View Full Version : DF41 (L21>DF13>DF41)
TigerMW
08-31-2014, 12:40 AM
Yes, of those 30, it looks like 19 are "point" SNPs which would be the best shot at good stable SNPs.
Samuel also has a group of "point" SNPs downstream that only he has. Good news for our illustrious project admin, something to shoot for.
I sent FTDNA one of those "Request New SNPs" forms, but I included all 19 SNPs on a single form. I hope that is kosher.
Robinson, kit U2676, recently got his Big Y results. He is CTS6581+ (DF41+) and, of course, CTS2501+. I sent him an email asking him to join the R-DF41 and Subclades Project. He has an odd haplotype, with 19=15 and YCAIIa=17, so he has no matches beyond 12 markers, and he has only tested to 37 markers. Robinson is an adopted surname (it says that in his public mdka entry, so it's okay to mention it).
I don't know whether or not he has contributed his Big Y raw data for analysis/comparison, so I asked him to email them to Mike Walsh.
TigerMW
09-01-2014, 09:29 PM
Robinson, kit U2676, recently got his Big Y results. He is CTS6581+ (DF41+) and, of course, CTS2501+. I sent him an email asking him to join the R-DF41 and Subclades Project. He has an odd haplotype, with 19=15 and YCAIIa=17, so he has no matches beyond 12 markers, and he has only tested to 37 markers. Robinson is an adopted surname (it says that in his public mdka entry, so it's okay to mention it).
I don't know whether or not he has contributed his Big Y raw data for analysis/comparison, so I asked him to email it to Mike Walsh
I do not have his raw results (.vcf/.bed compressed file folder). If I get it I'll make sure it gets into the shared folder which means Alex Williamson and about 3 or 4 others will include it in their analyses and those are free.
Below are the instructions for the individual since project administrators can't do it for a member.
-----------------------------------------
These results are only useful if shared so they can be compared across people. We currently have a comparison including more than 440 L21+ people. To do the comparison, please send me your raw results. Here's how.
Sign in to your myFTDNA account.
Select the OTHER RESULTS drop-down menu in the dark blue bar and select BIG Y RESULTS
On the BIG Y RESULTS screen select the blue DOWNLOAD RAW RESULTS button on the right.
At this point, you may see an error message related to "Houston". If that happens, please check again the next day. It takes a few days for FTDNA to update these files.
If you don't get the error message, then just select DOWNLOAD and then finally SAVE FILE okay.
A zipped (compressed) file should download very quickly.
Please email me the file you downloaded. mwwdna at gmail dot com
Thank you. I'll upload the file to a shared space for L21 and several analysts and myself will try to compare with the other raw results we have to understand L21's tree down to the modern era. The primary discussion for this takes place at https://groups.yahoo.com/neo/groups/R1b-L21-Project/
Please join in if you haven't already.
TigerMW
09-01-2014, 09:36 PM
Rich,
Below are the DF41+ Big Y results that I do have. If you see anyone missing please ask them to share their info. The STR variety assignments are probably a bit out of date.
f284562 Black 41-103-z1013
f35212 McCrere 41-114-563-z1411
f252939 Dixon 41-114-uas
f47694 MacMillan 41-21-uas
f17609 Conn 41-21-z9919
f21647 McCleland 41-40-04-MC
f22849 McCown 41-40-04-MC
f29705 McCown 41-40-04-MC
f240201 Walker 41-40-5584-5581
f32434 Morrison 41-40-5584-5581
f52062 Miller 41-40-5584-5581
f170555 McBurney 41-40-5584-uas
fE16164 Stuart 41-775-745-781
f147822 Stuart 41-775-745-uas
f239315 Thompson 41-775-745-uas
f256138 Ward 41-775-745-uas
f283694 Stewart 41-775-745-uas
f35963 Pearce 41-775-745-uas
f75703 zzzUnk(Webb) 41-775-745-uas
f116493 Matthews 41-775-uas
fN76583 Ryley 41-775-uas
f223212 Louw 41-uas
f53479 Selfe 41-z1123
fN104746 Samuel 41-z1123
f31023 Lamberson 41-z1410
f348926 Lamberson 41-z1410
FTDNA is calling those 19 solid SNPs shared by Dave Samuel and Chuck Self BY160 - BY178, respectively.
Here they are:
06915643G>A BY160
07452170A>T BY161
07506815C>T BY162
07550689A>T BY163
08121160T>C BY164
08172198C>T BY165
08487637T>G BY166
08702545C>T BY167
09963504A>T BY168
15330376T>C BY169
15590482G>C BY170
17676955T>C BY171
19118561C>T BY172
19278814T>C BY173
21384510G>T BY174
22466490G>A BY175
22917674T>C BY176
22933398G>A BY177
23866490C>T BY178
It's a start! :beerchug:
Mike has designated the new DF41 subclade for cluster 41-1123 by the first SNP in the list above, BY160 (06915643G>A). FTDNA is not yet offering it for sale a la carte, so I looked for it in YSEQ's catalog. I couldn't find it, so I filled out one of those "Wish a SNP" things with YSEQ. (Wishing for the SNP cost me a dollar! Yikes!).
Mike has designated the new DF41 subclade for cluster 41-1123 by the first SNP in the list above, BY160 (06915643G>A). FTDNA is not yet offering it for sale a la carte, so I looked for it in YSEQ's catalog. I couldn't find it, so I filled out one of those "Wish a SNP" things with YSEQ. (Wishing for the SNP cost me a dollar! Yikes!).
BY160 aka Z18014 is now available for sale from YSEQ (http://shop.yseq.net/index.php) for $35.
The lead SNP for the 41-1123 cluster's clade has been changed from BY160 to BY166 because FTDNA has BY166 for sale now under Advanced Orders. BY166 is 08487637T>G, btw.
