View Full Version : I found a clan Etruscan? I think that this is likely
Acque agitate
01-16-2016, 12:45 PM
Some time ago, analyzing the Study of Partecipanza of San Giovanni in Persiceto (Bologna), I realized that there was an abnormal concentration of samples R1b-U152 (not specified if L2+, Z36+, Z56+, etc.) having DYS385II=17. I refer to an abnormal concentration in the sense that this mutation is rare (almost absent) in the Project R1b. At that time I was too busy to look for samples close to me and so I decided not to pursue this coincidence.
Lately I have realized that, at the moment, the research related to my group is probably a waste of time and so I decided to investigate the coincidence concerning San Giovanni in Persiceto, a place I know very well.
The step n° 1 was to verify whether this coincidence was also present in other studies. The result was this:
1) This abnormal concentration is present also in the Studio of Professor Ferri, namely the study that analyzed the Province of Modena (in the border with San Giovanni in Persiceto). I remember that in this study are shown only samples generic R1b;
2) This abnormal concentration is present also in the work of 2013 in which were analyzed many italian samples and, as regards to the group R1b, only concerns samples R1b-U152 (xL2); namely n° 7 samples. But what is most interesting is the location of these samples: they are all concentrated in Toscana, except n° 1 located in Sardegna (actually it was discovered that the relationship between the two areas was very intense in Etruscan period) and n° 1 in Veneto;
I was very intrigued by these coincidences, and then I wanted to analyze the data of the Project R1b-U152 (step n° 2). I found this:
A) The only group that contains the rare mutation DYS385II=17 with a good frequency is the Group Z56+. The mutation is present in only 2 other cases, where it looks like a random event;
B ) In Group Z56+ the rare mutation concerns a very large number of samples, of which a good part is Italian and all these samples from Etruscan locations or location of Etruscan colonization (except for a sample coming from the Alps);
C) Analyzing the data of the Project R1b-U152, it seems to me that the subgroup that could represent this rare mutation is: U152> Z56, Z42, Z43> 22087296> Z71 et al.> CTS6389 et al.;
Step n° 3 was to verify if there were other details concerning this subgroup (U152> Z56, Z42, Z43> 22087296> Z71 et al.> CTS6389 et al.). As usual I have served the admirable work of Richard Rocca (its Excel spreadsheet) and I found this:
a) 4 Italian samples very interesting belong to this subgroup;
b) 2 of these 4 samples are from Toscana-Etruria (Sesto Fiorentino, 1000 Genomes);
c) the other two from Sardegna (Studio Francalacci), an area commercially and culturally connected to the Etruscans (I do not provide the data for not bore you);
In the light of the facts that I have written, I think is very likely that:
I) The rare mutation DYS385II=17 identifies a Etruscan clan between the Bronze Age and Iron Age in the historical Etruria;
II) Some elements of this clan were part of those Etruscans who crossed the Appennini and were based in Bologna, they have begun to colonize and occupy the western areas (before the current province of Bologna, then Modena, Reggio Emilia and perhaps much more);
III) Some of the not italian samples who own this rare mutation are the descendants of the people that, in the Roman imperial period, have settled out of Etruria (soldiers, traders, etc.);
Obviously this is a hypothesis, which can be confirmed in the future when the samples e the data will be more numerous and complete. I will also accurate that dating seems to coincide. On this point, however, I will not bring arguments to avoid controversy that I do not love (unfortunately now, for the dating of the Group R1b-U152, I'm a heretic because I do not think that the dating of YFull is correct; maybe one day I'll change my mind).
A final consideration. This forum was attended by a person who in my opinion belongs to the subgroup that I have described. It would be interesting if this person did the specific test to verify his belonging to the subgroup (if so, he might feel a real Etruscan :):):))
Greetings to all.
Titus Valerius
01-23-2016, 07:06 PM
Hi all, a friend of mine F. Bernardini has DYS385II=17 and he's U152+ Z56+ Z71+ Z72+ and he's waiting for the results of Big Y. His earliest known ancestor was from Sarzana- La Spezia- Italy- circa 1300 a.C.
