PDA

View Full Version : FTDNA is now offering a R1b - Z49 SNP Pack



MitchellSince1893
06-24-2016, 04:11 PM
R1b - Z49 SNP Pack

Includes the following SNPs on the haplotree:
U152, L2, Z49, Z150, S42, CTS7970, CTS8125, CTS11381, Z51, L562, Z57, Z148, Z149, Z52, CTS11232, CTS278, Z367, PF6658, Y4355, S8183, Z193, Z68, S22778, Y16862, Y17181, Y17179, Y17180, Y17176, Y4356, Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610, Y4353, Y4354, S12993, FGC31475, BY3626, FGC20775, FGC20778, FGC20779, FGC20781, FGC20780, FGC20782, FGC20786, Y16875, Y16876, Y16877, Y16878, Y17272, Y17273, Y17274, Z142, S18325, FGC22942, FGC22963, FGC22969, FGC22968, Z12222, Z26720, CTS9490, BY3624, A8451, A8453, A8454, A8455, BY3612, BY1210, BY3617, BY1350, BY1375, FGC37040, FGC37041, FGC37043, FGC37046, FGC37047, FGC37048, FGC37049, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, L553, BY3616, L654, BY1542, A6296, A6297, A6298, A6300, A6301, A6302, CTS7197, S1491, S1480, BY3623, BY3625, Z147, Z53, BY3613, BY3614, BY3615, BY3618, BY3620, BY3621, BY3622, ZP67, Y18894, Y18895, Y18896, Y18897, BZ28, Y18899, S20376, BY5702, BY1701, FGC22938, FGC22941, FGC22952, FGC22956, Y17276, Y17277, Y17278, Y17279, Y17280, BY5699, BY5704, BY5703, BY5698, BY5700, BY5694, BY5692, BY5693, BY5695, BY5696, BY5697, BY5701, BY5722, BY5723, BY5724, BY5725

Includes the following SNPs that are NOT on the haplotree:
S8172, Z18331, A8433, A8434, A8438, A8439, A8440, Z29988, Z29989, A8442, Z29990, A8443, CTS4962, S20782, BY5721, BY1349

jbarry6899
06-24-2016, 06:13 PM
Our surname project really lucked out. This SNP Pack contains a number of markers that, to date, are exclusive to our family line, to wit: Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610 and BY 5698. They give us the potential to confirm genealogical relationships within the past 300-500 years. I'm hoping that some of the members who have been reluctant to do deeper testing will take advantage of this opportunity, and have contacted about a dozen of them to encourage them to order the SNP Pack.

MitchellSince1893
06-24-2016, 10:14 PM
Our surname project really lucked out. This SNP Pack contains a number of markers that, to date, are exclusive to our family line, to wit: Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610 and BY 5698. They give us the potential to confirm genealogical relationships within the past 300-500 years. I'm hoping that some of the members who have been reluctant to do deeper testing will take advantage of this opportunity, and have contacted about a dozen of them to encourage them to order the SNP Pack.

Hopefully there will be an opportunity for an update to the Z49 pack.

Last week, with the release of a close matches' FGC results, approximately 17 of my formerly private BigY SNPs became terminal SNPs, forming a new branch below R-FGC12401.

kinman
06-25-2016, 02:45 AM
Hi all,
I am rather frustrated with all these new BY#### and Y#### numbers. I haven't found a way to determine their position numbers (except to wait for ISOGG to eventually provide that information; which could be a very long wait). I am now in BY5692, but have no idea which position number that corresponds to. And on the YFull tree, never could figure out the position number for Y19124.
------------------Ken

-----------------------------------------------------------------------------------------------------------------------------------------------------------------


R1b - Z49 SNP Pack

Includes the following SNPs on the haplotree:
U152, L2, Z49, Z150, S42, CTS7970, CTS8125, CTS11381, Z51, L562, Z57, Z148, Z149, Z52, CTS11232, CTS278, Z367, PF6658, Y4355, S8183, Z193, Z68, S22778, Y16862, Y17181, Y17179, Y17180, Y17176, Y4356, Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610, Y4353, Y4354, S12993, FGC31475, BY3626, FGC20775, FGC20778, FGC20779, FGC20781, FGC20780, FGC20782, FGC20786, Y16875, Y16876, Y16877, Y16878, Y17272, Y17273, Y17274, Z142, S18325, FGC22942, FGC22963, FGC22969, FGC22968, Z12222, Z26720, CTS9490, BY3624, A8451, A8453, A8454, A8455, BY3612, BY1210, BY3617, BY1350, BY1375, FGC37040, FGC37041, FGC37043, FGC37046, FGC37047, FGC37048, FGC37049, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, L553, BY3616, L654, BY1542, A6296, A6297, A6298, A6300, A6301, A6302, CTS7197, S1491, S1480, BY3623, BY3625, Z147, Z53, BY3613, BY3614, BY3615, BY3618, BY3620, BY3621, BY3622, ZP67, Y18894, Y18895, Y18896, Y18897, BZ28, Y18899, S20376, BY5702, BY1701, FGC22938, FGC22941, FGC22952, FGC22956, Y17276, Y17277, Y17278, Y17279, Y17280, BY5699, BY5704, BY5703, BY5698, BY5700, BY5694, BY5692, BY5693, BY5695, BY5696, BY5697, BY5701, BY5722, BY5723, BY5724, BY5725

