PDA

View Full Version : R1b Early Branching Phylogeny (SNP based family tree)



Pages : 1 [2]

smal
05-19-2015, 06:45 AM
smal what S1211 - .BAM files do you need?
Each sample is important to build the correct tree. I do not have bam files of Meyer, Schlegel, Cruz, and Shaw.
It would be important to analyse Meyer's data.

ballardgen
05-19-2015, 11:07 AM
Thanks smal

I am in contact with these testers, leave it with me :-)

thanks for all your good work.



Confirmed:
BDNA have had "NO" positive + results for S1199
BDNA have had "9" positive + results for S1187

Joe B
05-30-2015, 10:32 PM
The R1b-M269 (P312- U106-) DNA Project tree (https://www.familytreedna.com/groups/ht-3-5new/about/results) was updated last weekend. 4 new BigY-tested samples were added:

FTDNA-N97723 (Lakkis) L277 R1b>M269>L23>Z2103>L277.1
FTDNA-26483 (Kreklow) Z2109 R1b>M269>L23>Z2103>Z2109>CTS3937
FTDNA-108347 (Seymour) FGC29330 R1b>M269>L23>Z2103>Z2109>CTS7822>FGC29330
FTDNA-B3248 (Pancheri) BY250 R1b>M269>L23>Z2103>Z2109>CTS7822>CTS9219>BY250

Thank you for testing.

ballardgen
06-06-2015, 02:24 PM
Please - Who is doing the HT35 categorization of groups under CTS4528 - there are many mistakes, with who has taken what tests ????

please see my site "background" page for test status clarification OR please check the testers results !!

Best Wishes

https://www.familytreedna.com/groups/r-1b-s14328-genealogy/about/background

Joe B
06-06-2015, 03:44 PM
Please - Who is doing the HT35 categorization of groups under CTS4528 - there are many mistakes, with who has taken what tests ????

please see my site "background" page for test status clarification OR please check the testers results !!

Best Wishes

https://www.familytreedna.com/groups/r-1b-s14328-genealogy/about/background
Everything is under control. More subgroups were being added to the R1b-P310 part of the haplotree. This is a manual chore that takes time and is a lot of work. You just caught things midstream. There is no screw up.

TigerMW
06-09-2015, 01:11 AM
Everything is under control. More subgroups were being added to the R1b-P310 part of the haplotree. This is a manual chore that takes time and is a lot of work. You just caught things midstream. There is no screw up.
Thanks, Joe.
Please, don't hesitate to send those with P312+ U106+ or that haven't tested and don't fit your haplotypes back to the R1b project. We are going to try to get them to upgrade and get them differentiated.

ballardgen
06-09-2015, 08:21 AM
Thanks, Joe.
Please, don't hesitate to send those with P312+ U106+ or that haven't tested and don't fit your haplotypes back to the R1b project. We are going to try to get them to upgrade and get them differentiated.

Hi Mike,

there are several CTS4528's with potential for S14328 in your R1b project that we would like over at ours for further testing if that's possible.

of course any we have in your project category are directed your way :-)

Best Wishes

https://www.familytreedna.com/groups/r-1b-s14328-genealogy/about/background

TigerMW
06-09-2015, 01:43 PM
Hi Mike,

there are several CTS4528's with potential for S14328 in your R1b project that we would like over at ours for further testing if that's possible.

of course any we have in your project category are directed your way :-)

Best Wishes

https://www.familytreedna.com/groups/r-1b-s14328-genealogy/about/background

I can only join people to a project if they are confirmed with the appropriate SNP or downstream. If they are M269+ U106- P312- I can join them to the M269 ht35 project.

If they are not tested for S14328, I can't join them to that project. However, I think you may be saying they are CTS4528+, correct? If they are I can join them to a CTS4528 project.

ballardgen
06-09-2015, 05:02 PM
OK thanks anyway :-)

That will waist every bodies time joining them there.


The CTS4528 project Admin has given up (or never got started) and only uses the project front page to direct those landing there to other biased unconnected web sites.

For the sake of those customers and testers at FTDNA Perhaps this is a good reason to suggest it get taken over or shut down.

TigerMW
06-09-2015, 05:29 PM
OK thanks anyway :-)

That will waist every bodies time joining them there.


The CTS4528 project Admin has given up (or never got started) and only uses the project front page to direct those landing there to other biased unconnected web sites.

For the sake of those customers and testers at FTDNA Perhaps this is a good reason to suggest it get taken over or shut down.
Ouch. I don't know the situation. If you feel that then I recommend contacting FTDNA to ask this be corrected.

How about using the M269 ht35 project admins to provide testing guidance?

R.Rocca
06-09-2015, 06:41 PM
Ouch. I don't know the situation. If you feel that then I recommend contacting FTDNA to ask this be corrected.

How about using the M269 ht35 project admins to provide testing guidance?

I just went to the DF100-CTS4528 project and it doesn't seem to be all that abandoned (three ungrouped kits).

ballardgen
06-09-2015, 07:43 PM
I have sent the letter I received from this project Admin to FTDNA some time ago, they are aware of the problem with regards it lack of activity

I dont need any testing guidance, I pass members on to the HT35 project and chase .BAM files for them,

I just require members to join my project so I can advise them on testing and explore their ancestry :-)


last update over a year ago - http://www.worldfamilies.net/surnames/DF100/results

TigerMW
06-09-2015, 08:01 PM
... How about using the M269 ht35 project admins to provide testing guidance?

....
I dont need any testing guidance, I pass members on to the HT35 project and chase .BAM files for them,

I just require members to join my project so I can advise them on testing and explore their ancestry :-) ...
Ballard, what I meant was not that you needed testing guidance but that you could write up testing guidance for those that you think should test for your SNP and send that to the ht35 (or DF100) admins so they could forward it on.

I was just looking to help with alternatives for contacting people not in your project that you think need to take a specific test.

For my own edification, what STR signatures or under what circumstances should a person test for S14328?

R.Rocca
06-09-2015, 08:38 PM
I have sent the letter I received from this project Admin to FTDNA some time ago, they are aware of the problem with regards it lack of activity

I dont need any testing guidance, I pass members on to the HT35 project and chase .BAM files for them,

I just require members to join my project so I can advise them on testing and explore their ancestry :-)


last update over a year ago - http://www.worldfamilies.net/surnames/DF100/results

I thought you meant this DF100 CTS4528 Project: https://www.familytreedna.com/groups/df100-cts4528-l11-p310-l151-p311/about

smal
06-09-2015, 09:10 PM
For my own edification, what STR signatures or under what circumstances should a person test for S14328?

There are 2 main subclades under CTS4528
CTS4528>S14328 DYS478=13 (11)
CTS4528>S11481 DYS478=14

Joe B
06-10-2015, 12:23 AM
Ouch. I don't know the situation. If you feel that then I recommend contacting FTDNA to ask this be corrected.

How about using the M269 ht35 project admins to provide testing guidance?
I just went to the DF100-CTS4528 project and it doesn't seem to be all that abandoned (three ungrouped kits).
The R1b-M269 (P312- U106-) DNA Project is the only official haplogroup project for R1b-M269 (U106-, P312-) y branches.

R1b-S14328 and the other R1b-L51(U106-, P312-) haplogroups were reviewed by the person in charge of FTDNA projects last year. It was determined that the focus was too narrow and the numbers too small to justify creating new haplogroup projects for these y lines. They would be better served remaining in the R1b-M269 (P312- U106-) DNA Project (https://www.familytreedna.com/groups/ht-3-5new/about/background) and benefiting from smal's considerable expertise in building phylogenetic trees. This has turned out to be wise since he has found at least seven R1b-P311(U106-, P312-, CTS4528-, DF100-) haplotypes and added a lot of granularity to that part of the tree. Also, byrgian is in charge of R1b-CTS4528 and Subclades at ISOGG and that's a pretty good advocate to have.