In Boattini's paper , in province of La Spezia, there are two U152+ with Dys 385II=17 and one U152+ with Dys385II=16
Titus Valerius
01-23-2016, 09:19 PM
Hi, in addition there is another friend of mine, L. Basteri from the same area who is U152+ Z56+ Z71+ Z72-, but he has DYS385II=11-14. So I think everyone who has Dys385a,b=12-17 or 11-16 are Z72+
Acque agitate
01-23-2016, 10:44 PM
I am glad that sample Bernardini will test Bigy. I await with great curiosity the result.
It would be interesting if sample Guido Panara did the test.
Hi all, a friend of mine F. Bernardini has DYS385II=17 and he's U152+ Z56+ Z71+ Z72+ and he's waiting for the results of Big Y. His earliest known ancestor was from Sarzana- La Spezia- Italy- circa 1300 a.C.
In Boattini's paper , in province of La Spezia, there are two U152+ with Dys 385II=17 and one U152+ with Dys385II=16
His earliest known ancestor was from Sarzana- La Spezia- Italy- circa 1300 a.C. ???
1300 a.C. ? how can he say this ? has he investigated archives succefully ? It is really rare in Italy to go with papers before Council of Trento about the second half 1500. It is possible to go before that date but only for notable and rich family using the notary documents and in this last case there is always a certain inaccuracy in the research. I don't trust any assertion of date before 1600 for normal family and consider that for normal people surname in many case disappear before the first half of 1600 also for the church records.
Titus Valerius
01-24-2016, 09:39 PM
Hi all. We used the notary documents and the "Codice Pelavicino"
Titus Valerius
01-24-2016, 10:00 PM
Hi, in Sarzana during 1700 several family trees were made using notary documents. In addition there are: the Registrum Novum, the Codice Pelavicino and many other ancient documents rich of names! We were lucky!
Diana
01-25-2016, 07:17 AM
I am glad that sample Bernardini will test Bigy. I await with great curiosity the result.
It would be interesting if sample Guido Panara did the test.
Hello, which test are you speaking? This is my paternal line.
Diana
01-25-2016, 07:25 AM
I am glad that sample Bernardini will test Bigy. I await with great curiosity the result.
It would be interesting if sample Guido Panara did the test.
7458
This is my father, Guido Panara.. :-)
Titus Valerius
01-25-2016, 08:31 AM
Hi Diana! F. Bernardini is waiting for the results of Big Y! He has DYS385b=17 like your father! F. Bernardini is Z71+ and Z72+ I think your father is Z72+ too. Another friend of mine L. Basteri from the same area has 385b=14 and he's Z71+ but Z72-
Acque agitate
01-25-2016, 11:41 AM
7458
This is my father, Guido Panara.. :-)
Hello Diana,
The photo of your father convinces me more and more of the likelihood of my hypothesis: his face looks really an etruscan man .... Gens Etruscan Tarquinia, Gens Velleia or other gens of Etruscan origin? Obviously I joke but there might be some truth.
I was referring to BigY test or another test which has similar capabilities. Titus Valerius, however, has reported that Mr Bernardini is pending the outcome of the test Bigy. After that he will get the result will be easier to understand if my hypothesis is correct. Similarly, for you it will be easier to understand if it is convenient to undergo a new test (keep in mind that it appears that the BigY Test will be updated soon and this will result in or a decrease in the price or an improvement of the test).
As our forefathers said: Ad maiora
Titus Valerius
01-25-2016, 12:06 PM
My avatar is a "Signum Tabellionis (1197) " of my ancestor Conforto (ca. 1170 - after 1240).
Diana
01-25-2016, 03:14 PM
Hello Diana,
The photo of your father convinces me more and more of the likelihood of my hypothesis: his face looks really an etruscan man .... Gens Etruscan Tarquinia, Gens Velleia or other gens of Etruscan origin? Obviously I joke but there might be some truth.
I was referring to BigY test or another test which has similar capabilities. Titus Valerius, however, has reported that Mr Bernardini is pending the outcome of the test Bigy. After that he will get the result will be easier to understand if my hypothesis is correct. Similarly, for you it will be easier to understand if it is convenient to undergo a new test (keep in mind that it appears that the BigY Test will be updated soon and this will result in or a decrease in the price or an improvement of the test).
As our forefathers said: Ad maiora
My father always told me we were ancient Etruschi. His ancestors were from Orvieto and Palestrina, Umbria. In fact he even owns a home in Porano about 10 minutes from Orvieto.
