View Full Version : R1b-L2
harryandliz1
04-28-2013, 12:51 PM
Hi,
Are there many members that are L2
R.Rocca
04-28-2013, 01:52 PM
Hi,
Are there many members that are L2
Yes, there are a few of us here now.
harryandliz1
04-29-2013, 07:17 AM
Yes, there are a few of us here now.
Thanks for your reply
Name is Shannon and we have been researching the family for about 20 years
We have not found any DNA relationship with any other Shannon despite paying for many
tests for people from Ireland, Scotland, USA and Australia.
Earliest known relative was located in Ireland in the mid 1700's
His grandson came to Australia in 1930 from Dublin and started the family here (last count about 6000)
We have an association that has paid for most of the testing done to date.
Burning of Irish records in 1920's has put a stop to using this source
Church records have us back as far as we can go as the family moved around causing a gap
Family have been merchants and leather workers and seem to have arrived in northern Ireland from Scotland
in 1600 or early 1700's
With L2 having its center from Northern Italy/Switzerland/ east France/ Black forest, we have no idea how we arrived in Scotland but may have been with Normans or earlier as traders and the name then certainly was not Shannon
L2 is more than interesting -
looking at DNA and associated names
1) no trends of family names
2) looks like the DNA has dispersed to many countries but in low percentages in each country
3) there is some thought that this may be because they were traders
4) there is some thought that dispersion/trading may have some sephardic (s) roots
5) my family in Australia has never thrown a lot of males
Female side is also difficult to trace back as original male in Australia married an Irish orphan and her name may have been given to her by the orphanage.
There is a lot more but I am tired and off to bed
harryandliz1
05-01-2013, 08:39 AM
My apologies
I am not as up to date as I should be with the latest testing but testing to the 111 level we come out as L2.
From my memory of many years ago we were the first L2 FTDNA found and we were used as the standard for L2 with FTDNA. I don't know if this is still the case
That now be old history I am now trying to catch up with what has happened in the last few years with testing.
As you can see we have not been too successful in finding family members in Ireland, Scotland or the USA.
I will not be asking any stupid questions but intend to Lurk around and learn on this site and others at the same time helping others if I can
Regards
R.Rocca
05-01-2013, 11:52 AM
My apologies
I am not as up to date as I should be with the latest testing but testing to the 111 level we come out as L2.
From my memory of many years ago we were the first L2 FTDNA found and we were used as the standard for L2 with FTDNA. I don't know if this is still the case
That now be old history I am now trying to catch up with what has happened in the last few years with testing.
As you can see we have not been too successful in finding family members in Ireland, Scotland or the USA.
I will not be asking any stupid questions but intend to Lurk around and learn on this site and others at the same time helping others if I can
Regards
Harryandliz1, if you have been away for that long, then the the hypotheses around U152 have indeed changed.
Whereas U152's expansion was once attributed mainly to Celtic La Tene movements, academic testing has shown some of its highest frequency in areas with no Celtic influence, primarily Central Italy and Corsica. Along with its brother clades L21 and DF27, it seems to have expanded during the Copper Age and Early Bronze Age.
If you don't mind posting it, what is your kit number?
Claxon
05-01-2013, 02:53 PM
My apologies
I am not as up to date as I should be with the latest testing but testing to the 111 level we come out as L2.
From my memory of many years ago we were the first L2 FTDNA found and we were used as the standard for L2 with FTDNA. I don't know if this is still the case
That now be old history I am now trying to catch up with what has happened in the last few years with testing.
As you can see we have not been too successful in finding family members in Ireland, Scotland or the USA.
I will not be asking any stupid questions but intend to Lurk around and learn on this site and others at the same time helping others if I can
Regards
Have you tried research thru www.ancestry.co.uk ?
If your ancestors are not mainly US, this is more cost effective than signing up thru US and adding uk. Costs $25 for a month, then cancel until you need it again, or go for a year at a time.