The R1b-S14328-Genealogy (https://www.familytreedna.com/groups/r-1b-s14328-genealogy/about/background) project has turned out to be good compromise. ballardgen has created a project that acts as a bridge between surname/genealogy and the strictly phylogenetic work that the R1b-M269 (P312- U106-) DNA haplogroup project does. We really do appreciate him feeding us good members that actually do SNP testing. That part of the tree has really developing nicely. Thank you ballardgen.

The DF100-CTS4528 project (https://www.familytreedna.com/groups/df100-cts4528-l11-p310-l151-p311/about) is really unknown to the R1b-M269 (P312- U106-) DNA Project administrators. It would be better if they modified their focus to geography, surnames or somethings else other than as an official haplogroup project.

Pillar_of_fire
07-19-2015, 07:20 AM
Wow, it has been some time since I checked the R1b-M269 (P312- U106-) DNA Project page. I was nicely surpised to see a new tree - Ancient R1b samples Haplogroup Assignments. Thank you Sergey!

Chad Rohlfsen
07-19-2015, 09:00 PM
Y-full is updating their tree in the next 1-3 days. 468 new SNPs and 97 new subclades. 72 and 35, respectively for R1b.

Joe B
07-20-2015, 12:47 AM
Wow, it has been some time since I checked the R1b-M269 (P312- U106-) DNA Project page. I was nicely surpised to see a new tree - Ancient R1b samples Haplogroup Assignments. Thank you Sergey!The Ancient R1b samples Haplogroup Assignments on the background page (https://www.familytreedna.com/groups/ht-3-5new/about/background) is a great addition. Combining the recently discovered R1b branches with TMRCA estimates and adding ancient samples has helped a lot of our members better appreciate what this science can bring to the table.
When are we getting some ancient samples from Bulgaria? Bet that would bring some cool new members to the project.

Joe B
07-20-2015, 01:03 AM
The project tree was updated https://www.familytreedna.com/groups/ht-3-5new/about/results. 11 BigY tested samples were included:

FTDNA-? (Watson) PF7562
FTDNA-30885 (Mattoli) L277
FTDNA- 187115 (Spier) L584
FTDNA-? (Ginn) FGC29330
FTDNA-399697 (Bosinceanu) BY593
FTDNA-? (De La Fayolle) BY250
FTDNA-46468 (Ozkubilay) PF7589
FTDNA-257096 (Eagleton) CTS11824
FTDNA-? (Bryson) P311
FTDNA-406656 (Smith) S14328
FTDNA-E2806 (Meyer) S13328

Thanks smal. Eleven new Big Y tests on eleven different branches is a lot of work.
If you match any of these individuals with the FTDNA matching programs that do not have a FTDNA number, please contact them and ask them to join the R1b-M269 (P312- U106-) DNA Project (https://www.familytreedna.com/groups/ht-3-5new/about/background). They need to get their BAM file properly evaluated by smal.

Joe B
10-26-2015, 03:50 PM
The R1b-M269 (P312- U106-) DNA Project Tree was updated last week. Big thanks to smal for constucting another very detailed phylogenetic tree.

https://www.familytreedna.com/groups/ht-3-5new/about/results

The project tree was updated. The following samples were included:

4 BigY tested samples
FDNA-N8283 (Rutyna) L584
FTDNA-360054 (Van Weert) S1194>A8039
FTDNA-164249 (Arnold) S14328
FTDNA-277427 (Puckering) S14328

1 sample from PGP project
PGP226 PF7563

In addition, several branches were significantly corrected based on the BAM file analysis and YFull data.
It's almost as large as the Sequoia trees I saw this weekend.

TigerMW
11-05-2015, 02:50 AM
The R1b-M269 (P312- U106-) DNA Project Tree was updated last week. Big thanks to smal for constucting another very detailed phylogenetic tree.

https://www.familytreedna.com/groups/ht-3-5new/about/results

It's almost as large as the Sequoia trees I saw this weekend.
I am working on trying to get the haplotree updated above P311. This takes some time but hopefully we'll have some progress by Christmas.

Please keep posting any updates here. Thank you.

Joe B
11-05-2015, 05:32 PM
The R1b-M269 (P312- U106-) DNA Project Tree was updated this week. Thanks smal.
https://www.familytreedna.com/groups.../about/results

The project tree was updated https://www.familytreedna.com/groups/ht-3-5new/about/results. 4 BigY tested samples were included:

FTDNA-? (Oppenheim) PF7562
FTDNA-359776 (LeBlanc) PF7580
FTDNA-427434 (Botkin) CTS6889
FTDNA-105987 (Mathiasson / Mattisson) CTS4528

smal
11-08-2015, 05:12 PM
The R1b-M269 (P312- U106-) project tree was updated https://www.familytreedna.com/groups/ht-3-5new/about/results. 7 BigY tested samples were included:

FTDNA-364964 (Sforza) PF7562
FTDNA-? (Mohamad Ahmad Mohamad) L277
FTDNA-379015 (Markstedt/Östensson) L584
FTDNA-370505 (Molchanov) L584
FTDNA-? (Hollingsworth) CTS9219
FTDNA-419942 (Pancheri L / Panchero, b 1335) CTS9219
FTDNA-? (Fagundes) CTS9219

VinceT
11-09-2015, 01:03 PM
Are there any at all that have ordered Y-Elite 1.0 or 2.0 from Full Genomes Corp.?

morrisondna
11-09-2015, 01:56 PM
Are there any at all that have ordered Y-Elite 1.0 or 2.0 from Full Genomes Corp.?

Not Y Elite, but I have a Whole Genomes 4X on order.

VinceT
11-09-2015, 05:39 PM
Not Y Elite, but I have a Whole Genomes 4X on order.
Thanks. I don't think WGS 4X will be good enough for Y-SNP discovery, as far as the ISOGG Y-Tree is concerned. 10X is marginal, 30X or better is desirable. 4X was typical for 1000 Genomes Project samples, but 2, 3, or more samples per branch with the candidate SNP were needed to clarify if it was legitimately present. Even then, Sanger sequencing was recommended to confirm each SNP, if the site could be Sanger sequenced.

Joe B
11-09-2015, 06:40 PM
Are there any at all that have ordered Y-Elite 1.0 or 2.0 from Full Genomes Corp.?Hey Vince, There is one R1b-L584 haplotype that has results from both Big Y and Y-Elite 2.0 and that's nice to have. He is on the new R1b-M269 (P312- U106-) DNA Project tree https://www.familytreedna.com/groups.../about/results and the two at this level http://yfull.com/tree/R-L943/ are the same guy.

morrisondna
11-10-2015, 11:58 AM
Thanks. I don't think WGS 4X will be good enough for Y-SNP discovery, as far as the ISOGG Y-Tree is concerned. 10X is marginal, 30X or better is desirable. 4X was typical for 1000 Genomes Project samples, but 2, 3, or more samples per branch with the candidate SNP were needed to clarify if it was legitimately present. Even then, Sanger sequencing was recommended to confirm each SNP, if the site could be Sanger sequenced.

Understood. This test is somewhat experimental, but the objective is to identify recent private family-branch SNPs that might be verifiable through subsequent Sanger sequencing. The results from this test will be compared with Big Y results already received for known same-surname relatives within the past 400 years. We'll have to see how this turns out.