Includes the following SNPs that are NOT on the haplotree:
S8172, Z18331, A8433, A8434, A8438, A8439, A8440, Z29988, Z29989, A8442, Z29990, A8443, CTS4962, S20782, BY5721, BY1349

lgmayka
06-25-2016, 03:08 AM
And on the YFull tree, never could figure out the position number for Y19124.
1) Go to the YFull SNP search page (https://yfull.com/search-snp-in-tree/)
2) Enter Y19124, and click the search button
3) Click on the R-Y19124 hyperlink (https://yfull.com/tree/R-Y19124/)
4) Click on the word "info" to bring up a popup window
5) Select the "SNPs" tab
6) Click on the magnifying glass next to Y19124

You will see:
---
SNP details
ChrY position: 2960016 (+strand)
Reference sequence (100bp): GTGAGGCAGGAGAATCGCTTGAACCCAGGAGGTGGAGGTTACAGTGAGCT
G
AGACAGCACCGTTGCAGCTTGGGCGACAGAGCAAGACTCGGTCTTCAAAA
(2959965-2960066)
---

kinman
06-25-2016, 01:36 PM
Thanks Igmayka,
That helps me a lot to know how to do that. But I am very surprised that 2960016 does not appear on Williamson's Big Tree: http://ytree.net/DisplayTree.php?blockID=1224 . I guess that means that Williamson missed that one, or YFull made a mistake.
--------------Ken

MitchellSince1893
06-25-2016, 02:20 PM
Not sure if this is the reason for the difference, but Big tree analysis and subsequent results are primarily based on analysis of .bed and .vcf files.

While Ytree is based on analysis of the .bam file. So it may not be that something was missed but rather what they are analyzing and/or criteria for what is acceptable.

Your best bet is to contact Alex Williamson and ask about this specific situation.

kw5368
06-25-2016, 03:56 PM
This new pack doesn't help me. I already know that I am positive for S42 and CTS7197 so I'm still stuck for a while I guess. I hope that it will bring more matches to my little group of close matches though. Neither of these SNPs come up at Yfull.com. I guess the group is too small. I fit in somewhere below R-S7402, but I'm not sure where. I do wish that they would get a standardized naming of SNPs.

Ken

MitchellSince1893
06-26-2016, 03:24 PM
This new pack doesn't help me. I already know that I am positive for S42 and CTS7197 so I'm still stuck for a while I guess. I hope that it will bring more matches to my little group of close matches though. Neither of these SNPs come up at Yfull.com. I guess the group is too small. I fit in somewhere below R-S7402, but I'm not sure where. I do wish that they would get a standardized naming of SNPs.

Ken

A way ahead is to ask those that end up R-S7402 and have the smallest genetic distance with your STR markers to order a few $17.50 private SNPs of yours from YSEQ.net. If they come back positive you could encourage them to order BigY or FGC Y Elite to discover even more shared SNPs.

This approach worked for over the last year...at least 16 formerly private SNPS forming a new branch.

TigerMW
06-27-2016, 09:13 PM
Hopefully there will be an opportunity for an update to the Z49 pack.

Last week, with the release of a close matches' FGC results, approximately 17 of my formerly private BigY SNPs became terminal SNPs, forming a new branch below R-FGC12401.
A request was submitted to add at least one SNP for this new branch below FGC12401.

From the formal list of SNPs on the Advanced Orders web site, the coverage of the Z49 tree looks like this. This is my opinion. I have not seen FTDNA's haplotree on this.