I remember years ago prior to taking any sort of test reading about a dig where they had testing done on ancient Etruscans and the haplogroup being G something but I have not been able to locate it. My father has always had a strong liking to anything Etruscan. I will discuss this with him, he will be pleased as mentioning we were similar to the Irish upset him slightly lol! I'm sure he will contribute to proving otherwise.
Titus Valerius
01-25-2016, 04:11 PM
Hi, there's another hypothesis, that is Z71 or Z72 or both are Ligures-Apuans. In my area there are a lot of U152s et al. we are waiting for a paper about our popolation and the popolation around Benevento where the Apuans were deported by Romans.
Acque agitate
01-25-2016, 05:21 PM
My father always told me we were ancient Etruschi. His ancestors were from Orvieto and Palestrina, Umbria. In fact he even owns a home in Porano about 10 minutes from Orvieto.
I remember years ago prior to taking any sort of test reading about a dig where they had testing done on ancient Etruscans and the haplogroup being G something but I have not been able to locate it. My father has always had a strong liking to anything Etruscan. I will discuss this with him, he will be pleased as mentioning we were similar to the Irish upset him slightly lol! I'm sure he will contribute to proving otherwise.
Hello Diana, what you say is very helpful for me. I will remember that the ancient name of Orvieto coincides exactly with that of Bologna, ie Velzna. Its meaning is probably rock or camp (which is why Bologna Bononia called in this way, as German Bonn and other European locations).
Hi Diana! F. Bernardini is waiting for the results of Big Y! He has DYS385b=17 like your father! F. Bernardini is Z71+ and Z72+ I think your father is Z72+ too. Another friend of mine L. Basteri from the same area has 385b=14 and he's Z71+ but Z72-
I'm Z71+ and Z72+ , the family comes from Alessandria region about 600 years ago.
DYS385.1 11
DYS385.2 13
Titus Valerius
01-26-2016, 10:21 AM
I'm Z71+ and Z72+ , the family comes from Alessandria region about 600 years ago.
DYS385.1 11
DYS385.2 13
Hi " abds" If your surname is Bonelli, in U152 project I see about you only Z71+ PF6577+ and not Z72+
In U152 project there are only two men Z72+: Mr. Cannon and Mr. Gassin
Has it updated the project or not ?
Hi " abds" If your surname is Bonelli, in U152 project I see about you only Z71+ PF6577+ and not Z72+
In U152 project there are only two men Z72+: Mr. Cannon and Mr. Gassin
Has it updated the project or not ?
yes sure sorry:
ChrY position: 14480870 (+strand)
Reads: 73
Position data: 73G
Weight for G: 1.0
Probability of error: 0.0 (0<->1)
Sample allele: G
Reference (hg19) allele: G
Known SNPs at this position: Z72 • S258 (G->C)
Reference sequence (100bp): CCCAGGGCCAAGGCTACCATAGCAGGCTGGGTGCCTGCATTCTGAGCTGG
G
TGTGGAAGCACTGGGGCTCGGGGAAGTTGGCGGCTTTGATGCCTGAAGGC
(14480819-14480920)
Larth
03-03-2016, 03:04 AM
My father always told me we were ancient Etruschi. His ancestors were from Orvieto and Palestrina, Umbria. In fact he even owns a home in Porano about 10 minutes from Orvieto.
Hi Diana, but your father surname (Panara) seems to be originally from Abruzzo.
Diana
03-03-2016, 04:15 AM
Hi Diana, but your father surname (Panara) seems to be originally from Abruzzo.
Actually there are more Panara's in "Milano", correction from Tuscany what I originally put here..I don't know if they are related to us. Our family have been in Orvieto and area for generations, later becoming Barones of land there from what my father has told me. There are few of us left there. I think Panara may be a derived from the Panaro River, an extention of the River Po but thats speculation. We have no family in Abruzzo from what I know but it really isn't that far away. We are Umbrian.
Diana
03-03-2016, 04:19 AM
I haven't even taken a look to see if we match anyone from Abruzzo. Thanks for the info. May I ask how you came across it? Is it the surname site for Italians?