Anyway, now I can order it from FTDNA.
The lead SNP for the 41-1123 cluster's clade has been changed from BY160 to BY166 because FTDNA has BY166 for sale now under Advanced Orders. BY166 is 08487637T>G, btw.
Anyway, now I can order it from FTDNA.
I spent all day today up in the hospital and had surgery for something very painful. Once I got home, I managed to stagger to the computer and order BY166 from FTDNA. The pain meds made me do it.
Seems like no one but me is interested in the DF41 subforum, so it won't hurt if I reveal the little known truth that Dr. Xavier has discovered that Wolverine is DF41+. ;) (More pain med talk.)
2692
TigerMW
09-30-2014, 10:48 AM
I spent all day today up in the hospital and had surgery for something very painful. Once I got home, I managed to stagger to the computer and order BY166 from FTDNA. The pain meds made me do it.
Seems like no one but me is interested in the DF41 subforum, so it won't hurt if I reveal the little known truth that Dr. Xavier has discovered that Wolverine is DF41+. ;) (More pain med talk.)
We wish you a quick recovery, Rich!
This will be interesting to see what happens with BY166.
Anything can happen I guess, but I fully expect to be BY166+, given that it was found in one of my very closest 111-marker matches (105/111) and in another DF41+ who isn't as close to him but is a member of our cluster.
One thing about all the additional SNPs and phylogenetic tree branches revealed by NGS testing: once you get out on your terminal or nearly terminal twig, it starts to get a little lonely, and the discussion dwindles in the extreme.
It gets a little like trying to generate a discussion about your 3rd great grandfather's shoe size.
Back when most of us were stuck at M269, there was no shortage of company or exciting conversation. :pop2:
TigerMW
10-04-2014, 06:40 PM
One thing about all the additional SNPs and phylogenetic tree branches revealed by NGS testing: once you get out on your terminal or nearly terminal twig, it starts to get a little lonely, and the discussion dwindles in the extreme.
It gets a little like trying to generate a discussion about your 3rd great grandfather's shoe size.
Back when most of us were stuck at M269, there was no shortage of company or exciting conversation. :pop2:
Unfortunately, project initiatives or project related initiatives are getting a bit fractured. Some of this is due to the additional genetic genealogy testing competition. The competition is good.
When you are in a big group like L21, there so many initiatives, there is always someone to talk to, but when you dwindle down to a smaller number, like the testers in DF41, the facturing of initiatives and forums really starts to hurt. There are at two very passionate and avid positing DF41 NGS testers. One is driven by initiatives other than the FTDNA project formats you are used too.
Over in the L513 group, there is plenty to talk about. I just don't have time to post as much as I'd like because we have so many NGS testers the data just keeps coming in. The fine layering in the tree is fascinating.
I think the data is swamping us, in general.... less time to talk and less focus on what happened 3000 years ago, more on 1500 years ago and on in. We are entering true genetic genealogy with the SNP testing. Overlaying it with the long STR haplotypes is working.
David Mc
10-04-2014, 10:38 PM
I feel your pain, Rich. The same kind of thing happens for those of us who are stuck in a "*" category with wide-branching subclades below. I'm still waiting for Big Y results ordered last June... maybe there will be something to connect on then. Other than that, it feels kind of like being stuck in genetic limbo.
I know that what we're finding out now is more revealing, it's just that each new SNP and subclade is revealing to fewer and fewer people, so there are fewer people interested in it. I used to have a pretty good working knowledge of just about all the major y haplogroups. Now it's nearly impossible just to keep up with all of L21, let alone all the rest.
I just got an email from FTDNA saying that the new SNP BY160 is now on sale. They're a little late now that they have already offered BY166 and, as a consequence, BY166 was chosen to represent the new subclade.
You all may remember me talking awhile back about a Cavanaugh, kit 125069, who is a 64/67 match for Nolen, kit 110225. Finally, after several months, I heard back from Cavanaugh. He has joined the R L21 and Subclades Project and has ordered a DF41 test. Obviously, he is in the 1410 cluster along with Nolen and the others. His mdka is a Michael Kavanagh, b. 1675 in Rathanna, County Carlow, Ireland. I'll ask him to join the DF41 Project, as well
Quite often lately I feel like the lone ghost in the DF41 subforum ghost town. I can almost hear a mournful wind rattling broken, cobwebbed shutters and see tumble weeds blowing down dusty, forgotten streets.
Where are all the other DF41+ guys? :\
Dubhthach
10-17-2014, 03:56 PM
Haven't disapeared, from what I can see in the pending results we have a total of 7 DF41 bigY's pending. I think Sotomayor's one could be quite interesting, given his Iberian ancestry.
Haven't disapeared, from what I can see in the pending results we have a total of 7 DF41 bigY's pending. I think Sotomayor's one could be quite interesting, given his Iberian ancestry.
Yes, especially since he traces his y-dna ancestry to Galicia.
Dubhthach
10-18-2014, 07:53 AM
Yes, especially since he traces his y-dna ancestry to Galicia.
Did you see the email with regards to create the haplogroup panel (akin to the recent M222 beta panel). We need to draw up a bunch of SNP's that we can use for a DF41 panel.
Given that we have 10 SNP's marked as equivalent to DF41 (CTS2501 + 8 others) we probably need to include a chunk of those so as to at least see if we can catch any that might show up negative in someone.
I note on Alex's tree that some of these don't appear to have been covered in all the BigY tests, you can see them marked with "?" on specific BigY tests.
---
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
---
At the very least we need at least the following:
DF41/CTS2501/Y2368/Y2369/Y2371/Y2372
A41/A44/MC03/MC05
..... (Larry could help here as it's his cluster -- 1426c)
S775
Z18013/A600
A291 (debatable at this level?)