^ L2/S139 05755550-C-T
^ ^ Z367/S255 09810794-T-C
^ ^ Z49 28462237-G-T
_ _ Z68/S485 21058323-C-T
^ ^ ^ BY3613 07911232-G-A
_ _ _ BY3614 08351220-T-A
_ _ _ BY3615 09875990-G-A
_ _ _ BY3618 18426210-C-A
_ _ _ BY3620 18931192-C-G
_ _ _ BY3621 18945200-C-A
_ _ _ BY3622 18954214-A-T
^ ^ ^ S8183 02665967-G-T
^ ^ ^ ^ S22778 21260728-T-C
^ ^ ^ ^ ^ S20782 18188853-G-A
^ ^ ^ ^ ^ Y16862 17354634-G-A
_ _ _ _ _ Y17181 19282874-G-A
_ _ _ _ _ Y17179 14892862-C-T
_ _ _ _ _ Y17180 16350552-G-A
^ ^ ^ ^ ^ ^ Y17176 08425530-G-A
^ ^ ^ ^ Y4356/FGC31474 23883529-C-T
^ ^ ^ ^ ^ Y11179/FGC36705 02807605-A-G
_ _ _ _ _ Y11180 16463430-C-G
_ _ _ _ _ Y11181/FGC36720 16699687-C-T
_ _ _ _ _ Y11182/FGC36722 17412298-G-T
_ _ _ _ _ Y11183/FGC36714 14414832-G-A
_ _ _ _ _ Y11184/FGC36719 16243192-A-T
_ _ _ _ _ Y11185/FGC36723 17509523-G-A
_ _ _ _ _ Y11186/FGC36725 18617554-T-G
^ ^ ^ ^ ^ ^ ^ Y13610/FGC36710 07823757-G-T
_ _ _ _ _ _ _ BY5701/FGC36710 20732566-T-A
^ ^ ^ ^ ^ ^ ^ ^ BY5697 15582095-G-A
^ ^ ^ ^ ^ Y4353/FGC20796 17760314-T-C
^ ^ ^ ^ ^ ^ BY3626/FGC20812 06762871-CAAAT-C
_ _ _ _ _ _ FGC31475 13218678-C-T
_ _ _ _ _ _ S12993/S12993 10025720-C-T
_ _ _ _ _ _ Y4354/FGC20774 08356636-T-C
^ ^ ^ ^ ^ ^ ^ S8172 23595215-A-G
^ ^ ^ ^ ^ ^ ^ Y4355/FGC20777 06707665-A-G
^ ^ ^ ^ ^ ^ ^ ^ FGC20775/Y14088 02842598-T-C
_ _ _ _ _ _ _ _ FGC20778/Y14135 06804217-T-G
_ _ _ _ _ _ _ _ FGC20779/Y14089 07315755-T-G
_ _ _ _ _ _ _ _ FGC20781/Y14137 07611397-C-G
_ _ _ _ _ _ _ _ FGC20780/Y14136 07523890-C-A
_ _ _ _ _ _ _ _ FGC20782/Y14138 08854928-C-T
_ _ _ _ _ _ _ _ FGC20786/Y14090 14079163-T-G
^ ^ ^ ^ ^ ^ ^ ^ Y17276 07804169-A-G
_ _ _ _ _ _ _ _ Y17277 08300943-G-C
_ _ _ _ _ _ _ _ Y17278 08455264-G-C
_ _ _ _ _ _ _ _ Y17279 16249348-C-T
_ _ _ _ _ _ _ _ Y17280 23842484-C-T
^ ^ ^ ^ ^ ^ ^ ^ ^ Y16875 08502847-G-A
_ _ _ _ _ _ _ _ _ Y16876 14116113-A-T
_ _ _ _ _ _ _ _ _ Y16877 15151876-C-T
_ _ _ _ _ _ _ _ _ Y16878 22867750-T-C
_ _ _ _ _ _ _ _ _ Y17272 21970374-T-C
_ _ _ _ _ _ _ _ _ Y17273 02888065-C-T
_ _ _ _ _ _ _ _ _ Y17274 07637297-T-C
^ ^ ^ ^ ^ ^ ^ ^ Z18331 22444300-T-G
^ ^ ^ Y18894 17673197-C-T
_ _ _ Y18895 14206391-T-C
_ _ _ Y18896 17045258-C-T
_ _ _ Y18897 17278611-T-C
_ _ _ Y18899 06935417-C-T
_ _ _ BZ28/Y18898 18642795-G-A
^ ^ ^ Z142/S211 16787539-A-G
^ ^ ^ ^ FGC22963 19066987-C-T
_ _ _ _ FGC22969 22146356-C-T
^ ^ ^ ^ ^ ZP67/FGC22940 09102995-G-A
_ _ _ _ _ FGC22968 22141669-G-C
^ ^ ^ ^ ^ ^ FGC22942 09798767-C-T
_ _ _ _ _ _ S18325 16445533-T-G
^ ^ ^ ^ ^ ^ ^ FGC22952/Z28496 15945084-C-T
_ _ _ _ _ _ _ FGC22956 16589450-G-C
^ ^ ^ ^ ^ ^ ^ ^ FGC22938 07546898-C-A
_ _ _ _ _ _ _ _ FGC22941 09395783-G-A
^ ^ ^ ^ ^ ^ ^ BY5692 06859970-C-G
_ _ _ _ _ _ _ BY5693 07160122-G-A
_ _ _ _ _ _ _ BY5695 07915917-T-A
_ _ _ _ _ _ _ BY5696 08793207-A-G
^ ^ ^ ^ ^ ^ ^ ^ BY5694 07269016-C-A
_ _ _ _ _ _ _ _ BY5700 18761287-A-G
^ ^ ^ ^ ^ BY5699 18084613-T-A
_ _ _ _ _ BY5704 26495417-A-T
^ ^ ^ ^ ^ ^ BY5722 07862582-G-A
_ _ _ _ _ _ BY5723 07902781-A-G
_ _ _ _ _ _ BY5724 07976811-A-G