Diana
03-03-2016, 04:31 AM
"Panara has a strain in Rosate (MI) and in Milan, and one in Chieti and in Bucchianico (CH), Panari, very rare, is typical of Modena and Imola, panario, absolutely rare, it would seem from Savona, Panaro has small strains Genoa, Savona and in the Alessandria area in Acqui Terme and Castelletto d`Erro, has a Campania core between Casal di Principe (CE), Naples and Pozzuoli (NA), one in Paola (CS), but the most important nucleus is definitely Puglia , including Altamura, Alberobello, Monopoli and Bari in Bari, Foggia and in the Foggia Castelluccio and in Massafra (TA). integrations provided by Stefano Ferrazzi Panara has more strains in Chieti and in Milan, Panari and panario rather rare, they are present at low frequency between the north and the north of the town center, Panaro, much more common the previous ones, is more typically southern, with a core between Bari and Taranto and secondary nuclei in Caserta, near Naples, and in Cosenza, all of these surnames derived from the ancient Italian panaro , with meaningful baker, the baker ; in the case of Romagna strains (valid especially for the last Panari), it is not ruled out, however, that the name is derived from place names Modena and, more specifically, to such common Marano sul Panaro, San Felice sul Panaro, San Cesario sul Panaro and Savignano sul Panaro or directly from the Panaro River, a tributary of the Po flowing along the territory"
http://www.ganino.com/cognomi_italiani_p
Romilius
03-03-2016, 06:13 AM
We forget that Titus Livius wrote Etruscan élites imposed themselves on Oscans and Umbrians in Central Italy. So, the commoners and, perhaps, some nobles were Indoeuropeans, not Etruscans.
Larth
03-05-2016, 04:38 PM
Actually there are more Panara's in "Milano", correction from Tuscany what I originally put here..I don't know if they are related to us. Our family have been in Orvieto and area for generations, later becoming Barones of land there from what my father has told me. There are few of us left there. I think Panara may be a derived from the Panaro River, an extention of the River Po but thats speculation. We have no family in Abruzzo from what I know but it really isn't that far away. We are Umbrian.
"Panara has a strain in Rosate (MI) and in Milan, and one in Chieti and in Bucchianico (CH), Panari, very rare, is typical of Modena and Imola, panario, absolutely rare, it would seem from Savona, Panaro has small strains Genoa, Savona and in the Alessandria area in Acqui Terme and Castelletto d`Erro, has a Campania core between Casal di Principe (CE), Naples and Pozzuoli (NA), one in Paola (CS), but the most important nucleus is definitely Puglia , including Altamura, Alberobello, Monopoli and Bari in Bari, Foggia and in the Foggia Castelluccio and in Massafra (TA). integrations provided by Stefano Ferrazzi Panara has more strains in Chieti and in Milan, Panari and panario rather rare, they are present at low frequency between the north and the north of the town center, Panaro, much more common the previous ones, is more typically southern, with a core between Bari and Taranto and secondary nuclei in Caserta, near Naples, and in Cosenza, all of these surnames derived from the ancient Italian panaro , with meaningful baker, the baker ; in the case of Romagna strains (valid especially for the last Panari), it is not ruled out, however, that the name is derived from place names Modena and, more specifically, to such common Marano sul Panaro, San Felice sul Panaro, San Cesario sul Panaro and Savignano sul Panaro or directly from the Panaro River, a tributary of the Po flowing along the territory"
http://www.ganino.com/cognomi_italiani_p
Panara is Abruzzese, no way it's a Tuscan surname, Panara doesn't exist among native Tuscans. Your family were barons in Orvieto? There are no historical records about Barons Panara in Orvieto. The Panara from Umbria, Tuscany, Lazio are all an old migration from Abruzzo and according to a quick search they first settled in southern Umbria. The Panara living in Milan, north Italy, are likely descendants of migrants, because the surname in Lombardy is mostly concentrated in the province of Milan, the most cosmopolitan province of Lombardy full of migrants from the rest of the country. Panari is a different surname but too rare to find the exact roots. That site (ganino.com) is an amateur site.
Diana
03-05-2016, 04:50 PM
Panara is Abruzzese, no way it's a Tuscan surname, Panara doesn't exist among native Tuscans. Your family were barons in Orvieto? There are no historical records about Barons Panara in Orvieto. The Panara from Umbria, Tuscany, Lazio are all an old migration from Abruzzo and according to a quick search they first settled in southern Umbria. The Panara living in Milan, north Italy, are likely descendants of migrants, because the surname in Lombardy is mostly concentrated in the province of Milan, the most cosmopolitan province of Lombardy full of migrants from the rest of the country. Panari is a different surname but too rare to find the exact roots. That site (ganino.com) is an amateur site.