L744/L745/L746
S781
A102/A103/A105/A107
(waiting on another BigY for cluster that Lamberson/Nolen is in)
BY166 (this is available from FTDNA, you've tested positive)
MC21
FGC14676/FGC14683/FGC14692
L563
That's very basic first go, it's add up to circa 28 snp's ideally for clusters with a long string of SNP's (1426, my cluster, your cluster) we probably need 4-6 snp's so as to cover early branches (eg. try and find like a S775)
Opinions?
-Paul
Did you see the email with regards to create the haplogroup panel (akin to the recent M222 beta panel). We need to draw up a bunch of SNP's that we can use for a DF41 panel.
Given that we have 10 SNP's marked as equivalent to DF41 (CTS2501 + 8 others) we probably need to include a chunk of those so as to at least see if we can catch any that might show up negative in someone.
I note on Alex's tree that some of these don't appear to have been covered in all the BigY tests, you can see them marked with "?" on specific BigY tests.
---
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
---
At the very least we need at least the following:
DF41/CTS2501/Y2368/Y2369/Y2371/Y2372
A41/A44/MC03/MC05
..... (Larry could help here as it's his cluster -- 1426c)
S775
Z18013/A600
A291 (debatable at this level?)
L744/L745/L746
S781
A102/A103/A105/A107
(waiting on another BigY for cluster that Lamberson/Nolen is in)
BY166 (this is available from FTDNA, you've tested positive)
MC21
FGC14676/FGC14683/FGC14692
L563
That's very basic first go, it's add up to circa 28 snp's ideally for clusters with a long string of SNP's (1426, my cluster, your cluster) we probably need 4-6 snp's so as to cover early branches (eg. try and find like a S775)
Opinions?
-Paul
I did see that email. Your ideas sound good to me.
glamberson
10-23-2014, 09:53 AM
Hi guys, Work has kept me pretty busy, but I'm still around and looking forward to Sotomayer and Cavanaugh results. As you say, it gets a little quiet when we get more specific. However, I do think there's opportunity to make further strides with the information we have, particularly in the melding of SNP and STR data. I certainly wish I had a better grasp of it myself.
It would be really really amazing if we could come up with a way to combine this data into a rough but unified analysis. I myself was wondering this morning if it made more sense to order the SNP diagram more in line with what the STR mdka data shows. But I suspect the smart people could do more with this data. Anyway, those are my thoughts.
I'm looking forward to the day when a DF41+ result pops up in a set of ancient remains. Of course, with our luck, it will probably be when, at some Iron Age site, they unearth the body of the local village idiot. ;)
TigerMW
11-12-2014, 02:01 PM
Did you see the email with regards to create the haplogroup panel (akin to the recent M222 beta panel). We need to draw up a bunch of SNP's that we can use for a DF41 panel.
Given that we have 10 SNP's marked as equivalent to DF41 (CTS2501 + 8 others) we probably need to include a chunk of those so as to at least see if we can catch any that might show up negative in someone.
I note on Alex's tree that some of these don't appear to have been covered in all the BigY tests, you can see them marked with "?" on specific BigY tests.
---
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
---
At the very least we need at least the following:
DF41/CTS2501/Y2368/Y2369/Y2371/Y2372
A41/A44/MC03/MC05
..... (Larry could help here as it's his cluster -- 1426c)
S775
Z18013/A600
A291 (debatable at this level?)
L744/L745/L746
S781
A102/A103/A105/A107
(waiting on another BigY for cluster that Lamberson/Nolen is in)
BY166 (this is available from FTDNA, you've tested positive)
MC21
FGC14676/FGC14683/FGC14692
L563
That's very basic first go, it's add up to circa 28 snp's ideally for clusters with a long string of SNP's (1426, my cluster, your cluster) we probably need 4-6 snp's so as to cover early branches (eg. try and find like a S775)
Opinions?
-Paul
I just noticed that these SNPs are available now on FTDNA's upgrade orders/advanced testing menu under the "Y" names.
Y2368/FGC7999
Y2369/FGC5564
Y2371/FGC13007
Y2372/FGC8001
Y2374/FGC7998
Dubhthach
11-12-2014, 04:51 PM
I just noticed that these SNPs are available now on FTDNA's upgrade orders/advanced testing menu under the "Y" names.
Y2368/FGC7999
Y2369/FGC5564
Y2371/FGC13007
Y2372/FGC8001
Y2374/FGC7998
Indeed Sotomayor (origins Iberian via Peurto Rico) didn't return a result for 4 of these in his BigY which is fairly typical. On examination of his BAM he was positive for two of them, I've ordered the other two (Y2369 and Y2372) for him through FTDNA.
Could be an interesting result.
-Paul
TigerMW
11-12-2014, 05:40 PM
Indeed Sotomayor (origins Iberian via Peurto Rico) didn't return a result for 4 of these in his BigY which is fairly typical. On examination of his BAM he was positive for two of them, I've ordered the other two (Y2369 and Y2372) for him through FTDNA.
Could be an interesting result.
-Paul
I have been remiss in submitting SNPs to FTDNA for stand alone offering. I think YSEQ can respond immediately but with FTDNA we need to do the submissions. Are there other key SNPs for DF41 we need to request? I'm not sure who requested these Y series SNPs.
