same clade. Anyone know who're the other gentlemen id:YF08495, id:YF04246?


https://abload.de/img/mitanni_z282mfyhs.png


The Syrian is a Druze from As-Suwayda. The area is 99% Druze, so this was very surprising to me. I have been trying to get more information on him and the others, but so far have been unsuccessful.
How/When/Why this line got the Pakistan is perplexing me more and more haha.

I think the majority of people under R-Y17491 are Kurdish? Your blog has has a few Kurds in this group if I remember.

MfA
07-09-2017, 01:13 PM
The Syrian is a Druze from As-Suwayda. The area is 99% Druze, so this was very surprising to me. I have been trying to get more information on him and the others, but so far have been unsuccessful.
How/When/Why this line got the Pakistan is perplexing me more and more haha.

I think the majority of people under R-Y17491 are Kurdish? Your blog has has a few Kurds in this group if I remember.

There're some Druzes having Kurdish ancestry, but would be speculation to say if it's recent Kurdish ancestry for him or not, TMRCA doesnt support that at least for now, so it seems autochthonous atm. I wouldn't say majority is Kurdish for sure but yeah many Kurdish R1a falls under the clade. One Kurdish tribe is YP5820 shared with an Armenian AFAIK.

lgmayka
07-09-2017, 02:47 PM
Anyone know who're the other gentlemen id:YF08495, id:YF04246?
Public R1a Project results (https://www.familytreedna.com/public/R1a?iframe=yresults) suggest that YF04246 (R-YP5930 (https://yfull.com/tree/R-YP5930/)) is probably #132838 of Poland.

pegasus
07-10-2017, 03:25 AM
There're some Druzes having Kurdish ancestry, but would be speculation to say if it's recent Kurdish ancestry for him or not, TMRCA doesnt support that at least for now, so it seems autochthonous atm. I wouldn't say majority is Kurdish for sure but yeah many Kurdish R1a falls under the clade. One Kurdish tribe is YP5820 shared with an Armenian AFAIK.

YES, this is true. There are Druzes who are of Kurdish origin. The most famous among them are the Joumblatts or Joumpalats. For the most part Druzes have not allowed new converts after the 11th century and practice a level of severe endogamy akin to that practiced among some upper caste Hindus. There are also Druze villages in remote NW Syria my assumption is these people were also former Kurds.

khanabadoshi
07-18-2017, 10:07 AM
There're some Druzes having Kurdish ancestry, but would be speculation to say if it's recent Kurdish ancestry for him or not, TMRCA doesnt support that at least for now, so it seems autochthonous atm. I wouldn't say majority is Kurdish for sure but yeah many Kurdish R1a falls under the clade. One Kurdish tribe is YP5820 shared with an Armenian AFAIK.


YES, this is true. There are Druzes who are of Kurdish origin. The most famous among them are the Joumblatts or Joumpalats. For the most part Druzes have not allowed new converts after the 11th century and practice a level of severe endogamy akin to that practiced among some upper caste Hindus. There are also Druze villages in remote NW Syria my assumption is these people were also former Kurds.



Found the Druze in my FTDNA matches. Under paternal he has the following listed:



فرع حمدان الحمدان؛ آل الحمدان؛ كناكر؛ السويداء


Looks like his surname is Al-Hamdan (https://en.wikipedia.org/wiki/Al_Hamdan) and he is from Kanaker, Syria (https://en.wikipedia.org/wiki/Kanaker,_Syria).



The Al Hamdan claim descent from the Hamdanids (https://en.wikipedia.org/wiki/Hamdanid_dynasty) (Banu Hamdan), an Arab (https://en.wikipedia.org/wiki/Arab) dynasty that governed much of northern Syria during Fatimid (https://en.wikipedia.org/wiki/Fatimid_Caliphate) rule in the 10th century.[1] (https://en.wikipedia.org/wiki/Al_Hamdan#cite_note-Firro40-1) This claim is accepted by 20th-century French historian N. Bouron and Druze historian A. Najjar.[1] (https://en.wikipedia.org/wiki/Al_Hamdan#cite_note-Firro40-1) However, Druze (https://en.wikipedia.org/wiki/Druze) historian Kais Firro views the claim of Hamdanid descent as skeptical and believes the Al Hamdan invented and spread it to boost their legitimacy as leaders of the Druze community, which generally held great respect for noble genealogy.[1] (https://en.wikipedia.org/wiki/Al_Hamdan#cite_note-Firro40-1) According to Al Hamdan tradition, members of the family adopted the Druze faith during the Fatimid era, and migrated to Mount Lebanon (https://en.wikipedia.org/wiki/Mount_Lebanon) during the Fatimid decline in Syria.[1] (https://en.wikipedia.org/wiki/Al_Hamdan#cite_note-Firro40-1) However, early Druze chronicles do not mention conversion to the Druze religion among any members of the Hamdanid dynasty.[1] (https://en.wikipedia.org/wiki/Al_Hamdan#cite_note-Firro40-1) In Mount Lebanon, the Al Hamdan were based in the village of Kafra.