_ _ _ _ _ _ BY5725 08312085-A-G
^ ^ ^ ^ Z12222/S7402 08413680-A-G
_ _ _ _ Z150/S257 03989476-T-C
_ _ _ _ Z26720/S7402 22867545-A-T
^ ^ ^ ^ ^ CTS9490/M1146 18928795-C-A
_ _ _ _ _ BY3624/A8812 24447090-A-G
^ ^ ^ ^ ^ ^ CTS7970/S7404 17771915-C-T
^ ^ ^ ^ ^ ^ ^ A8451 14066378-T-C
_ _ _ _ _ _ _ A8454/S7409 19531938-C-T
_ _ _ _ _ _ _ A8453/BY1438 18563403-G-T
_ _ _ _ _ _ _ A8455/BY1805 21985235-T-C
^ ^ ^ ^ ^ ^ ^ ^ BY1350/A8804 17571024-T-A
_ _ _ _ _ _ _ _ BY1375/A8805 17908123-C-T
_ _ _ _ _ _ _ _ BY3612/A8801 07169408-C-T
_ _ _ _ _ _ _ _ BY3617/A8803 15915461-A-G
_ _ _ _ _ _ _ _ BY3624/A8812 24447090-A-G
_ _ _ _ _ _ _ _ BY1210 15819689-T-C
^ ^ ^ ^ ^ ^ ^ CTS8125 17843894-G-A
^ ^ ^ ^ ^ ^ ^ ^ CTS11381 23088814-A-G
^ ^ ^ ^ ^ ^ FGC37040/Y17092 09893096-A-C
_ _ _ _ _ _ FGC37041/Y17091 06628883-T-C
_ _ _ _ _ _ FGC37043/Y17094 07766998-A-T
_ _ _ _ _ _ FGC37046/Y17080 07106812-T-G
_ _ _ _ _ _ FGC37047/Y17082 07771702-A-G
_ _ _ _ _ _ FGC37048/Y17095 08676248-G-T
_ _ _ _ _ _ FGC37049/Y17084 08808671-A-T
^ ^ ^ ^ ^ FGC12378/Y10987 21690021-G-T
_ _ _ _ _ FGC12379/Y3142 07224581-G-C
_ _ _ _ _ FGC12380/Y3143 06833853-C-T
_ _ _ _ _ FGC12381/Y3140 09852155-C-T
_ _ _ _ _ FGC12382/Y3144 06754788-G-C
^ ^ ^ ^ ^ ^ FGC12383/Y3141 07733015-T-G
^ ^ ^ ^ ^ ^ ^ FGC12401/Y10984 19436291-G-A
_ _ _ _ _ _ _ FGC12402/Y10985 21290212-A-G
_ _ _ _ _ _ _ FGC12404/Y10986 22771081-G-A
^ ^ ^ ^ ^ ^ ^ ^ BY5698/Y19291 16387379-A-G
^ ^ ^ ^ ^ ^ ^ S20376 17909529-G-T
_ _ _ _ _ _ _ BY5702 22440780-A-T
^ ^ ^ ^ ^ L553 14577522-C-T
_ _ _ _ _ BY3616 14834642-T-G
^ ^ ^ ^ ^ L654 02888600-T-C
_ _ _ _ _ BY1542 19477303-G-C
_ _ _ _ _ BY1701 20815008-C-T
^ ^ ^ ^ ^ ^ S42 21706472-T-C
_ _ _ _ _ _ A6296 07220271-G-A
_ _ _ _ _ _ A6297 07589975-G-A
_ _ _ _ _ _ A6298 08289208-A-C
_ _ _ _ _ _ A6300 16855836-T-A
_ _ _ _ _ _ A6301 17251991-G-A
_ _ _ _ _ _ A6302 19160449-C-G
^ ^ ^ ^ ^ ^ ^ CTS7197 17342637-G-A
^ ^ ^ ^ ^ ^ BY5703 23503477-A-G
^ ^ ^ ^ Z51/S369 15662576-A-G
_ _ _ _ L562/S213/Z50 09790893-G-A
^ ^ ^ ^ ^ Z57/S1468 02650701-G-A
^ ^ ^ ^ ^ ^ S1491 17861407-G-C
^ ^ ^ ^ ^ ^ ^ S1480 16472013-G-T
_ _ _ _ _ _ _ BY3623/YP4766 19089111-C-T
_ _ _ _ _ _ _ BY3625 28711762-G-A
^ ^ ^ ^ ^ ^ ^ ^ A8433 06925867-T-C
_ _ _ _ _ _ _ _ A8434 07570972-G-A
_ _ _ _ _ _ _ _ A8438 15107679-T-C
_ _ _ _ _ _ _ _ A8439 17578459-C-T
_ _ _ _ _ _ _ _ A8440 18595622-T-C
^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Z29988 23154451-G-C
^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Z29989 02797205-G-A
_ _ _ _ _ _ _ _ _ _ A8442 08397340-G-T
_ _ _ _ _ _ _ _ _ _ Z29990 15754236-G-A
_ _ _ _ _ _ _ _ _ _ A8443 09885704-G-A
^ ^ ^ ^ ^ ^ ^ ^ BY1349/A8446 17569474-G-A
_ _ _ _ _ _ _ _ BY5721 07569474-G-A
^ ^ ^ ^ ^ ^ Z147 16512405-C-G
_ _ _ _ _ _ Z148/S489 16742300-A-T
^ ^ ^ ^ ^ ^ ^ Z52 06893107-G-A
_ _ _ _ _ _ _ Z53/S214 08893906-C-A
_ _ _ _ _ _ _ Z149/S490 09052518-T-C
^ ^ ^ ^ ^ ^ ^ ^ CTS11232 23025429-C-T
^ ^ ^ ^ ^ ^ ^ ^ CTS278 02866994-G-C
_ _ _ _ _ _ _ _ CTS4962 15927028-T-G