Dubhthach
03-03-2015, 09:09 PM
I see Fisher who is more distant from myself and Black has just got his BigY results. He is positive for A100 which looks like it's a good SNP to define the cluster. This SNP is available from yseq: http://www.yseq.net/product_info.php?products_id=6017
It's also on ISOGG tree, the current DF41 ISOGG tree looks like the following:
• • • • • • • • • • • • R1b1a2a1a2c1i CTS2501/S836, CTS6581/DF41/S524
• • • • • • • • • • • • • R1b1a2a1a2c1i* -
• • • • • • • • • • • • • R1b1a2a1a2c1i1 S775
• • • • • • • • • • • • • • R1b1a2a1a2c1i1* -
• • • • • • • • • • • • • • R1b1a2a1a2c1i1a L744/S388, L745/S463, L746/S310
• • • • • • • • • • • • • • • R1b1a2a1a2c1i1a* -
• • • • • • • • • • • • • • • R1b1a2a1a2c1i1a1 S781
• • • • • • • • • • • • • • R1b1a2a1a2c1i1b A600
• • • • • • • • • • • • • R1b1a2a1a2c1i2 BY114/FGC14692
• • • • • • • • • • • • • • R1b1a2a1a2c1i2* -
• • • • • • • • • • • • • • R1b1a2a1a2c1i2a L563
• • • • • • • • • • • • • R1b1a2a1a2c1i3 MC21
• • • • • • • • • • • • • R1b1a2a1a2c1i4 A874
• • • • • • • • • • • • • • R1b1a2a1a2c1i4* -
• • • • • • • • • • • • • • R1b1a2a1a2c1i4a A1786
• • • • • • • • • • • • • R1b1a2a1a2c1i5 A40/FGC5583
• • • • • • • • • • • • • R1b1a2a1a2c1i6 A100/FGC8628/Y3517
• • • • • • • • • • • • • R1b1a2a1a2c1i7 FGC13017
• • • • • • • • • • • • • R1b1a2a1a2c1i8 BY166/Z18021
Arkgirl
05-25-2015, 12:05 AM
My uncle just found out he was on the line that tested for r-DF41/ R-CTS2501 [DF41-A874]....can you explain what that exactly means as far as heritage?
My uncle just found out he was on the line that tested for r-DF41/ R-CTS2501 [DF41-A874]....can you explain what that exactly means as far as heritage?
Hard to say definitively. A874 thus far seems to be mostly men with the surname Riggs, but it is interesting there is a Dutchman there whose haplotype is different from the rest.
Thus far DF41 is mostly an Isles phenomenon, but we do have a few continentals.
simdadams
07-02-2015, 05:16 PM
Hi Just Joined I'm on a few groups mainly ftdna. with big y I am R-CTS2501 MC21 and FTDMA number is 397394 , I also have a BAM file analysis if thats of any use, means nowt to me
Dubhthach
07-03-2015, 01:50 PM
Welcome to the forum, you are the third MC21+ man to do a BigY / NGS (Next Generation Sequencing) test. So far your clade under DF41/CTS2501 is looking quite old as you aren't particulary close to the other two (McMillian, Conn).
Here's a link to Alex Williamson's DF41 tree (built using NGS results) as you can see you are in MC21 "block" with McMillian and Conn.
http://ytree.net/DisplayTree.php?blockID=7
-Paul
Dubhthach
07-06-2015, 04:34 PM
Obviously our part of the DF13 tree is quite sparse on FTDNA's Haplotree, with only CTS2501 marked! (thus DF41+ men are often down as predicted M269 or L21+, when it comes to haplogroups!)
Anyways I've been thinking we need to have a DF41/CTS2501 bundle pack, sorta like what M222, CTS4466 and Z253 have. Using ISOGG tree as a guide with some further input from Alex Williamson's tree I've come up with following list
DF41 and CTS2501 (this is important as men who are only tested DF41+ are showing up M269! or L21 etc.)
S775
L744, L745, L746 (there's mix of men who have tested one or all three of these SNP's)
S781 (appears to be mainline of Stewarts)
A600 (Three BigY men came back with this -- main non Stewart S775 line)
BY114
L563
MC21
A874 (A875, A876 also available to order from FTDNA, A874 one on isogg list)
A1786 (A1787 available as well)
A40
FGC5595
MC07 (MC04 also available with FTDNA)
BY281
A100
A113
FGC13017
BY166
Obviously this is just a first draft so any feedback would be helpfull, all of SNP's listed above are available as single order SNP's from FTDNA at the moment. I think it's critical that both DF41 and CTS2501 are down as equivalent.
-Paul
(DF41+)
simdadams
07-06-2015, 08:27 PM
Hi, is the a SNP test for MC21? I am R-CTS2501 and MC21 after my Big Y (397394 Adams) and I want to test my Father who is M269 with a Y 37 test to just confirm. The only near SNP test I can see is the CTS2501 SNP test for $39
Dubhthach
07-06-2015, 11:15 PM
Hi, is the a SNP test for MC21? I am R-CTS2501 and MC21 after my Big Y (397394 Adams) and I want to test my Father who is M269 with a Y 37 test to just confirm. The only near SNP test I can see is the CTS2501 SNP test for $39
To order MC21 you'd need to hit "Upgrade" in top right hand corner, than select "Advanced Test", in the "Test Type" drop down select SNP and in search box enter MC21 and press "find" this will show you the SNP with price and option to hit "add" to place it in your "order basket"
-Paul
(DF41+)
Dubhthach
07-09-2015, 11:52 AM
DF41/CTS2501 has just gotten a little bit bigger! We got a new BigY result (Kelly -- Ireland) who doesn't match with any existing BigY/NGS DF41/CTS2501. Looks like he's a new lineage within the clade.
TigerMW
07-09-2015, 08:37 PM
DF41/CTS2501 has just gotten a little bit bigger! We got a new BigY result (Kelly -- Ireland) who doesn't match with any existing BigY/NGS DF41/CTS2501. Looks like he's a new lineage within the clade.
You've got another NGS result in too. I'll let him break any new news.
TigerMW
07-09-2015, 08:39 PM
Obviously our part of the DF13 tree is quite sparse on FTDNA's Haplotree, with only CTS2501 marked! (thus DF41+ men are often down as predicted M269 or L21+, when it comes to haplogroups!)