I corrected Tuscany with Milan. I don't know where you are getting your information from. Interesting you have access to historical records from Orvieto.
Show me some proof that the Panara origins come from Abruzzo, I beg to differ on that notion.
Diana
03-05-2016, 04:54 PM
Panara is Abruzzese, no way it's a Tuscan surname, Panara doesn't exist among native Tuscans. Your family were barons in Orvieto? There are no historical records about Barons Panara in Orvieto. The Panara from Umbria, Tuscany, Lazio are all an old migration from Abruzzo and according to a quick search they first settled in southern Umbria. The Panara living in Milan, north Italy, are likely descendants of migrants, because the surname in Lombardy is mostly concentrated in the province of Milan, the most cosmopolitan province of Lombardy full of migrants from the rest of the country. Panari is a different surname but too rare to find the exact roots. That site (ganino.com) is an amateur site.
Who are you exactly and where do you come from? What makes you an expert on Italian surnames and history, just curious? What is your haplogroup?
So far I'm hearing information from a ghost named Larth, no offense. What is your interest in my ancestry?
Larth
03-05-2016, 05:33 PM
Who are you exactly and where do you come from? What makes you an expert on Italian surnames and history, just curious? What is your haplogroup?
So far I'm hearing information from a ghost named Larth, no offense. What is your interest in my ancestry?
I have no interest in your ancestry. I'm fully Italian from Italy with degree in History (BA, MA). I've spent many hours of my time in Italian archives and I'm mostly interested in the genealogy of historic Italian families ("Famiglie Storiche d'Italia") but I do quickly recognize in most cases the origin of a family, of a surname. You can find me here http://www.iagiforum.info/, unfortunately is only in Italian.
vettor
03-05-2016, 05:42 PM
In regards to the surname Panara ...........there are about 113 households in Italy with this name. 45 and 44 split between Lombardy and Abruzzo and the other 18 regions holding less than a handful.
An ara ending to a surname I have never found , ............but an ra ending is usually southern italian.
Italian surnames can be broken down , so what is a Pana ? is it cream, whipped cream?.............Pan is bread in northern italy.
Anyway this site is the best I have found for surname origins in Italy
http://italian.about.com/od/italianculture/a/meaning-italian-last-names.htm
but site have left out some endings like the friulian "gher" and the Veneto "lin"
The veneto lin is always associated with a christian name like
Bartolin
Santolin
Guidolin etc etc
and also the veneto "in".........like Martin, Serafin, Giustin
Diana
03-05-2016, 05:55 PM
I have no interest in your ancestry. I'm fully Italian from Italy with degree in History (BA, MA). I've spent many hours of my time in Italian archives and I'm mostly interested in the genealogy of historic Italian families ("Famiglie Storiche d'Italia") but I do quickly recognize in most cases the origin of a family, of a surname. You can find me here http://www.iagiforum.info/, unfortunately is only in Italian.
Thank you for your input. Coming from your background and knowledge it is appreciated. I will have to find out more from my father about the barons and land he told me about and seek clarification on it.
vettor
03-05-2016, 08:00 PM
Thank you for your input. Coming from your background and knowledge it is appreciated. I will have to find out more from my father about the barons and land he told me about and seek clarification on it.
http://www.cognomix.it/mappe-dei-cognomi-italiani/PANARA
you can drill down further by selecting the region
Diana
03-06-2016, 07:45 AM
http://www.cognomix.it/mappe-dei-cognomi-italiani/PANARA
you can drill down further by selecting the region
This is incorrect. They don't list even 1 Panara in Orvieto and I know of at least 12.
Romilius
03-06-2016, 07:47 AM
I have no interest in your ancestry. I'm fully Italian from Italy with degree in History (BA, MA). I've spent many hours of my time in Italian archives and I'm mostly interested in the genealogy of historic Italian families ("Famiglie Storiche d'Italia") but I do quickly recognize in most cases the origin of a family, of a surname. You can find me here http://www.iagiforum.info/, unfortunately is only in Italian.
I'm sorry, but I'm skeptical when it comes to tie lines and when it comes to say where (and, obviously, when) a surname was born: from my experience as a genealogist, I saw the same surname born in two different places for two different reasons.
Larth
03-06-2016, 03:25 PM
Thank you for your input. Coming from your background and knowledge it is appreciated. I will have to find out more from my father about the barons and land he told me about and seek clarification on it.