You can get copies of census etc, and also I have had a LOT of luck in clicking on " Family Trees". Also, I am the authority on posting "stupid questions" and get much support, so don't worry about that.
This forum is VERY forgiving, with the best knowledgable people.
Rich C
harryandliz1
05-02-2013, 11:35 AM
Hi Richard,
Thanks for the reply and I certainly am surprised about the amount of activity.
That activity seems to be very recent (last year or so) was there some reason for the sudden surge in activity?
We seemed to be sitting out there as L2 for a long time before others started turning up, now there seems to be a cloudburst with more and more sub-clades under L2.
For years our family research considered that the Russians seemed to have the best and most logical movement of the U152 DNA through North Africa and into Spain Then the severe drought that also disrupted the Egyptian kingdoms and created the deserts in north Africa. Resulted in what was left of the European population surviving in the Pyrenees until they were able to spread out again some going north and east into France. With what became L2 moving along the Mediterranean coast and into northern Italy and up into the Alpes.
I think the old name given to the was Alpine Celts.
However there seems to be as many theories as there are papers written. Never the less, taken with a grain of salt the Russians have been very logical in their hypothesis.
With regard to central Italy - if you check on Roman history, the alpine tribes in the upper Po valley and down the mountains to about where Monarco is today stopped the Romans advance, into what is now France, for many years. When the Romans finally won through they rounded up as many of that population as they could ( about 20,000) and moved them to the area South and East of Rome (where the Abruzzi region is today) so they didn't do it again. That would give a high reading in central Italy
We have several Kits, The best one is the public one and that is 159917 if that is any help to you.
The name in Scotland is derived from the German Aschennane (or one of its variants) which comes from the Swiss German border area
As I said we cannot find any related L2 in Southern Ireland or Dublin where our ancestor came from (still looking into Northern Ireland but the records are not as good as in Southern Ireland). Have not found any related L2 in Scotland as it seems most of the family left during the clearings. We know several reached the USA but are very distant cousins.
I hope this may be of some use to you. The reason we stopped doing more research was that we found ourselves bashing our heads on the wall trying to get more information and people to test.
But we did assist a lot of people in the USA get in touch with their Ireland Roots. It is funny we found that in the USA people were happy once they found the relatives that first reached The USA ( a bit of the Mayflower I think)
Best regards
harryandliz1
05-02-2013, 11:45 AM
Thanks Rich
That information is very useful unfortunately we are in Ancestry in the USA and Australia
We are reasonably comfortable that our people left Scotland in the mid to late 1600 but getting connection links is a problem. Particularly in Northern Ireland as Immigration records are very haphazard to say the least and people and family just seem to appear and disappear with no links in church and civil records.
I have just sent a reply to Richard's questions that should fill you in with more of the story to date\
Best regards
R.Rocca
05-02-2013, 01:37 PM
Hi Richard,
Thanks for the reply and I certainly am surprised about the amount of activity.
That activity seems to be very recent (last year or so) was there some reason for the sudden surge in activity?
We seemed to be sitting out there as L2 for a long time before others started turning up, now there seems to be a cloudburst with more and more sub-clades under L2.
For years our family research considered that the Russians seemed to have the best and most logical movement of the U152 DNA through North Africa and into Spain Then the severe drought that also disrupted the Egyptian kingdoms and created the deserts in north Africa. Resulted in what was left of the European population surviving in the Pyrenees until they were able to spread out again some going north and east into France. With what became L2 moving along the Mediterranean coast and into northern Italy and up into the Alpes.
I think the old name given to the was Alpine Celts.
However there seems to be as many theories as there are papers written. Never the less, taken with a grain of salt the Russians have been very logical in their hypothesis.