Anyways I've been thinking we need to have a DF41/CTS2501 bundle pack, sorta like what M222, CTS4466 and Z253 have. Using ISOGG tree as a guide with some further input from Alex Williamson's tree I've come up with following list
DF41 and CTS2501 (this is important as men who are only tested DF41+ are showing up M269! or L21 etc.)
S775
L744, L745, L746 (there's mix of men who have tested one or all three of these SNP's)
S781 (appears to be mainline of Stewarts)
A600 (Three BigY men came back with this -- main non Stewart S775 line)
BY114
L563
MC21
A874 (A875, A876 also available to order from FTDNA, A874 one on isogg list)
A1786 (A1787 available as well)
A40
FGC5595
MC07 (MC04 also available with FTDNA)
BY281
A100
A113
FGC13017
BY166
Obviously this is just a first draft so any feedback would be helpfull, all of SNP's listed above are available as single order SNP's from FTDNA at the moment. I think it's critical that both DF41 and CTS2501 are down as equivalent.
-Paul
(DF41+)
I owe you an email, but I've got to put you in touch with someone at FTDNA. I've already pretty much given him Alex's big tree, but that is not complete, as you know.
Dubhthach
04-06-2016, 08:04 PM
Looks like the M343 bundle has found us a new DF41 lineage, this time with MDKA in Germany (Baden c. 1706), within the DF41 project his closest match at 111 markers is a GD of 28!, at 67 markers he has a match (whose only tested to 67 markers) with a GD of 15.
Interesting the match at 67 markers, who was also found via M343 bundle has a GD of 10+ with members of the 1426c cluster, and likewise bear's the Scottish surname of Campbell.
Looks like the M343 bundle has found us a new DF41 lineage, this time with MDKA in Germany (Baden c. 1706), within the DF41 project his closest match at 111 markers is a GD of 28!, at 67 markers he has a match (whose only tested to 67 markers) with a GD of 15.
Interesting the match at 67 markers, who was also found via M343 bundle has a GD of 10+ with members of the 1426c cluster, and likewise bear's the Scottish surname of Campbell.
That's pretty far off anybody in the Isles, and remember our guy in the eastern French Alps. Maybe DF41 is La Tene Celtic. Stranger things have happened.
I'm of the Bonkyll Branch of the Stewart line, most likely through Sir James Stewart.
Any benefit in me spending all that money on the BigY tesy?
Dubhthach
08-22-2016, 09:44 AM
I'm of the Bonkyll Branch of the Stewart line, most likely through Sir James Stewart.
Any benefit in me spending all that money on the BigY tesy?
At the moment there are about 11 men who are S781+ and who have done BigY
http://www.ytree.net/DisplayTree.php?blockID=87&star=false
Obviously if you can afford it another datapoint would always be good for helping on-going research into Stewart lineage. Though given price of BigY it's always worthwhile waiting for a sale to come along (can knock $100+ off price).
Of course it also depends on what you are looking for when it comes to testing. BigY apart from showing links with other men (such as if you share unique SNP's with other S781+ men) will give you a list of SNP's that are "private" to your own lineage. This in itself is interesting, as eventually as more men get tested it might be possible to parse these into genealogical timeframe (eg. if you carry a SNP that a verified 4th cousin on male line doesn't, than you know it arose after last common ancestor etc.)
We seem to be one of the smaller branches of DF13. We don't seem to get new additions very often. Quality over quantity, I guess. ;)
David Mc
09-06-2016, 10:36 PM
We seem to be one of the smaller branches of DF13. We don't seem to get new additions very often. Quality over quantity, I guess. ;)
While your last sentence is self-deprecating in an ironic kind of way, there is actually an important point here that needs to be considered when we think about the origins of haplotypes or branches.
The prevailing wisdom has been that large haplogroups/branches are large because they were fathered by powerful men. This assumption led companies telling one group that they were all descended from Genghis Khan (because "of course") and another that they were descended from Niall of the Nine Hostages. Now all of this might be true. But we don't have the remains of Niall or Genghis, so we can't confirm any of these hypotheses. We are quite certain, though, that the Royal Stewart line is genuine; yet it is relatively small. It makes me wonder if our earlier assumptions were correct. "Selfish genes" aside, perhaps successful lines do not necessarily produce many children. Perhaps, instead, they are responsible for the greater success of the majority haplotypes found within their kingdom or tribe. Their greatest contribution to the gene pool might be an indirect one. Just "thinking out loud."
Dubhthach
09-07-2016, 09:43 AM
While your last sentence is self-deprecating in an ironic kind of way, there is actually an important point here that needs to be considered when we think about the origins of haplotypes or branches.
The prevailing wisdom has been that large haplogroups/branches are large because they were fathered by powerful men. This assumption led companies telling one group that they were all descended from Genghis Khan (because "of course") and another that they were descended from Niall of the Nine Hostages. Now all of this might be true. But we don't have the remains of Niall or Genghis, so we can't confirm any of these hypotheses. We are quite certain, though, that the Royal Stewart line is genuine; yet it is relatively small. It makes me wonder if our earlier assumptions were correct. "Selfish genes" aside, perhaps successful lines do not necessarily produce many children. Perhaps, instead, they are responsible for the greater success of the majority haplotypes found within their kingdom or tribe. Their greatest contribution to the gene pool might be an indirect one. Just "thinking out loud."
Well it's worth remembering that the Stewarts are only one of easily a dozen lineages within DF41. What seems to happen every so often is we find new "loners" due to M343 bundle testing etc.