TigerMW
11-10-2015, 02:20 PM
Understood. This test is somewhat experimental, but the objective is to identify recent private family-branch SNPs that might be verifiable through subsequent Sanger sequencing. The results from this test will be compared with Big Y results already received for known same-surname relatives within the past 400 years. We'll have to see how this turns out.
I always get into trouble with those that have firm approaches on this, but with all of the data you are uncovering with this kind of testing it would be ashamed to discard everything that wasn't Sanger Sequenceable. Sanger is great for what it does but it about 40 years old and these new tests can allow you to discover patterns of variants that show the branching with great confidence. This doesn't help for current ISOGG qualification but if it is private branching it doesn't qualify for ISOGG trees anyway. Eventually, trees will be based on fuller patterns of data than what we've used in the past and yet today.

morrisondna
11-11-2015, 02:39 AM
I always get into trouble with those that have firm approaches on this, but with all of the data you are uncovering with this kind of testing it would be ashamed to discard everything that wasn't Sanger Sequenceable. Sanger is great for what it does but it about 40 years old and these new tests can allow you to discover patterns of variants that show the branching with great confidence. This doesn't help for current ISOGG qualification but if it is private branching it doesn't qualify for ISOGG trees anyway. Eventually, trees will be based on fuller patterns of data than what we've used in the past and yet today.

True. The main advantage Sanger offers now is that it is inexpensive. I look forward to the day when NGS testing is as affordable; there is no question it provides superior results for identifying private branches.

miiser
11-11-2015, 05:07 AM
Thanks. I don't think WGS 4X will be good enough for Y-SNP discovery, as far as the ISOGG Y-Tree is concerned. 10X is marginal, 30X or better is desirable. 4X was typical for 1000 Genomes Project samples, but 2, 3, or more samples per branch with the candidate SNP were needed to clarify if it was legitimately present. Even then, Sanger sequencing was recommended to confirm each SNP, if the site could be Sanger sequenced.

I think 10X will be good enough for SNP discovery and tree definition. I'm having trouble finding it now, but there was an academic study that related coverage to percent of SNPs discovered and confidence. From what I recall, it reached something like 90% confidence for 90% of sequenceable SNPs at around 8X or 10X coverage. 30X is needed for medical applications, where you really want better than 90% confidence before you start chopping off body parts. 4X coverage will be good enough in most cases to easily place a person within the tree, and discover a large fraction of novel SNPs with reasonable confidence. There may be some relevant SNPs that get missed here and there. But in most branches, there are phylogenetically equivalent SNPs anyways, so it's not an insurmountable loss to miss an SNP here and there. If you have 2 or 3 people who test at 4X from the same terminal haplogroup, that'll get you close to 100% SNP discovery for that branch, although each individual will miss some of them here and there. But once you have the branch defined, it doesn't really matter if you miss some SNPs except for the terminal SNPs at the very bottom. And you can mop those up with Sanger sequencing if they happen to be critical for defining phylogeny (which they probably won't be).

The other nice thing is you can always upgrade from 4X later if you decide it wasn't sufficient. 4X now + 4X later = 8X.

I'll see if I can find the study.

morrisondna
11-11-2015, 12:11 PM
Milser, you expressed my thinking on this approach very clearly. If we can find just a few more SNPs in the recent generations, this test will be worthwhile. And the lower cost might allow us to NGS-test several people related within the past 400 years rather than one or two. Of course, there may be a problem if the newly-discovered recent SNPs are not Sanger-testable.

smal
11-25-2015, 09:41 PM
A consensus tree for the R-M343 (M73- M269-) Project (https://www.familytreedna.com/public/R1b1Asterisk/) + M478 was created (pdf (http://www.kumbarov.com/ht35/R1b-M343xM269%20Y-DNA%20tree_02_11_25_2015.pdf)). It includes the following BigY tested samples:

FTDNA-431539 (Saxton) V88
FTDNA-M8555 (abdurhman) V88
FTDNA-154472 (Billstein) V88
FTDNA-40065 (Vass/Weil/Vaider) V88
FTDNA-N131996 (Boukari) V88
FTDNA-317546 (Musa/Yahya) V88
FTDNA-386931 (Alzuwayed) V88
FTDNA-293211 (Al-Tamimi) V88
FTDNA-?/YFull-YF03139 M478
FTDNA-277808 (Kolomiets, Ukraine) M478
FTDNA-?/YFull-YF02940 M478

and different samples published in
Francalacci et al. 2013
Hallast et al. 2014
Lippold et al. 2014
Karmin et al. 2015
Francalacci et al. 2015
Trombetta et al. 2015
1000 Genomes Project

grouza31
11-27-2015, 02:54 PM
A consensus tree for the R-M343 (M73- M269-) Project (https://www.familytreedna.com/public/R1b1Asterisk/) + M478 was created (pdf (http://www.kumbarov.com/ht35/R1b-M343xM269%20Y-DNA%20tree_02_11_25_2015.pdf)). It includes the following BigY tested samples:

FTDNA-431539 (Saxton) V88
FTDNA-M8555 (abdurhman) V88
FTDNA-154472 (Billstein) V88
FTDNA-40065 (Vass/Weil/Vaider) V88
FTDNA-N131996 (Boukari) V88
FTDNA-317546 (Musa/Yahya) V88
FTDNA-386931 (Alzuwayed) V88
FTDNA-293211 (Al-Tamimi) V88
FTDNA-?/YFull-YF03139 M478
FTDNA-277808 (Kolomiets, Ukraine) M478
FTDNA-?/YFull-YF02940 M478

and different samples published in
Francalacci et al. 2013
Hallast et al. 2014
Lippold et al. 2014
Karmin et al. 2015
Francalacci et al. 2015
Trombetta et al. 2015
1000 Genomes Project

Smal, I want to thank you very much for your excellent work.
I am a member of the V88 FTDNA group that you administer.

smal
11-27-2015, 03:54 PM
I am a member of the V88 FTDNA group that you administer.

It is a good time to order more BigY tests. We need more data to develop a high-quality tree for the V88 clade.

VinceT
11-28-2015, 03:59 AM
Also, more Y-Elite 2.0 tests are needed for a variety of haplogroups, but especially the ones relevant to this thread, to resolve Y-SNPs in all of the regions that Big-Y doesn't cover.

A seasonal sale from Full Genomes is now on!
http://cruwys.blogspot.ca/2015/11/full-genomes-winter-discount.html

grouza31
11-28-2015, 09:54 AM
It is a good time to order more BigY tests. We need more data to develop a high-quality tree for the V88 clade.
Smal, you have already my Big Y data.

Joe B
11-28-2015, 08:05 PM
Smal, you have already my Big Y data.
Thanks for making sure smal got your BAM file. If you have not already, please consider submitting your BAM file to YFull and joining Group: R1b-M343 (xP312 xU106). This group covers all the early branches of R1b.
Thanks, Joe

grouza31
11-28-2015, 10:06 PM
Thanks for making sure smal got your BAM file. If you have not already, please consider submitting your BAM file to YFull and joining Group: R1b-M343 (xP312 xU106). This group covers all the early branches of R1b.
Thanks, Joe

YFull has already my BAM file. I will join R1b-M343 (×P312xU106) group. Thanks.

grouza31
12-23-2015, 03:42 PM
At last if the sardinian origin of R-V88 was finally confirmed?
I sent my Big Y BAM file to FGC for analysis and interpretation. I received as results as regards the haplogroup match:

Match #2: R-M18 Score relative to best match: 1
*Extras: Z1518+, FGC49+, Y4010+, 50f2(P)+, Z14907+, PF6328+, Y2550+, P80+, FGC464+, CTS12019+, L1228+, Z3327+, CTS10834+, Z28+, FGC5628+, PF2372+, CTS11468+, M162_1*, FGC5085+, P266+, DYS257_2+, P27.2_2+, Y2252+, CTS616+, CTS2646*, M118+, Y2754+, FGC20667*, M141+, L665+, Z14350+, Z6859+, Z889+, Z13537*, Z6171+, Z1237+, FGC756+, BY451+, P19_1*, P79*, PF2276+, Z16986+, CTS8665+, M5220+, FGC1920+, Z1842+, Z15.1+, V190+, CTS6911+, CTS2518+, FGC4872+, Y5185*, Y2986+, Z548.1+, L729.1+, Z1101+, Z15165+, IMS-JST022457+, M2087.1+, S730+, S504+, Z836*, IMS-JST029149+, M1994*, L990+, P198+, Z2182*, CTS8591+
R1b1c1

If these results are correct, Yfull should put haploroup R-Y7771 under the R-M18 branch. Thank YFull much for their good work.
Smal and Joe what do you think?
Smal, do my FGC results can allow you to refine the excellent work you have done on R1b-V88 tree? If yes, I will send you my FGC analysis and interpretation results of my Big Y BAM File.