MitchellSince1893
06-27-2016, 10:35 PM
A request was submitted to add at least one SNP for this new branch below FGC12401.

From the formal list of SNPs on the Advanced Orders web site, the coverage of the Z49 tree looks like this. This is my opinion. I have not seen FTDNA's haplotree on this.

^ L2/S139 05755550-C-T
^ ^ Z49 28462237-G-T
^ ^ ^ Z142/S211 16787539-A-G
^ ^ ^ ^ Z12222/S7402 08413680-A-G
_ _ _ _ Z150/S257 03989476-T-C
^ ^ ^ ^ ^ FGC12378/Y10987 21690021-G-T
_ _ _ _ _ FGC12379/Y3142 07224581-G-C
_ _ _ _ _ FGC12380/Y3143 06833853-C-T
_ _ _ _ _ FGC12381/Y3140 09852155-C-T
_ _ _ _ _ FGC12382/Y3144 06754788-G-C
^ ^ ^ ^ ^ ^ FGC12383/Y3141 07733015-T-G
^ ^ ^ ^ ^ ^ ^ FGC12401/Y10984 19436291-G-A
_ _ _ _ _ _ _ FGC12402/Y10985 21290212-A-G
_ _ _ _ _ _ _ FGC12404/Y10986 22771081-G-A
^ ^ ^ ^ ^ ^ ^ ^ BY5698/Y19291 16387379-A-G
^ ^ ^ ^ ^ ^ ^ S20376 17909529-G-T
_ _ _ _ _ _ _ BY5702 22440780-A-T


Yes this branch has been previously identified.

The new one includes these SNPs
7881772 C>G FGC12385
8194117 T>G FGC12387
8290583 T>C FGC12388
9795464 C>G FGC12389
13713820 T>C FGC12392
13871171 G>A FGC47889
14497774 A>C FGC12393
15878557 C>T FGC12396
15971853 G>A FGC12397
16185253 G>A FGC12398
17003970 T>C FGC12399
17299391 C>T FGC12400
20408815 C>T FGC47894
22486450 G>A FGC47870
23969601 G>A FGC12406

Currently there's no way of knowing which of these SNPs occurred earliest. So it may be better to wait until this branch can be broken down further.

Walkman
06-27-2016, 10:35 PM
I've been anxiously awaiting this Z49 SNP pack and just ordered it for my R-U152-Z49 line. :beerchug:

MitchellSince1893
06-28-2016, 04:41 PM
I would like to publicly thank Mikewww for all he's doing behind the scenes on the SNP tests.

TigerMW
06-28-2016, 08:20 PM
Thanks, Mark. :)

Walkman
06-29-2016, 01:26 AM
I would like to publicly thank Mikewww for all he's doing behind the scenes on the SNP tests.

Seconded! Thanks, Mike and thanks for your inputs too, Mark.

MitchellSince1893
06-29-2016, 12:19 PM
Woohoo, two SNPs identified only a couple of weeks ago as forming a new branch under R-FGC12401 (via FGC Y Elite 2.1 results) are now in the Z49 SNP pack.

I commend FTDNA for being very quick to respond to a request to add them.