With regard to central Italy - if you check on Roman history, the alpine tribes in the upper Po valley and down the mountains to about where Monarco is today stopped the Romans advance, into what is now France, for many years. When the Romans finally won through they rounded up as many of that population as they could ( about 20,000) and moved them to the area South and East of Rome (where the Abruzzi region is today) so they didn't do it again. That would give a high reading in central Italy
We have several Kits, The best one is the public one and that is 159917 if that is any help to you.
The name in Scotland is derived from the German Aschennane (or one of its variants) which comes from the Swiss German border area
As I said we cannot find any related L2 in Southern Ireland or Dublin where our ancestor came from (still looking into Northern Ireland but the records are not as good as in Southern Ireland). Have not found any related L2 in Scotland as it seems most of the family left during the clearings. We know several reached the USA but are very distant cousins.
I hope this may be of some use to you. The reason we stopped doing more research was that we found ourselves bashing our heads on the wall trying to get more information and people to test.
But we did assist a lot of people in the USA get in touch with their Ireland Roots. It is funny we found that in the USA people were happy once they found the relatives that first reached The USA ( a bit of the Mayflower I think)
Best regards
Please know that there have been two large groups below L2 that have been found in the last 2 years. One is Z49 and the other is Z367. You way want to test for them (although not both at once since they are mutually exclusive).
Claxon
05-02-2013, 05:33 PM
Thanks Rich
That information is very useful unfortunately we are in Ancestry in the USA and Australia
We are reasonably comfortable that our people left Scotland in the mid to late 1600 but getting connection links is a problem. Particularly in Northern Ireland as Immigration records are very haphazard to say the least and people and family just seem to appear and disappear with no links in church and civil records.
I have just sent a reply to Richard's questions that should fill you in with more of the story to date\
Best regards
It has has mentioned in a blog, that large ammounts of parrish and civil records are being put into databases. I may have the info a bit incorrect... but that was the gist of things. I would think that this will eventually be the case for the Isles at some point. They certainly have much more interest with paper trails on the whole than this side of the pond, altho that is of course , of interest... but we are getting more and more interest in the DNA side of things, while THAT side is apparently running away screaming when DNA testing is mentioned.
Anyway, not to clutter the board, I am
[email protected] for further chatting
RichC
GailT
05-03-2013, 12:59 AM
Please know that there have been two large groups below L2 that have been found in the last 2 years. One is Z49 and the other is Z367. You way want to test for them (although not both at once since they are mutually exclusive).
Another option is to test the full y-DNA genome, there are four R-L2 samples in the phase III pilot study, and hopefully we will get some interesting results.
harryandliz1
05-03-2013, 10:44 AM
Hi Richard
Do you have any idea where the nodes for Z49 and Z367 are presently located in Europe and if there is any info as to rough dates the changes occured.
I will contact the lass who has the funds and authorises testing on the families behalf and see how soon we can get some testing done.
Regards H
R.Rocca
05-03-2013, 11:24 AM
Z49 does not seem to have an obvious centerpoint, but Z367 is the parent of Z34 and L20. Z34 seems to be more prevalent around the North Sea and L20 in France.
Claxon
05-03-2013, 01:41 PM
Harry, I am an amateur in this stuff. Others can address your questions much better than I can.
Rich C
nfvee
05-04-2013, 12:30 AM
Hi harryandliz1
I am am in pretty much the same boat as you. R1b, L2, Z49- Kit # 129628 FTDNA tested at 67 markers with only one match beyond 12 markers, at 67 markers and not of the same surname or nationality(He is Danish). My family name is Dalton. Family lore says that our family arrived in Newfoundland from Ireland in early to mid 1700s through involvement in the fishing industry(there are some vague references to Cork but no paper or DNA trail). I am part of the Dalton International project but no matches there. Im not sure how our results compare.
Regards
harryandliz1
05-04-2013, 12:01 PM
Your remarks are normal as far as we have found -
We have distant cousins in Norway Denmark Iceland Bahamas and South America at the 67 marker level but none at the 111 level.
Names of distant cousins have nothing in common.