TigerMW
12-23-2015, 04:15 PM
Is this an accurate portrayal of the V88 tree?

Tree
Level SNP Position Ancestor .. Synonyms
4.... V88 04862861-C-T L754 .. PF6279
5..... M18 21733162-indel V88
6...... Y7771 07366284-G-T M18
5..... PF6289 07404645-C-A V88
5..... F3867 08465669-C-T V88
5..... FGC20986 17773125-T-C V88
6...... FGC21008 19533766-C-T FGC20986
7....... FGC21060 18136440-C-G FGC21008
5..... M8363 08337108-G-A V88
5..... PF6319 19217499-G-A V88
6...... PF7548 15656116-C-T PF6319
6...... PF6369 17576405-C-G PF6319
5..... SK2063 08535601-G-A V88 .. FGC21034/V2197
5..... SK2071 08428070-G-A V88 .. V1944
6...... V3181 15859861-C-T SK2071
7....... SK2072 02819797-A-G V3181
7....... Y18462 19396341-T-C V3181
5..... V8 06932176-G-C V88
5..... V35 06812012-T-A V88
6...... SK2067 14773359-C-T V35
6...... V7 06932105-G-A V35
6...... Z30280 16635337-A-G V35
5..... V69 18099054-C-T V88

smal
12-23-2015, 08:45 PM
I have corrected tree levels column

Tree
Level SNP Position Ancestor .. Synonyms
4.... V88 04862861-C-T L754 .. PF6279
5..... V8 06932176-G-C V88
5..... M18 21733162-indel V88
5..... F3867 08465669-C-T V88
5..... PF6289 07404645-C-A V88
6..... M8363 08337108-G-A PF6289
6..... PF6319 19217499-G-A PF6289
7...... PF7548 15656116-C-T PF6319
7...... PF6369 17576405-C-G PF6319
6..... SK2063 08535601-G-A PF6289 .. FGC21034/V2197
7..... V35 06812012-T-A SK2063
8...... SK2067 14773359-C-T V35
8...... V7 06932105-G-A V35
8...... Z30280 16635337-A-G V35
7..... FGC20986 17773125-T-C SK2063
8...... FGC21008 19533766-C-T FGC20986
9....... FGC21060 18136440-C-G FGC21008
7..... SK2071 08428070-G-A SK2063 .. V1944
7...... Y7771 07366284-G-T SK2063 [SK2071 equivalent]
8...... V3181 15859861-C-T SK2071, Y7771
9....... SK2072 02819797-A-G V3181
9....... Y18462 19396341-T-C V3181
8..... V69 18099054-C-T SK2071, Y7771

It is better to include V8, M18, F3867, V7, SK2072 as SNPs not on the Haplotree
Additional SNPs for the investigation: SK2076, V1169, V1449, V1672, V2198.

Joe B
12-23-2015, 09:05 PM
Is this an accurate portrayal of the V88 tree?

Tree
Level SNP Position Ancestor .. Synonyms
4.... V88 04862861-C-T L754 .. PF6279
5..... M18 21733162-indel V88
6...... Y7771 07366284-G-T M18
5..... PF6289 07404645-C-A V88
5..... F3867 08465669-C-T V88
5..... FGC20986 17773125-T-C V88
6...... FGC21008 19533766-C-T FGC20986
7....... FGC21060 18136440-C-G FGC21008
5..... M8363 08337108-G-A V88
5..... PF6319 19217499-G-A V88
6...... PF7548 15656116-C-T PF6319
6...... PF6369 17576405-C-G PF6319
5..... SK2063 08535601-G-A V88 .. FGC21034/V2197
5..... SK2071 08428070-G-A V88 .. V1944
6...... V3181 15859861-C-T SK2071
7....... SK2072 02819797-A-G V3181
7....... Y18462 19396341-T-C V3181
5..... V8 06932176-G-C V88
5..... V35 06812012-T-A V88
6...... SK2067 14773359-C-T V35
6...... V7 06932105-G-A V35
6...... Z30280 16635337-A-G V35
5..... V69 18099054-C-T V88
The SNPs are highlighted for a visual look at the coverage on this clip of the haplotree made by smal.
R1b-M343 (xM269) Y-DNA tree. v 2. November 25, 2015
https://c2.staticflickr.com/2/1461/23564709769_a211239f30_t.jpg (https://c2.staticflickr.com/2/1461/23564709769_d0c6b25888_o.png)Thanks Gentlemen for getting this important detail work done.

smal
12-23-2015, 09:29 PM
At last if the sardinian origin of R-V88 was finally confirmed?
I sent my Big Y BAM file to FGC for analysis and interpretation. I received as results as regards the haplogroup match...


The problem is that we do not have any M18+ samples in FTDNA projects. All Y7771 samples tested for M18 are negative. If FGC compare your data with the R-M18 line I will be glad to look at your FGC report.
The R-V88 line in Sardinia is very ancient. However, of course, there are no evidences that prove its Sardinian origin.

grouza31
12-23-2015, 10:12 PM
The problem is that we do not have any M18+ samples in FTDNA projects. All Y7771 samples tested for M18 are negative. If FGC compare your data with the R-M18 line I will be glad to look at your FGC report.
The R-V88 line in Sardinia is very ancient. However, of course, there are no evidences that prove its Sardinian origin.

I'm in the FTDNA project. My sample is also Y7771. For FGC which analysis my BIG Y BAM file, snp M18 is not negative but no call.

grouza31
12-23-2015, 10:32 PM
The problem is that we do not have any M18+ samples in FTDNA projects. All Y7771 samples tested for M18 are negative. If FGC compare your data with the R-M18 line I will be glad to look at your FGC report.
The R-V88 line in Sardinia is very ancient. However, of course, there are no evidences that prove its Sardinian origin.

I'm in the FTDNA project. My sample is also Y7771. For FGC which analysis my BIG Y BAM file, snp M18 is not negative but no call.

TigerMW
12-24-2015, 04:02 AM
I have corrected tree levels column

Tree
Level SNP Position Ancestor .. Synonyms
4.... V88 04862861-C-T L754 .. PF6279
5..... V8 06932176-G-C V88
5..... M18 21733162-indel V88
5..... F3867 08465669-C-T V88
5..... PF6289 07404645-C-A V88
6..... M8363 08337108-G-A PF6289
6..... PF6319 19217499-G-A PF6289
7...... PF7548 15656116-C-T PF6319
7...... PF6369 17576405-C-G PF6319
6..... SK2063 08535601-G-A PF6289 .. FGC21034/V2197
7..... V35 06812012-T-A SK2063
8...... SK2067 14773359-C-T V35
8...... V7 06932105-G-A V35
8...... Z30280 16635337-A-G V35
7..... FGC20986 17773125-T-C SK2063
8...... FGC21008 19533766-C-T FGC20986
9....... FGC21060 18136440-C-G FGC21008
7..... SK2071 08428070-G-A SK2063 .. V1944
7...... Y7771 07366284-G-T SK2063 [SK2071 equivalent]
8...... V3181 15859861-C-T SK2071, Y7771
9....... SK2072 02819797-A-G V3181
9....... Y18462 19396341-T-C V3181
8..... V69 18099054-C-T SK2071, Y7771

It is better to include V8, M18, F3867, V7, SK2072 as SNPs not on the Haplotree
Additional SNPs for the investigation: SK2076, V1169, V1449, V1672, V2198.
Thank you.