Updated Z49 SNP pack with additions in bold


SNP Pack R1b - Z49 SNP Pack
Includes the following SNPs on the haplotree:
U152, L2, Z49, Z150, S42, CTS7970, CTS8125, CTS11381, Z51, L562, Z57, Z148, Z149, Z52, CTS11232, CTS278, Z367, PF6658, Y4355, S8183, Z193, Z68, S22778, Y16862, Y17181, Y17179, Y17180, Y17176, Y4356, Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610, Y4353, Y4354, S12993, FGC31475, BY3626, FGC20775, FGC20778, FGC20779, FGC20781, FGC20780, FGC20782, FGC20786, Y16875, Y16876, Y16877, Y16878, Y17272, Y17273, Y17274, Z142, S18325, FGC22942, FGC22963, FGC22969, FGC22968, Z12222, Z26720, CTS9490, BY3624, A8451, A8453, A8454, A8455, BY3612, BY1210, BY3617, BY1350, BY1375, FGC37040, FGC37041, FGC37043, FGC37046, FGC37047, FGC37048, FGC37049, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, L553, BY3616, L654, BY1542, A6296, A6297, A6298, A6300, A6301, A6302, CTS7197, S1491, S1480, BY3623, BY3625, Z147, Z53, BY3613, BY3614, BY3615, BY3618, BY3620, BY3621, BY3622, ZP67, Y18894, Y18895, Y18896, Y18897, BZ28, Y18899, S20376, BY5702, BY1701, FGC22938, FGC22941, FGC22952, FGC22956, Y17276, Y17277, Y17278, Y17279, Y17280, BY5699, BY5704, BY5703, BY5698, BY5700, BY5694, BY5692, BY5693, BY5695, BY5696, BY5697, BY5701, BY5722, BY5723, BY5724, BY5725

Includes the following SNPs that are NOT on the haplotree:
S8172, Z18331, A8433, A8434, A8438, A8439, A8440, Z29988, Z29989, A8442, Z29990, A8443, CTS4962, S20782, BY5721, BY1349, FGC12384, FGC12385

For those on the fence on the BigY and FGC Y Elite tests, this is a good example of their benefits.
1. My BigY test found these two private SNPs via FGC analysis of my BigY results which identified almost 30 private SNPs
2. A close match took FGC Y Elite 2.1 and matched ~16 of my private SNPs.
3. Two of these SNPs are now on the FTDNA Z49 pack which will help identify additional matches.

Without individuals taking the BigY and Y Elite tests, none of this would have been possible.

kw5368
06-30-2016, 06:39 PM
Woohoo, two SNPs identified only a couple of weeks ago as forming a new branch under R-FGC12401 (via FGC Y Elite 2.1 results) are now in the Z49 SNP pack.

I commend FTDNA for being very quick to respond to a request to add them.

Updated Z49 SNP pack with additions in bold



For those on the fence on the BigY and FGC Y Elite tests, this is a good example of their benefits.
1. My BigY test found these two private SNPs via FGC analysis of my BigY results which identified almost 30 private SNPs
2. A close match took FGC Y Elite 2.1 and matched ~16 of my private SNPs.
3. Two of these SNPs are now on the FTDNA Z49 pack which will help identify additional matches.

Without individuals taking the BigY and Y Elite tests, none of this would have been possible.

I am on the fence about taking the BigY test. Are there any $100 coupons out there right now? I think I would do it if I could find a coupon.

Ken

MitchellSince1893
06-30-2016, 08:24 PM
In 2013 FTDNA had a summer sale in July
In 2014 FTDNA had a summer sale in Aug
In 2015 I don't think they had a summer sale
No idea if they will have one this summer.

kinman
07-01-2016, 01:25 AM
I think you are right that they didn't have a summer sale in 2015.
I waited for a coupon and ordered Big Y in early October 2015. I think the cost was $475.
I guess you would call that an early autumn sale.
------------------------------------------------------------------------------------------------------------


In 2013 FTDNA had a summer sale in July
In 2014 FTDNA had a summer sale in Aug
In 2015 I don't think they had a summer sale
No idea if they will have one this summer.

kinman
07-01-2016, 02:13 AM
I am glad to have position numbers (below) for my subclade BY5692 (incl. BY5693, BY5695, and BY5696). But there are another 19 SNPs in this subclade, and I noticed that these four named ones (which can now be tested individually at FTDNA) are the first four SNPs when you list them in order of position numbers. But there is no reason to assume that these four are the earliest mutations.
I understand that they couldn't name and offer tests for all 23 SNPs, but why did they chose the first four. I guess this must be an arbitrary selection which may or may not be the most useful in subdividing the clade.
By the way, one of those other 19 SNPs already had a name, M359 (a.k.a. P41), which has had an SNP test at Yseq.net for a while. And I assume that almost all of 23 have Y numbers at YFull (and that four of those are synonyms of the BY#### numbers of FTDNA).
------------Ken