The title of baron may be of two or three different types in Italy. The older one is a title of feudal system, middle ages, the most recents date back to pre-unitarian states and the Kingdom of Italy (1861–1946). The latter are easy to verify in the Libro d'Oro of Italian nobility.
This is incorrect. They don't list even 1 Panara in Orvieto and I know of at least 12.
It's based on Italian phone directories.
I'm sorry, but I'm skeptical when it comes to tie lines and when it comes to say where (and, obviously, when) a surname was born: from my experience as a genealogist, I saw the same surname born in two different places for two different reasons.
I do agree that very often it happens, but it doesn't seem in her case. Generally speaking I haven't found so far evidence that in Lombardy is native. The few informations refers to families migrated from elsewhere. Of course, to be absolutely certain it would take a long archival research.
Romilius
03-06-2016, 06:12 PM
The title of baron may be of two or three different types in Italy. The older one is a title of feudal system, middle ages, the most recents date back to pre-unitarian states and the Kingdom of Italy (1861–1946). The latter are easy to verify in the Libro d'Oro of Italian nobility.
It's based on Italian phone directories.
I do agree that very often it happens, but it doesn't seem in her case. Generally speaking I haven't found so far evidence that in Lombardy is native. The few informations refers to families migrated from elsewhere. Of course, to be absolutely certain it would take a long archival research.
That's the argument I would have passed: without a long archival research is nearly impossible to say which surname is native or not in one region. And, of course, in many cases, also an archival research couldn't tell you that. Let's think about the north of Italy: surnames exist for a longer time than, for example, central or southern Italy.
Diana
03-06-2016, 07:59 PM
The title of baron may be of two or three different types in Italy. The older one is a title of feudal system, middle ages, the most recents date back to pre-unitarian states and the Kingdom of Italy (1861–1946). The latter are easy to verify in the Libro d'Oro of Italian nobility.
It's based on Italian phone directories.
I do agree that very often it happens, but it doesn't seem in her case. Generally speaking I haven't found so far evidence that in Lombardy is native. The few informations refers to families migrated from elsewhere. Of course, to be absolutely certain it would take a long archival research.
Surnames are very young in comparison to Italian history. Orvieto is less then a 3 hour drive to Abruzzo. Likely some of us moved there prior to or around the the time of surnames being used. What does our YDNA say to you?
Diana
03-06-2016, 08:18 PM
In regards to the surname Panara ...........there are about 113 households in Italy with this name. 45 and 44 split between Lombardy and Abruzzo and the other 18 regions holding less than a handful.
An ara ending to a surname I have never found , ............but an ra ending is usually southern italian.
Italian surnames can be broken down , so what is a Pana ? is it cream, whipped cream?.............Pan is bread in northern italy.
Anyway this site is the best I have found for surname origins in Italy
http://italian.about.com/od/italianculture/a/meaning-italian-last-names.htm
but site have left out some endings like the friulian "gher" and the Veneto "lin"
The veneto lin is always associated with a christian name like
Bartolin
Santolin
Guidolin etc etc
and also the veneto "in".........like Martin, Serafin, Giustin
Maybe the Panaro River stands for whipped cream River or bread river too.
Diana
03-06-2016, 08:24 PM
The title of baron may be of two or three different types in Italy. The older one is a title of feudal system, middle ages, the most recents date back to pre-unitarian states and the Kingdom of Italy (1861–1946). The latter are easy to verify in the Libro d'Oro of Italian nobility.
It's based on Italian phone directories.
I do agree that very often it happens, but it doesn't seem in her case. Generally speaking I haven't found so far evidence that in Lombardy is native. The few informations refers to families migrated from elsewhere. Of course, to be absolutely certain it would take a long archival research.
So it is thus in accurate and can't possibly give us a proper idea of how many Panara's are in the Lombardy region just as it doesn't account for not even one of my immediate family members from Orvieto.
Diana
03-06-2016, 10:19 PM
The connection to Tuscany is via information from the 1k Genomes project in comparison with Z56. I haven't dismissed the fact that the highest concentration of my male lines haplogroup as far as I know for now is in Tuscany which genetically links us there prior to the surname.
Powered by vBulletin® Version 4.2.5 Copyright © 2021 vBulletin Solutions Inc. All rights reserved.