These aren't in YBrowse: V1169, V1449, V1672, V2198. Is there a reference to find the positions and allele changes?

smal
12-24-2015, 04:51 AM
These aren't in YBrowse: V1169, V1449, V1672, V2198. Is there a reference to find the positions and allele changes?

V1169 06660251-A-G
V1449 07805240-A-T
V1672 08152409-G-A
V2198 08535686-C-T

They were published by Trombetta et al. 2015 (http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134646) for samples from Central and Northern Africa.

smal
12-24-2015, 10:38 AM
I'm in the FTDNA project. My sample is also Y7771. For FGC which analysis my BIG Y BAM file, snp M18 is not negative but no call.
There are the other samples from the Y7771 branch which were tested negative for M18.

grouza31
12-26-2015, 09:35 PM
There are the other samples from the Y7771 branch which were tested negative for M18.
I sent you by email the results of interpretation of my big bam file by fgc.

grouza31
12-26-2015, 10:00 PM
I think (if I'm not mistaken) Y7771 is much older than expected and that his age would be equivalent to M269 or more. I say this for the following reason:
I am surprised that my Y STR matchs provided by FTDNA are not from Y7771 or PF6289 group but they are from R-M269 group.
1) YSTR 12:
GD 0:
- No match with Y7771 or PF6289 samples.
- Match with 5 R-M269 samples

GD 1:
- Match with 1 Y7771 (PF6289) sample.
- Match with 11 R-M269 samples
- Match with 1 R-P25, 1 R-L21, 1 R-P312, 1 R-BY3290, 1 R-Y17221, 1 R-M343, 1 R-DF-13, 1 R-L-2, 1 R-Z381, 2 R-Z49, 1 R-Z295, 1 R-L23, 1 R-U106 samples
2) YSTR 25
GD 0:
- No match with Y7771 or PF6289 samples.
- Match with 1 R-M269 sample

GD 1:
- No match

3) YSTR 37
- Match with 1 R-M269 sample at GD 4
No match with Y7771 or PF6289 samples

4) YSTR 67
- Match with 1 R-M269 sample at GD 4
- No match with Y7771 or PF6289 samples
5) YSTR 111
- My R-M269 match at YSTR 67 did not upgrated his FTDNA test to YSTR111
- No match with Y7771 or PF6289 samples

TigerMW
12-28-2015, 07:26 PM
V1169 06660251-A-G
V1449 07805240-A-T
V1672 08152409-G-A
V2198 08535686-C-T

They were published by Trombetta et al. 2015 (http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134646) for samples from Central and Northern Africa.

Thank you, Smal.

Do we have any knowledge about the status of any of these SNPs in the individuals who had V11169, V1449, V1672 and V2198, respectively?

PF6289
F3867
FGC20986
M8363
PF6319
SK2063
SK2071
V8
V35
V69

smal
12-29-2015, 08:59 PM
Do we have any knowledge about the status of any of these SNPs in the individuals who had V1169, V1449, V1672 and V2198, respectively?

PF6289
F3867
FGC20986
M8363
PF6319
SK2063
SK2071
V8
V35
V69

They are under PF6289>SK2063>SK2071 --> V1169, V1449, V1672, V2198.

F3867, FGC20986, M8363, PF6319, V8, V35, V69 are probably negative.

Bonnie
01-03-2016, 08:32 PM
Smal, are you there? I appreciate your work very much. I've just been learning about this part of the phylotree, mostly from your work. Very impressive! Have you heard about our Cameroon R1b challenge? I'd love to have you participate!

Please see: http://www.anthrogenica.com/showthread.php?6134-Two-probable-R1b-V88-among-our-Cameroonian-samples-collected-by-A00-project&p=131047&viewfull=1#post131047

I was just noticing that V1169, V1449, V1672, and V2198 look like very good candidates. Thomas may not be ready to test them now, though, if they aren't in Ybrowse. I'll ask him!

Bonnie

Bonnie
01-09-2016, 07:22 PM
Hi all,

The first round of tests has had results, as follows, quoted from Thomas:



Here are the primary results as we have scored them today:

Sample 3064 3804
PF6332 failed C+
PF6333 T+ T+
Y7782 A+ A+
Y7771 T+ T+
V1684 G- failed
SK2076 G- G-
V3181 failed C-
V69 failed C-
Y18462 T- T-
Y18459 A- A-
PF6368 G- G-
Z30246 C- C-
L388 G- G-
M18 del- del-
U152 C- C-

Unfortunately a few results failed at the first attempt. 3804 / V1684
was likely a clogged capillary and the sample quality of 3064 is
generally a little bit lower.
I don't think we need to re-run PF6332 since it's implicit positive.
However V3181,V69 and V1684 are still interesting and we'll try to solve
them in a second sequencing attempt.

To get your orientation I recommend to look at the following two trees:

R1b-M343 (xM269) Y-DNA tree. v 2. November 25, 2015 (Sergey Malyshev 2015):
http://www.kumbarov.com/ht35/R1b-M343xM269%20Y-DNA%20tree_02_11_25_2015.pdf

YFull Experimental YTree v3.18 (Vladimir Urasin 2016)
http://www.yfull.com/tree/R1b/ (top section, for Y18462 and Y18459)

At the moment Vincent Tilroe is still in the lead since he was the first
who predicted the R1b-Y7771 level.

However, as you can see there are still plenty of phylo-equivalent SNPs
at the V3181 level that could be potentially positive.

The challenge is now to identify those SNPs out of them that could be
available at YSEQ.

I suggest you look them up in http://ybrowse.org and check what SNPs are
in the proximity. Then you look up those makers with the YSEQ search box
if they are available. I will also go through this list later today, but
of course you want to be faster than the other participants of this
challenge.

More risk friendly participants may also check on the V1169, V69 and
Y18485 branches.

So we'd like to have sponsors, still, for SNPs downstream of V7771, as explained above.

Just message or email me if interested.

Bonnie

grouza31
01-09-2016, 11:13 PM
Hi all,

The first round of tests has had results, as follows, quoted from Thomas:



So we'd like to have sponsors, still, for SNPs downstream of V7771, as explained above.

Just message or email me if interested.

Bonnie
Bonnie, thank you for these results. I think that these two samples are also positive to some SNPs that serve to define the haplogroups R-P297 and R-M269. These SNPs can be PF6464, CTS10834, PF6520, PF6469, PF6470, PF6477, PF6479, CTS623.
I will sponsor for one sample these 8 SNPs + 2 SNPs under Y18485. Meanwhile, I have to check if they are available at YSEQ.

smal
01-10-2016, 09:01 AM
I think that these two samples are also positive to some SNPs that serve to define the haplogroups R-P297 and R-M269. These SNPs can be PF6464, CTS10834, PF6520, PF6469, PF6470, PF6477, PF6479, CTS623.