^ ^ ^ ^ FGC22963 19066987-C-T
_ _ _ _ FGC22969 22146356-C-T
^ ^ ^ ^ ^ ZP67/FGC22940 09102995-G-A
_ _ _ _ _ FGC22968 22141669-G-C
^ ^ ^ ^ ^ ^ FGC22942 09798767-C-T
_ _ _ _ _ _ S18325 16445533-T-G
^ ^ ^ ^ ^ ^ ^ FGC22952/Z28496 15945084-C-T
_ _ _ _ _ _ _ FGC22956 16589450-G-C
^ ^ ^ ^ ^ ^ ^ ^ FGC22938 07546898-C-A
_ _ _ _ _ _ _ _ FGC22941 09395783-G-A
^ ^ ^ ^ ^ ^ ^ BY5692 06859970-C-G
_ _ _ _ _ _ _ BY5693 07160122-G-A
_ _ _ _ _ _ _ BY5695 07915917-T-A
_ _ _ _ _ _ _ BY5696 08793207-A-G
^ ^ ^ ^ ^ ^ ^ ^ BY5694 07269016-C-A
_ _ _ _ _ _ _ _ BY5700 18761287-A-G
^ ^ ^ ^ ^ BY5699 18084613-T-A
_ _ _ _ _ BY5704 26495417-A-T
^ ^ ^ ^ ^ ^ BY5722 07862582-G-A
_ _ _ _ _ _ BY5723 07902781-A-G
_ _ _ _ _ _ BY5724 07976811-A-G
_ _ _ _ _ _ BY5725 08312085-A-G

MitchellSince1893
07-01-2016, 03:10 AM
As its currently unknown which SNPs are the earliest they went with the lowest named which in my case was also the lowest position SNPs. As there are at least a handful of SNPs we don't share, I'm pretty sure the two FTDNA chose are going to be close to 1000 years old.

For my purpose/goal it will work. New matches will hopefully lead to additional testing.

kw5368
07-01-2016, 04:29 PM
In 2013 FTDNA had a summer sale in July
In 2014 FTDNA had a summer sale in Aug
In 2015 I don't think they had a summer sale
No idea if they will have one this summer.

Thanks. I will keep an eye out. If you see something, let me know.

Ken

MitchellSince1893
07-01-2016, 06:48 PM
All things being equal I have noticed that new branches are often named after the lowest numbered position. So if you or FTDNA have to pick some random ones why not the lowest position ones.

kinman
07-02-2016, 01:36 AM
Well, I am no expert on probabilities. But I suspect that there might be a slightly better probability for some parts of the chromosome to mutate more readily than others. And that those parts would tend to be farther away from the centromere than near to it. Since the centromere is almost always left of center, I would be tempted to pick the highest numbered positions as being slightly more likely to have arisen earlier than later. I have no proof of this, but I would have probably recommended doing the exact opposite of what they did (and pick the 4 highest numbered SNPs, not the 4 lowest numbered SNPs). I guess only time will tell if one way is better than the other.
-----------------Ken
---------------------------------------------------------------------------------------------------------------------------


All things being equal I have noticed that new branches are often named after the lowest numbered position. So if you or FTDNA have to pick some random ones why not the lowest position ones.

MitchellSince1893
07-02-2016, 05:23 AM
Well, I am no expert on probabilities. But I suspect that there might be a slightly better probability for some parts of the chromosome to mutate more readily than others. And that those parts would tend to be farther away from the centromere than near to it. Since the centromere is almost always left of center, I would be tempted to pick the highest numbered positions as being slightly more likely to have arisen earlier than later. I have no proof of this, but I would have probably recommended doing the exact opposite of what they did (and pick the 4 highest numbered SNPs, not the 4 lowest numbered SNPs). I guess only time will tell if one way is better than the other.
-----------------Ken
---------------------------------------------------------------------------------------------------------------------------

Your post inspired me to do an experiment on the position of SNPs going from R-L23 through R-U152 down to my private SNPs. I was expecting the positions to be a totally random scatter shot; but to my surprise a visible pattern emerged.

I had forgotten that I had noticed this pattern when back in November 2014 a new match to my BigY results shared 5 of my 28 private SNPs. What struck me as odd/non random was that they were all in position and name order. FGC12401, FGC12402, FGC12403, FGC12404, FGC12405. Of all my 28 SNPs why did the new branch end up being these 5 similarly positioned/in sequential position SNPs?

While this is no means 100%, it appears, that SNPs within a block/branch tend to be similar to each other in being positioned closer to the beginning/end of the Y chromosome and being on the left or right side of the centromere.

Also it appears there is a better than average chance that if the earlier branch is closer to one end of the Y chromsome, the next branch down will be the opposite. That is they tend to flip flop.

If this bears out then the take away might be to select SNPs that are a mirror image of the previous branch. i.e. if the previous branch tended to be positioned closer to the end, then select SNPs closer to the beginning.

The image below illustrates this pattern.

10094

Looking at my list of SNPs, it wouldn't surprise me if future branching occurs within this currently single block with

FGC12384
FGC12385
FGC12387
FGC12388
FGC12389
FGC47886

forming the next branch down and

FGC12392
FGC47889
FGC12393
FGC12396
FGC12397
FGC12398
FGC12399
FGC12400
FGC12406

forming a branch below that.

Walkman
07-30-2016, 07:51 PM
My Z49 SNP Pack results are in and, drum roll please, survey says:

U152>Z49>BY3613,BY3614,BY3615,BY3618.