Leaving that aside the Stewart lineage only really seems to expand in the 13th century, with probably the 4th Steward been the main ancestor for both S781 and potentially Z38845 (have to check with guys in University of Strathclyde on when they think Z38845 showed up). This obviously ties in with growing power of the family in Scotland, in sense politically they went from nobodies to holding high office to Royalty, unsurprisingly their lineage then start to diversify.
ScotlandsDNA of course claimed that about 50% of their sample set of Stewarts/Stuarts were part L744+ (and thus DF41+).
I forgot to mention that the famous Guinness brewing family is evidently DF41+. That must be equal to about a million other DF41+ results. :beerchug:
Dubhthach
12-15-2016, 11:31 AM
Very interesting result from DF41 bundle came in there. Through the M343 bundle a new group of DF41er's had been found who weren't particulary close to anyone at 111 or 67 markers. One of them did the DF41 bunder and surprisingly shares several SNP's that are found in my cluster (1013).
See diagram of 1013 BigY results here:
http://www.ytree.net/DisplayTree.php?blockID=458&star=false
Several of the SNP's that were common in all 1013 BigY results were included in the bundle, and it appears to have paid off. The new tester came back as:
A98+
A109+
⁊
A97-
A99-
A100-
A107-
A108-
A110-
FTDNA have him down as A98+, in comparison I'm now A98+ -> A100+
This tester only has 25STR's but close match is tested to 111STR's -- the closet 1013 member to this kit has a Genetic Distance of 23 at 111 markers, I myself have a GD of 28! (at 67 markers GD is: 16 (closest) and 18 for myself!)
It looks like we thus have a early spilt in the lineage, discovered purely by SNP bundle testing and now we know that A98 and A109 occurred before at least 6 of the SNP's in that phylogenetic block. It would be interesting if we can get one of members of this cluster to do BigY.
What's the ancestry on that one?
Dubhthach
12-16-2016, 01:18 PM
What's the ancestry on that one?
They seem to have been in North America as far back as 17th century, they have an active historical society. From looking at there webpage they mention Leicestershire, so ye basically talking about English midlands etc.
Interesting in sense cause it reminds me of situation with S775 where you have one lineage (A600) which appears more southernly in Britain and than the massive Stewart Lineage. Like the lineages spilt and one line stayed around in southern Britain and another moved northwards.
I just emailed a man with the surname Ritchie (original spelling Richey) and asked him to join the DF41 Project. Thus far he is FGC8000+. His Haplotree & SNPs page shows that his DF41 test is in progress.
I wasn't familiar with FGC8000 until I saw this man's results and that FGC8000 is listed as his terminal SNP. FTDNA's tree shows it on the same level as DF41, CTS2501, etc. A check of the Y-DNA SNP function shows that the lot of us who are sufficiently well tested are positive for it (unless I missed something).
His mdka was born in York, Pennsylvania, circa 1760, so I'm not sure of his European origin. Richey is supposed to be either an English or a French surname.
Dubhthach
02-03-2017, 11:42 AM
So was looking at Alex's tree there, he has a new SNP called Z43690 on his DF41 tree, which might turn out to be the DF13 of DF41 land!
Caveats:
Z43690
Found within DYZ19, but not in either the hg19 or hg38 reference sequences. The sequence in the vicinity of the mutation is: CTTCTGGGAGGTTCATGGACTTGCTCATTTCAAGAATGAAGCTGCATACC TTTACGGTGAGGGTTATAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTC CTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTCCT CACTTCAAGAATGAAGCTGCAGAACTTAGTGGTGAGTTTTACACACTTAA AGGTGTTATGTCC. It is a G -> A mutation at position 209 in this sequence. In BAM files aligned to hg19, it shows up as a heterozygous mutation at position 22282894.
On his tree of the 109 DF41+ men who have shared BigY data 95 are in this branch! (87.91%)
http://www.ytree.net/DisplayTree.php?blockID=2174&star=false
My own cluster of A100+ men isn't under it. Some of groups covered by it include 1426 cluster, BY166, MC21, Isle of Man group (L563 and related), our two non-clustered Iberian origin BigY results, A874+ etc.
Dubhthach
02-17-2017, 10:43 AM
Looks like we might have another DF41 lineage of potentially Iberian origin. A new kit joined the DF41 project yesterday, they had gotten a DF41+ result through doing the M343 bundle. Their MDKA is from late 19th century Mexico. What's interesting about this kit is it has no matches in FTDNA database at 12,25,37,67 or 111 STR's!!!
When I run a GD report in the project, closest match at 111 markers is member of Stewart cluster with a GD of 28. At 67 markers closest match is a member of FGC13023 cluster. I imagine to get better picture here we will probably need a BigY test. We currently have two Iberian origin BigY singletons who don't share any SNP's with anyone (other than the "basal" DF41 block).
Dubhthach
02-17-2017, 12:03 PM
duplicate post
Dubhthach
01-14-2018, 11:56 AM
so my own cluster of DF41 is marked by a SNP block containing several SNP's, these been A98, A100, A105, A107, A109 etc.
http://compsoc.nuigalway.ie/~dubhthach/DNA/a100-july.png
we have known for some time that there existed a A98+/A100- lineage (due to DF41 SNP bundle testing). We now have two BigY results come in from men who are A98+/A107+ and A100-
At 67 markers I have a genetic distance of 15 to Holder and 23 to Parks, at 111 markers this goes to GD of 23 to Holder and 32. The two men have a GD of 27 between each other at 111 markers, so it seems to imply we have two distinct new A98+ (A100-) lineages.
robhart
06-21-2019, 09:37 AM
Hello there,
as far as I understand my paternal line is DF41, my result was R1b1a2a1a2c1i PF6093. That´s Pretty amazing for a german. Can anybody tell me where the geographical origins are? Ireland, Scotland, Wales?
robhart
06-21-2019, 09:37 AM
Hello there,
as far as I understand my paternal line is DF41, my result was R1b1a2a1a2c1i PF6093. That´s Pretty amazing for a german. Can anybody tell me where the geographical origins are? Ireland, Scotland, Wales?