Could you explain why you think so?

grouza31
01-10-2016, 11:11 PM
Could you explain why you think so?
Members of the R-V88 group (including those of subclass R-Y7771) who took FTDNA Big Y test are positive to these SNPS. All these SNPs are classified by FTDNA as high quality. In my case, for the moment (because I continue to check each SNP with high quality) I notice 9 high quality SNPs belonging to R-M269: CTS10834, PF6520, PF6469, PF6470, PF6477, PF6479, CTS623, CTS11948 (FGC54 / PF6522) CTS12972 (FGC52 / PF6532) and 2 of R-P297: PF6464 and CTS9018 (FGC188 / PF6484). This may explain why my YSTR matchs are from R-M269 and its subclasses members (more than 94%) rather than with other members of R-V88 group.
Besides, I do not understand why people do not take into account all these SNPs in the different studies of R-V88 group as they are very important to understand the migration path of R-V88 and different links (distant or recent) that are between R-V88 and R-M269.

smal
01-11-2016, 07:56 AM
Members of the R-V88 group (including those of subclass R-Y7771) who took FTDNA Big Y test are positive to these SNPS. All these SNPs are classified by FTDNA as high quality. In my case, for the moment (because I continue to check each SNP with high quality) I notice 9 high quality SNPs belonging to R-M269: CTS10834, PF6520, PF6469, PF6470, PF6477, PF6479, CTS623, CTS11948 (FGC54 / PF6522) CTS12972 (FGC52 / PF6532) and 2 of R-P297: PF6464 and CTS9018 (FGC188 / PF6484).

You are not right, all R-V88 including R-Y7771 are negative for these SNPs.

CTS10834, 22796697, all R-V88 have ancestral “T”, all R-M269 have derived “C”
PF6520, 23124367, all R-V88 have ancestral “G”, all R-M269 have derived “T”
PF6469, 17461478, all R-V88 have ancestral “T”, all R-M269 have derived “C”
PF6470, 17594966, all R-V88 have ancestral “C”, all R-M269 have derived “G”
PF6477, 18095336, all R-V88 have ancestral “A”, all R-M269 have derived “C”
PF6479, 18137831, all R-V88 have ancestral “T”, all R-M269 have derived “C”
CTS623, 6912992, all R-V88 have ancestral “T”, all R-M269 have derived “G”
CTS11948, 23379254, all R-V88 have ancestral “G”, all R-M269 have derived “A”
CTS12972, 28771116, all R-V88 have ancestral “C”, all R-M269 have derived “G”
PF6464, 16376495, all R-V88 have ancestral “A”, all R-P297 have derived “C”
CTS9018, 18617596, all R-V88 have ancestral “C”, all R-P297 have derived “T”

VinceT
01-11-2016, 08:05 AM
Members of the R-V88 group (including those of subclass R-Y7771) who took FTDNA Big Y test are positive to these SNPS. All these SNPs are classified by FTDNA as high quality. In my case, for the moment (because I continue to check each SNP with high quality) I notice 9 high quality SNPs belonging to R-M269: CTS10834, PF6520, PF6469, PF6470, PF6477, PF6479, CTS623, CTS11948 (FGC54 / PF6522) CTS12972 (FGC52 / PF6532) and 2 of R-P297: PF6464 and CTS9018 (FGC188 / PF6484). This may explain why my YSTR matchs are from R-M269 and its subclasses members (more than 94%) rather than with other members of R-V88 group.
Besides, I do not understand why people do not take into account all these SNPs in the different studies of R-V88 group as they are very important to understand the migration path of R-V88 and different links (distant or recent) that are between R-V88 and R-M269.

Please request one of them to present his "variants.vcf" file or his BAM file to confirm. Many of the early R1b SNPs were unintentionally registered with reversed polarity states, and FTDNA has not audited them.

The correct polarities these are:


ID

Ancestral
Derived
REF


CTS10834

T

C
C


CTS11468/FGC49/PF6520
G
T
T



CTS7400/FGC33/PF6469
T
C
C


CTS7659/FGC50/PF6470
C
G
G


CTS8591/FGC64/PF6477
A
C
C


CTS8665/FGC464/PF6479
T
C
C


CTS623/FGC37/PF6419

T
G
G


CTS11948/FGC54/PF6522
G
A
A


CTS12972/FGC52/PF6532
C
G
G


CTS5577/FGC38/PF6464
A
C
C


CTS9018/FGC188/PF6484
C
T
T




As you can see, the reference sequence is derived or positive for all of them. If an R-V88 sample DOES NOT match the reference sequence at these locations, he will have the ancestral or negative state, which implies that they became derived at or beneath the R-P297 branch.

grouza31
01-11-2016, 10:13 AM
Please request one of them to present his "variants.vcf" file or his BAM file to confirm. Many of the early R1b SNPs were unintentionally registered with reversed polarity states, and FTDNA has not audited them.

The correct polarities these are:


ID

Ancestral
Derived
REF


CTS10834

T

C
C


CTS11468/FGC49/PF6520
G
T
T



CTS7400/FGC33/PF6469
T
C
C


CTS7659/FGC50/PF6470
C
G
G


CTS8591/FGC64/PF6477
A
C
C


CTS8665/FGC464/PF6479
T
C
C


CTS623/FGC37/PF6419

T
G
G


CTS11948/FGC54/PF6522
G
A
A


CTS12972/FGC52/PF6532
C
G
G


CTS5577/FGC38/PF6464
A
C
C


CTS9018/FGC188/PF6484
C
T
T




As you can see, the reference sequence is derived or positive for all of them. If an R-V88 sample DOES NOT match the reference sequence at these locations, he will have the ancestral or negative state, which implies that they became derived at or beneath the R-P297 branch.

Are you saying that FTDNA and FGC have not audited these SNPs? The results provided by FTDNA are confirmed by FGC.

smal
01-11-2016, 10:54 AM
Are you saying that FTDNA and FGC have not audited these SNPs? The results provided by FTDNA are confirmed by FGC.

This is reality :).
For example, please, compare your FTDNA report for CTS10834
SNP Name Derived? On Y-Tree? Reference Genotype Confidence
CTS10834 Yes (+) ...Yes......... C............ T............ High

and the result of R-M269 man
CTS10834 .No (-).....Yes......... C............ C........... High

grouza31
01-11-2016, 11:44 AM
This is reality :).
For example, please, compare your FTDNA report for CTS10834
SNP Name Derived? On Y-Tree? Reference Genotype Confidence
CTS10834 Yes (+) ...Yes......... C............ T............ High

and the result of R-M269 man
CTS10834 .No (-).....Yes......... C............ C........... High
If what you say is true, this is very serious for the credibility of all genetic tests. It means that all the results provided for all haplogroups are false.
FGC use GRCh37 reference sequence to analized Y BAM File.
Which one uses Yfull ?
Which one uses FTDNA?

smal
01-11-2016, 12:48 PM
They all use GRCh37. The problem is not SNP mining but only an incorrect interpretation of the ancestral/derived stages. It can be easily corrected.
You're too hard on FTDNA. Fortunately, the most of their results are reliable.

grouza31
01-11-2016, 01:13 PM
They all use GRCh37. The problem is not SNP mining but only an incorrect interpretation of the ancestral/derived stages. It can be easily corrected.
You're too hard on FTDNA. Fortunately, the most of their results are reliable.

What Iknow is that : GRCh37 is built not from one individual's genome sequence, but from reference sequences of different individuals. How to determine who is derived and who is ancestral ?
Are there any confirmation of this distinction by genetic analysis of ancient remains and human skeletons?
I have been tested by Geno2, FTDNA and confirmed by FGC as V88+/PF6279+, how can I be sure that is true? What proves that this is not the reverse?

smal
01-11-2016, 01:47 PM
What Iknow is that : GRCh37 is built not from one individual's genome sequence, but from reference sequences of different individuals. How to determine who is derived and who is ancestral ? Are there any confirmation of this distinction by genetic analysis of ancient remains and human skeletons?
You need to compare individuals from different haplogroups or branches. Ancestral/derived stages for SNPs can be determined after the tree building. There are no needs to study skeletons.