MitchellSince1893
07-30-2016, 08:34 PM
My Z49 SNP Pack results are in and, drum roll please, survey says:

U152>Z49>BY3613,BY3614,BY3615,BY3618.


Congratulations, but how did you switch from U106 to U152?

Your signature says you are "Paternal Y-DNA: R-U106>BY118"

Walkman
07-31-2016, 03:57 AM
Congratulations, but how did you switch from U106 to U152?

Your signature says you are "Paternal Y-DNA: R-U106>BY118"

Correct, I remain U106. "My" Z49 SNP Pack was run on my first cousin, twice removed, i.e., U152 is my paternal grandfather's maternal grandfather's Y-DNA. (See my verbose signature. :))

Petr
07-31-2016, 09:36 AM
My Z49 results arrived as well:
10710

Z18331 = 22444300(T/G) and in the U152 and Subclades Phylogenetic Tree by Richard Rocca is placed differently, but still not on my tree. Results of other test don't confirm this mutation:
BigY: 2A 1C 174T 114G
FGC Elite: 1A 630T 90G
FGC WG 15x: 11T 5G
My father's BigY: 140T 74G

lgmayka
08-01-2016, 10:21 PM
My Z49 results arrived as well:
Z18331 = 22444300(T/G) and in the U152 and Subclades Phylogenetic Tree by Richard Rocca is placed differently, but still not on my tree.
#195719 of Poland tested:
Y4354+
S12993+
S8172+
Z18331+

wlongabaugh
08-02-2016, 04:55 AM
My Z49 results arrived as well:
10710

Z18331 = 22444300(T/G) and in the U152 and Subclades Phylogenetic Tree by Richard Rocca is placed differently, but still not on my tree. Results of other test don't confirm this mutation:
BigY: 2A 1C 174T 114G
FGC Elite: 1A 630T 90G
FGC WG 15x: 11T 5G
My father's BigY: 140T 74G

10750

Based on the results I just got back from my Z49 SNP pack, things are even weirder, as the above screen capture shows. I am Z18331+, but S8183-, Y4356-, Y4353-, Y4254-, Y4355- (and the Rocca tree puts Z18331 under Y4355). According to other kits on the U152 subclades group, there are a dozen other kits out there with the same results. Seems to me that Z18331 belongs upstream of S8183?

MitchellSince1893
08-26-2016, 10:08 PM
For those that have already done the Z49 pack, was there a delay between initial identification as Z49 and later identification of subclades?

I really hoping this is the case because I just got the Z49 test results for a man that has done the FGC Y Elite 2.1 and is confirmed to be positive for these FTDNA Z49 SNP Pack test SNPs:
Z49, Z142, Z150, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, FGC12384, and FGC12385.

Currently he is only shown as positive for Z49 on FTDNA. Also it shows his Z49 SNP test is completed.

wlongabaugh
08-26-2016, 11:23 PM
I was actually assigned immediately to my subclade, Z18331. But since that result was crazy, I decided to do Big Y. Since that result came back, I too have been parked at Z49, as their haplotree is now in need of revision. Maybe the new Z49 results coming in are revealing their current tree is inconsistent, and they are parking kits at Z49 while they straighten things out?

MitchellSince1893
08-27-2016, 01:58 AM
I'm thinking it's not done processing yet because on the FTDNA haplotree it doesn't say he has tested positive or negative for any SNPs below Z49.

In fact the tree has a special offer for the Z49 Pack...which he just completed. Hopefully this will resolve itself soon.

wlongabaugh
08-27-2016, 05:28 AM
I jumped on the new Z49 SNP Pack very soon after release, and I had red and green SNPs showing up in my tree the day I got my results back early this month. I also got my clade assignment right away, even though my results showed the tree had Z18331 in the wrong place. Does the list of SNP results shown in the big list at the bottom of the tree indicate any of the new SNP results? Or does a CSV download indicate the new SNPs? Maybe they are suspicious of the results below Z-49 and are having a second look?

MitchellSince1893
08-27-2016, 01:09 PM
Just learned the testee ordered the Z49 individual SNP test rather than the Z49 SNP Pack test.

wlongabaugh
09-03-2016, 08:33 PM
Just wondering, if a man has FGC Y Elite 2.1 results that he is Z49+ all the way down to beyond FGC12404+ on the tree, why would a standalone Z49 SNP test be beneficial? It turns out in my case that my recent BigY results actually only had a single (albeit high quality, and consistent) read of my Z49 SNP, and so was not called. So for me, my Z49 SNP Pack results are filling in a blank that was not covered by BigY.

MitchellSince1893
09-30-2016, 03:33 AM
Z49 SNP pack just paid off for me. It just found a match that shares two of the SNPs from my terminal branch...FGC12384 and FGC12385.

Both of these SNPs ended up on the Z49 test because of their discovery via the Y Elite 2.1 test. FTDNA and Mikewww where very helpful in getting both these SNPs added at the last moment.