Hello there,
as far as I understand my paternal line is DF41, my result was R1b1a2a1a2c1i PF6093. That´s Pretty amazing for a german. Can anybody tell me where the geographical origins are? Ireland, Scotland, Wales?
I can't find PF6093. What SNP is immediately upstream of it?
robhart
06-21-2019, 02:46 PM
Hi,
now I am not sure at all.
Mr. Morley said: R1b1a2a1a2c1i~2§ PF6093 (most likely)
Tom Casey said: DF41_S 95% 9 9 100% 67; L226 95% 9 9 100% 67 (SNP, Probability of testing positive, Fingerprint Match, Fingerprint Breadth, Fingerprint Match Percentage, Genetic Distance)
So I have got several results with differences or am I just too stupid to interprete that right?
Thanks
Robert
robhart
06-21-2019, 02:55 PM
And another question: is my myheritage raw data enough to get a valid result?
robhart
06-21-2019, 03:00 PM
That´s the result of Morley:
R1b1a2a1a2c M529/L21/S145, L459
R1b1a2a1a2c1 DF13/CTS241/S521
R1b1a2a1a2c1~5 CTS2501
R1b1a2a1a2c1i DF41/S524
R1b1a2a1a2c1i1 L744/S388, L746/S310
R1b1a2a1a2c1i1a L745/S463
R1b1a2a1a2c1i2 L563
R1b1a2a1a2c1i~1§ CTS11440
R1b1a2a1a2c1i~2§ PF6093
R1b1a2a1a2c1i~3§ PF4634
robhart
06-21-2019, 03:02 PM
...and only the line with PF6093 is green, the line with L563 is red
Is that based on STRs or raw data from Ancestry or 23andMe? Sorry for all the questions.
robhart
06-21-2019, 03:25 PM
I am the one who has to apologize. I have made this myheritage-test. And with the raw data I tried to get my haplogroup. For the ydna it is quite good (but the specific result is confusing). It is only based on the raw data of myheritage.
I am the one who has to apologize. I have made this myheritage-test. And with the raw data I tried to get my haplogroup. For the ydna it is quite good (but the specific result is confusing). It is only based on the raw data of myheritage.
No need to apologize. Morley's prediction might be right, but you're going to need to have your y-dna tested by Family Tree DNA to be certain, or you could go with YSEQ or 23andMe. I like FTDNA personally.
robhart
06-21-2019, 03:40 PM
Thank you. So I have to join this DNA-World. Exciting! Never have I thought that my grandgrand….Father could be scottish or irish or welsh. But that´s o.k. for me. I like the music, the beer, the landscape and the kind people.
Thank you. So I have to join this DNA-World. Exciting! Never have I thought that my grandgrand….Father could be scottish or irish or welsh. But that´s o.k. for me. I like the music, the beer, the landscape and the kind people.
It's a lot of fun. I don't regret any of the money I have spent on y-dna testing or any of the rest of the dna testing I have had done.
Dubhthach
06-27-2019, 09:03 AM
Thank you. So I have to join this DNA-World. Exciting! Never have I thought that my grandgrand….Father could be scottish or irish or welsh. But that´s o.k. for me. I like the music, the beer, the landscape and the kind people.
Welcome to the land of DF41. With regards to our current known geographic spread we have distinct DF41 lineages found in Ireland, Scotland, Wales, England, Spain (with spill over into Mexico and Puerto Rico), Netherlands, Germany (Rhine as a conduit?)
What part of Germany are you from? What should be remember is that DF41 by itself is quite an old haplogroup dating back to at least the Bronze age. As a result depending on where you fall exactly in overall lineage you could either be:
(a) a totally new branch lineage with low testing
(b) belong to a branch that has small level of testing and scattered geography
(c) belong to a major branch which up until now is associated with specific geographic area.
In the event of (c) that would hint at more recent ancestry (say in last 3-500 years). If you are in either (a) or (b) scenarios then your lineage might have been in Germany (or what is now Germany) for a long time.
Ideally if we got you tested with FTDNA we could see how you'd compare with other DF41+ men. Here is a 'tree' made up of DF41+ men who have done advanced Y-DNA testing (BigY etc.) which gives us very fine grain phylogeny of how they connect to each other:
http://www.ytree.net/DisplayTree.php?blockID=7
Rich (RMS2) I see the following post from you on Molgen back in 2013
Thus far, only one person in my haplotype cluster has had the Geno 2.0 test: Self, kit 53479. His test turned up a SNP that so far is unique to him: PF6093.
I don't know anything else about how reliable PF6093 is, but it's interesting that at least one person in your cluster shows up for it. As a result it would be very interesting to at least get Robhart STR tested and maybe DF41 SNP pack tested (though SNP pack has never been updated).
-Paul
(Dublin)
Since then a bunch of us have gotten Big Y results, including Self, and PF6093 isn't showing up, not even for him. Not sure there was anything to it. That Molgen post was made back when Geno 2.0 was about it, other than FTDNA's then-current range of SNP testing.
robhart
07-01-2019, 11:36 AM
Hello,
I have got no further testing so far. The results of the different ydna-tools are - suprise: - different. One of this Tools says to me the the most recent common ancestor of me with the R1b STR47 was about 300 years ago. So I think it could be the "Dreißigjährige Krieg" 1618-1648, but that´s just an idea. I can follow my paternal line until the 18th century to Nordenham, Friesland.