I have been tested by Geno2, FTDNA and confirmed by FGC as V88+/PF6279+, how can I be sure that is true? What proves that this is not the reverse?
Because only R-V88 people have "T" in Y:4862861 position.

grouza31
01-11-2016, 02:36 PM
You need to compare individuals from different haplogroups or branches. Ancestral/derived stages for SNPs can be determined after the tree building. There are no needs to study skeletons.

If I follow your reasoning, you take my 10 SNPs in question, and you place them on the M269 branch. With the value of these SNPs, you find that they are ancestral in the M269 branch.
Now, if you take my YSTR results, my haplogroup may be ancestral to some members of this branch M269.
But my YSTR111 results provided by FTDNA indicate that it is the haploroups of some members of the M269 branch and its sub-branches that are ancestral to my haplogroup and my only YSTR67 match is a person with haplogroup M269 and GD 4.
How can you explain that?
Are my FTDNA YSTR111 results false?

smal
01-11-2016, 03:11 PM
grouza31,
Do you have contact with MASRI? We should check his haplotype. There is a very big possibility that his M269+ result is false positive. Look at 306159 Mansour data. He was a member of our M269/ht35 project and was tested M269+. But based on his STRs I have advised him to test V88. Now you can see he is both V88 and M269 positive. But you can be sure his M269+ (Y-HAP-Backbone test) is probably a lab error. Unfortunately, we can find such false positive M269 among different samples that are probably, for example, R-M73 or R1a. This is also reality.

grouza31
01-11-2016, 03:47 PM
grouza31,
Do you have contact with MASRI? We should check his haplotype. There is a very big possibility that his M269+ result is false positive. Look at 306159 Mansour data. He was a member of our M269/ht35 project and was tested M269+. But based on his STRs I have advised him to test V88. Now you can see he is both V88 and M269 positive. But you can be sure his M269+ (Y-HAP-Backbone test) is probably a lab error. Unfortunately, we can find such false positive M269 among different samples that are probably, for example, R-M73 or R1a. This is also reality.
I have no contact with Masri. I can pay for his V88 test if he is OK. Could you contact him as you are the administrator of R-M343 group?
You are right on Y-HAP-backbone test. They lead to many false positive. Before taken Big Y , I ordered FTDNA backbone test and I was positive to PF331.

MacUalraig
01-11-2016, 03:47 PM
If I follow your reasoning, you take my 10 SNPs in question, and you place them on the M269 branch. With the value of these SNPs, you find that they are ancestral in the M269 branch.
Now, if you take my YSTR results, my haplogroup may be ancestral to some members of this branch M269.
But my YSTR111 results provided by FTDNA indicate that it is the haploroups of some members of the M269 branch and its sub-branches that are ancestral to my haplogroup and my only YSTR67 match is a person with haplogroup M269 and GD 4.
How can you explain that?
Are my FTDNA YSTR111 results false?

The tree is build from SNPs, period. Bringing STRs into the discussion will just confuse people.

grouza31
01-11-2016, 04:03 PM
The tree is build from SNPs, period. Bringing STRs into the discussion will just confuse people.

I do not think so. There is a link between tree, SNPs and YSTR tests. There are questions to be asked if we have as YSTR67 match a person who is in a totally separate branch of our.

MacUalraig
01-11-2016, 04:15 PM
I do not think so. There is a link between tree, SNPs and YSTR tests. There are questions to be asked if we have as YSTR67 match a person who is in a totally separate branch of our.

You do not think what? I made two statements there. The first is a simple statement of fact. To refute it you need to show us a scientific standard Y STR tree.

The second statement is subjective. Several things you said make me wonder if you really understand what we do, but maybe its just the way you express things.
For example 'There is a link between tree, SNPs and YSTR tests' is false. At the risk of repeating myself, STRs are not used to build SNP trees.

They *might* in very rare circumstances (I'm trying to even think of one but its at least hypothetically true) point to a lab error in a SNP result. They might in very rare circumstances highlight a recurrent or back mutating SNP.

Those cases don't alter the fact that the tree is built from SNPs only.

MitchellSince1893
01-11-2016, 04:15 PM
I do not think so. There is a link between tree, SNPs and YSTR tests. There are questions to be asked if we have as YSTR67 match a person who is in a totally separate branch of our.

If they are on a separate branch then the 67 marker match is just a coincidence. Some of my closest 111 markers matches are R-U106 and I'm U152. These matches are irrelevant and should be ignored.

With a Yfull estimated MRCA of 3200 years ago my confirmed terminal SNP branch matches has a GD of 17 at 67 Markers. I have plenty of false 67 marker matches that have closer GDs. For example, two R-L21 individuals have a GD of 11 at 67 markers. Again these two "matches" should be ignored as our MRCA was around 4500 years ago.

grouza31
01-11-2016, 04:25 PM
If they are on a separate branch then the 67 marker match is just a coincidence. Some of my closest 111 markers matches are R-U106 and I'm U152. These matches are irrelevant and should be ignored.

I had written several times FTDNA. They confirmed that my YSTR67 match with this personn in other branch is correct and relevant.
Look here the all results with this match : YSTR12 GD=0, YSTR25 GD=0, YSTR37 GD=4, YSTR67 GD=4. This match has not tested YSTR111.

MitchellSince1893
01-11-2016, 04:28 PM
I had written several times FTDNA. They confirmed that my YSTR67 match with this personn in other branch is correct and relevant.
Look here the all results with this match : YSTR12 GD=0, YSTR25 GD=0, YSTR37 GD=4, YSTR67 GD=4. This match has not tested YSTR111.

The only way this would be a true match is if the SNP difference between you and this individual occurred very recently. e.g. within the last 1000 years, and more likely the last 400 years.

grouza31
01-11-2016, 04:30 PM
You do not think what? I made two statements there. The first is a simple statement of fact. To refute it you need to show us a scientific standard Y STR tree.

The second statement is subjective. Several things you said make me wonder if you really understand what we do, but maybe its just the way you express things.
For example 'There is a link between tree, SNPs and YSTR tests' is false. At the risk of repeating myself, STRs are not used to build SNP trees.

They *might* in very rare circumstances (I'm trying to even think of one but its at least hypothetically true) point to a lab error in a SNP result. They might in very rare circumstances highlight a recurrent or back mutating SNP.

Those cases don't alter the fact that the tree is built from SNPs only.

Have you forgotten that many haplogroup were predicted just on the basis of YSTR tests?

Cofgene
01-11-2016, 06:11 PM
The tree is build from SNPs, period. Bringing STRs into the discussion will just confuse people.


Nope the tree includes other variants. PERIOD. There are INDELs and at least one MNP present.

Joe B
01-11-2016, 06:12 PM
Have you forgotten that many haplogroup were predicted just on the basis of YSTR tests?
SNPs and STRs are coincidental to each other and the history of false haplogroup predictions is long. The science has moved on from haplogroup predictions from STRs to assigning a haplogroup from a series of SNPs. This eliminates any problems with back mutations or incorrect single SNP results. smal and Vince are two of the best at this kind of detailed anlysis.

MacUalraig
01-11-2016, 07:01 PM
I had written several times FTDNA. They confirmed that my YSTR67 match with this personn in other branch is correct and relevant.
Look here the all results with this match : YSTR12 GD=0, YSTR25 GD=0, YSTR37 GD=4, YSTR67 GD=4. This match has not tested YSTR111.

They are confused and/or trying to plug their legacy STR matching database which is proven to be unreliable.

There are parts of the tree (M222 being one of the most striking) where SNPs can be predicted from STRs in most cases. Even then, there is no substitute for actually getting the SNP confirmation. In other parts of the tree it is not nearly so clear.