Hello,
I have got no further testing so far. The results of the different ydna-tools are - suprise: - different. One of this Tools says to me the the most recent common ancestor of me with the R1b STR47 was about 300 years ago. So I think it could be the "Dreißigjährige Krieg" 1618-1648, but that´s just an idea. I can follow my paternal line until the 18th century to Nordenham, Friesland.
"R1b STR47"? That sounds like some very old John McEwan stuff. Where did you get that?
If you really want to know about your y-chromosome line, you're going to have to test with Family Tree DNA. You can start with a simple (and relatively inexpensive) 37-marker STR test and work up from there.
robhart
07-02-2019, 03:42 PM
Hi,
it is the www.mymcgee.com Website. It says to me:
Time to Most Recent Common Ancestor (Years)
ID modal R1bSTR47 Scots 90 Years
But yesterday it said to me 300 years to the TMRCA. I will get a further test to be quite sure. These tests and tools do confuse me.
I see that page was last updated in 2011.
"STR47" was one of John McEwan's old 37-marker clusters. John did good work back in the day and helped a lot of people, but he quit being active a long time ago. His old clusters aren't really of any use anymore, having been rendered obsolete by NGS SNP testing.
Baraona
07-11-2019, 01:01 PM
Hello to everyone! I'm Daniel, from Chile (obviously spain ancestry: my paternal line come to the Americas in 1555 from Burgos). I did too the prediction from Morley (from MyHeritage raw data) and also got an PF6093 result. It's curious to me how the three persons I have contacted with pf6093 did the prediction with MH raw file. i dont know if it is related. Well, in an facebook group of iberic genealogy i was told that the pf6093 is same as BY114, but I dont know. The other thing giving me doubts is the red background on L21 but still collapsing in df41 and pf6093. I did an y37 on ftDNA (still waiting the results, with hopes of upgrading it with the time), so maybe on that way the doubts will be cleared. (I've attached the screen cap).
31608
Cheers!
Hello to everyone! I'm Daniel, from Chile (obviously spain ancestry: my paternal line come to the Americas in 1555 from Burgos). I did too the prediction from Morley (from MyHeritage raw data) and also got an PF6093 result. It's curious to me how the three persons I have contacted with pf6093 did the prediction with MH raw file. i dont know if it is related. Well, in an facebook group of iberic genealogy i was told that the pf6093 is same as BY114, but I dont know. The other thing giving me doubts is the red background on L21 but still collapsing in df41 and pf6093. I did an y37 on ftDNA (still waiting the results, with hopes of upgrading it with the time), so maybe on that way the doubts will be cleared. (I've attached the screen cap).
31608
Cheers!
Once you get your results from FTDNA, you can get a SNP test, perhaps even the Big Y-700, and know for sure.
We do have a fair-sized Spanish contingent in the DF41 Project, so a positive result wouldn't be a big surprise.
Dubhthach
07-19-2019, 09:43 AM
Once you get your results from FTDNA, you can get a SNP test, perhaps even the Big Y-700, and know for sure.
We do have a fair-sized Spanish contingent in the DF41 Project, so a positive result wouldn't be a big surprise.
We appear to so far have at least two distinct Iberian origin DF41 lineages, with a BigY in each. As both don't share any SNP's other than the DF41 equivalents it wouldn't surprise me if there was a couple more distinct lines with origins in what is now Spain and Portugal.
simdadams
07-25-2019, 11:17 AM
Hi All, got my Big Y500 to Y700 completed today, no change in terminal
Hi All, got my Big Y500 to Y700 completed today, no change in terminal
I'm still waiting on mine. It's been delayed several times.
Not sure what it'll do for me when it finally arrives - if ever. I look on it as keeping up with the Joneses, staying on the cutting edge, blah, blah, blah.
Baraona
07-29-2019, 07:31 PM
Hi. I wanted to make a theoretical consultation to those who know the most. My question is quite neophyte, and it is based on “logical” conclusions that may be wrong due to lack of basic knowledge.
Both, a contact and I share, according to the Morley predictor, haplogroup R-pf6093 (R1b1a2a1a2c1i – 2 △), as I have tell you before. We have both requested Y analysis ( he a Y37 and I have just updated mine to Y67)
As he lives in Spain, and I in Chile, we know that if I have a common ancestor this must be before 1550 (approximate date of arrival of my ancestor to America), minimum 15 generations, so in the autosomal comparisons of gedmatch , with a threshold in 7cM nothing appears.
But if it drops the threshold to 5cM (where the possibility of false positive is greater), a 5.6 cM appears in the 22 chromosome (21,409,191-23,742,049).
If it drops to threshold 4cM, one more 5.0cM segment appears in the 14 (21,484,183-22,377,212)
If it goes down to 3 on the threshold, 9 more segments appear for a total of 40.0 cM; at a threshold of 2cM, 34 segments of 94.3cM total.
And well, if it keeps going down, it keeps growing exponentially. With just 1cM threshold, there are 125 shared segments and 226.8 cM total.
I did the same experiment with other gedmatch kits that marked us 0 in 7cM, and when I arrived at 1cM with luck I marked, with only very small segments, 10 to 15cM in total.
Could it be that indeed any of these segments of 3 to 5 cM can give us clues of a common ancestor, reducing the chances of false positives??? Or im trying to dig to deep? I know I have to wait the Y results, but Im very entgusiastic right now. Sorry.
Thanks!
I wouldn't make too much of those low level autosomal dna matches. I am no expert, but they could be due to both of you just having the same general Spanish background, your ancestors having swum in the same broad gene pool, etc.
You're going to have to wait for your y-dna results.
Rich has disappeared? Is he OK?
Rich has disappeared? Is he OK?
I tried to send you a private message but your box is full.
I tried to send you a private message but your box is full.
Ive cleared my box now.
Powered by vBulletin® Version 4.2.5 Copyright © 2022 vBulletin Solutions Inc. All rights reserved.