VinceT
01-11-2016, 09:17 PM
Are you saying that FTDNA and FGC have not audited these SNPs? The results provided by FTDNA are confirmed by FGC.
That's what I'm saying, and I confess that I was unfairly biased against FTDNA in my previous statement. When FGC submitted their variant discoveries for Thomas Krahn's Ybrowse database, they had not performed a complete comparative phylogenetic analysis. Ditto for when Thomas had uploaded Chris Tyler-Smith's and Paolo Francalacci's published variants, both of whom are very respected and world-renown population geneticists. We simply didn't know where these variants fit in the tree until recently.

TigerMW
01-11-2016, 10:09 PM
Moderator note: This is a very important thread. I think we are getting side tracked on to issues beyond topic of thread. I understand that some of this is unavoidable but we are spiraling. Please, let's come back to the topic. Any one who wants to start up another thread in the appropriate category and refer to it from here, is welcome to.

TigerMW
02-06-2016, 06:04 PM
National Geo Society's Geno 2 NG has YSC0000072 as its own branch just below L23 and just above L51 and Z2103. It looks possible from a glance but do we have anything that would invalidate this position?

smal
02-06-2016, 06:57 PM
1. Geno 2 NG produces unreliable results for Z2103.
2. YSC0000072 is one of unstable markers that can be found in dozens of haplogroups and clades. I do not exclude that it can be useful for some family projects.
However, this marker cannot define clade of such level as Z2103 or L51.

Joe B
02-06-2016, 07:08 PM
National Geo Society's Geno 2 NG has YSC0000072 as its own branch just below L23 and just above L51 and Z2103. It looks possible from a glance but do we have anything that would invalidate this position?
1. Geno 2 NG produces unreliable results for Z2103.
2. YSC0000072 is one of unstable markers that can be found in dozens of haplogroups and clades. I do not exclude that it can be useful for some family projects.
However, this marker cannot define clade of such level as Z2103 or L51.There are several examples of people ordering SNP YSC0000072 based on past FTDNA haplotrees and getting a negative result. Seems that testing YSC0000072 by Sanger sequencing will get a negative read while SNP array gets a positive call.

VinceT
02-07-2016, 12:31 AM
There are several examples of people ordering SNP YSC0000072 based on past FTDNA haplotrees and getting a negative result. Seems that testing YSC0000072 by Sanger sequencing will get a negative read while SNP array gets a positive call.
I would tend to distrust SNP-chip probes for this variant. There's a poly-A region just to the left of PF6426/YSC0000072 that could make the probe design fallible.


>ChrY:7766662..7766762 CATGCTTGCAAAAGGGTAAAAAAAAAAAAAAGTTTCTTTTGAAGTTGTGC[C|T]TTCATTGCC CTTCTTCCTGTGCAAACTGGAAAAAATATCTTGGAATTTTT

smal
03-04-2016, 08:31 PM
The R-M343 (M73- M269-) DNA Project (https://www.familytreedna.com/public/R1b1Asterisk/) tree was updated. 2 BigY tested samples were added:
1) FTDNA-N4337 (Gil)
2) FTDNA-376858 (alateik)

In addition, data discovered by YFull from a re-analysis of 2 Sardinian samples (Francalacci at al. 2013) were included.

Joe B
03-13-2016, 09:09 PM
There is another nice update to the R1b-M269 x106 xP312 tree posted by smal.
"The R1b-M269 (P312- U106-) project tree was updated https://www.familytreedna.com/groups/ht-3-5new/about/results. 17 NGS tested samples were included:"
It's best to download the PDF version and use the search function.
Here are the haplogroups with the new data from smal.
R1b-M269>PF7562 (2)
R1b-M269>L23>Z2103>L584 (2)
R1b-M269>L23>Z2103>Z2106>Z2109>CTS3937>M64 (3)
R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>Y18959 (1)
R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>Y18959>Y5587>Y5586 (2)
R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>Y18959>Y5587>BY593 (1)
R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>BY250>Y15983>BY3297 (2)
R1b-M269>L23>L51>PF7589>CTS6889 (1)
R1b-M269>L23>L51>P311>FGC37082 (2)
R1b-M269>L23>L51>P311>S1194>CTS4528 (1)

@smal
Everyone really appreciates your hardwork and steadfast adherence to the scientific method.

Joe B
05-26-2017, 04:44 PM
Update to the R1b-M269 x106 xP312 tree posted by smal. v.37
https://www.familytreedna.com/groups.../about/results. 23 NGS tested samples were included so most branches will see some development.
Of note this year is the establishment of a fourth branch to the R1b-Z2103 haplogroup. R1b-PF311 is found in Saudi Arabia, Italy and England. https://www.yfull.com/tree/R-PF331/ Obviously a little early to figure out this branch.
R1b-Z2103>PF311
R1b-Z2103>Y4362, L277
R1b-Z2103>FGC14586/Y13370>L584
R1b-Z2103>Z2106

Tqes
07-12-2017, 05:44 PM
Recently got my results, from Ftdna Z2103 pack:

R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>Y18959> Y5587>Y5586

Most common in Bulgaria, some samples in Spain and Germany. I am of portuguese origins... by the distribution I think Legio IV Macedonica... Can anyone help me figure this out?

Silesian
07-22-2017, 01:15 PM
Recently got my results, from Ftdna Z2103 pack:

R1b-M269>L23>Z2103>Z2106>Z2109>CTS7822>CTS9219>Y18959> Y5587>Y5586

Most common in Bulgaria, some samples in Spain and Germany. I am of portuguese origins... by the distribution I think Legio IV Macedonica... Can anyone help me figure this out?

Welcome to the forum. Forgot about this thread. Nice to reflect what was originally posted within the 5 year anniversary range of this thread. Here is what I posted way back in 2013- with regards R1b variance lines 5586/5587 compared to L277 found in Bashkir-Nazarov. At that time we had a rough idea trying to compare apples with oranges strs and new snps. Although some had pointed to the region of Levant and Anatolia as to the origin of 5586/5587 and L277, new scientific studies have shown that Yamnaya also carried a branch of R1b. Also Alans aka Ossetians also carry a branch of R1b as well as Sarmatians.

04-20-2013, 12:46 AM

Well it seems rather odd the base model for Bashkir's haplotype is 12 24 14 10 X X X 12 12 13 13 30 - 10. who had a common ancestor 500+/- ybp is closer to my numbers than Nazarov.

L23+

12 24 14 10 X X X 12 12 13 13 30 - 10. Bashkir base model
12 24 14 10 X X X 12 12 11 14 31-Poland
12 21 14 11 X X X 12 12 12 13 28- Khazakstan

As we get more autochthonous R1b samples from both Europe/Steppe[20-30+/-samples] and Levant/Anatolia/Iran[1 sample] the matter should begin to resolve itself as to origin, of both R1b L277 and R1b- 5586 and 5587 lines.

Joe B
01-16-2018, 08:55 PM
There's a new R1b-M343 (P312-, U106-) Phylogenetic Tree found at the R1b Basal Subclades project. Best to download the searchable PDF version because of it's size. https://www.familytreedna.com/groups/r-1b-basal-subclades/about/results

Invisible Sun
01-16-2018, 11:09 PM
There's a new R1b-M343 (P312-, U106-) Phylogenetic Tree found at the R1b Basal Subclades project. Best to download the searchable PDF version because of it's size. https://www.familytreedna.com/groups/r-1b-basal-subclades/about/results

So does I0122 Khvalynsk R1b guy really belong to the same V1636 clade as the Kura-Araxes boy? I was actually expecting the clade to be more rooted since very ancient times around Caucasus area, at least for Georgian, Armenian and Iranian haplotypes...recently an updated version of the Yfull tree is dating its TMRCA to 6200 ybp, on average.

WCod
05-04-2020, 10:33 PM
Hi Tqes, I am the same haplogroup Y5586. Maybe we can help each other!