You may be Irish with viking or Anglo Saxon connections with the link into Denmark (At one time the Danish empire covered Scandinavia and a lot of eastern Germany and Poland)
If what I suspect is true, many L2 were Sephardic traders who spread all over Europe
Because they had to protect themselves on their journies their fighting powers were well known and they were often used as mercenaries.
For example the Tutonic Knights were Sephardic and they sold their services to a wide range of people and countries, going on several crusades.
Also the majority of trading vessels in the period 700 to 1300 AD were owned and manned by Sephardics
It was their vessels that any king had to hire if he wanted to travel to or attack another country.
Sephardic people had no problem changing their name frequently and to fit in with the locality, as their true family name was only spoken and recorded in the Synagogue. These secret names do not show up in any civil records and children were not told of their proper (secret name) until they turned 14. Their Synagoges never published any secret names but every person was recognised by his secret name in the church and in private meetings with other Sephardics.
Hope this helps
R.Rocca
05-04-2013, 12:29 PM
Your remarks are normal as far as we have found -
We have distant cousins in Norway Denmark Iceland Bahamas and South America at the 67 marker level but none at the 111 level.
Names of distant cousins have nothing in common.
You may be Irish with viking or Anglo Saxon connections with the link into Denmark (At one time the Danish empire covered Scandinavia and a lot of eastern Germany and Poland)
If what I suspect is true, many L2 were Sephardic traders who spread all over Europe
Because they had to protect themselves on their journies their fighting powers were well known and they were often used as mercenaries.
For example the Tutonic Knights were Sephardic and they sold their services to a wide range of people and countries, going on several crusades.
Also the majority of trading vessels in the period 700 to 1300 AD were owned and manned by Sephardics
It was their vessels that any king had to hire if he wanted to travel to or attack another country.
Sephardic people had no problem changing their name frequently and to fit in with the locality, as their true family name was only spoken and recorded in the Synagogue. These secret names do not show up in any civil records and children were not told of their proper (secret name) until they turned 14. Their Synagoges never published any secret names but every person was recognised by his secret name in the church and in private meetings with other Sephardics.
Hope this helps
Aside from the Ashkenazi-heavy L408 subclade of L2, which based on STR values is very young and probably originated in the middle Rhine, there is nothing "Jewish" about L2, and especially not Sephardic.
harryandliz1
05-04-2013, 01:49 PM
Hi Richard,
We did not think so either until we started looking into it about 8 years ago.
You need to know your history to go through the information to sort it out and you certainly cannot have any anti-semeatic feelings or you miss the critical information.
We have many academics including a couple of Vice Chancellors in the family who have taken a keen interest and contributed to the research. That is also how we have come across so much of the Russian information
Having Sephardic roots is nothing to be ashamed of a significant number of the most famous people in the world have Separdic roots
A lot of people who have Sephardic roots are unaware of their past as they changed religion to stop from being killed by the inquisition and to disappear into the communities of the countries they went to. Only about 5% of those with Sephardic roots still call themselves Sephardic. Ultimately we will find L2 is much more people who have Sephardic rootsthan any testing has has revealed to date.
There are significant differences in the two Jewish groups with the Sephardic being far older and based in The Iberian peninsular a 1000 years before Rome conquered Spain. Their only problem in Spain was they were used by the Arabs as their teachers and administrators.
Sephardic means Spanish Jew but few of them remained in Spain. As I mentioned they became the traders of Europe and when they were tossed out of Spain and Portugal in the 1500's they went to many countries England, France, Holland, Italy, Turkey , Morocco, South America, Mexico.
Most then went underground and changed names and religions
Some became Hugenaught (s) You would be surprised at the number of famous historic people who have Sephardic roots.
Some helped HenryV111 to set up the church of England. Others founded some of the worlds great Universities.
Collumbus was Sephardic and took a few ship loads of his compatriots to the new world. The inquisition spent a lot of time tracking them down in Mexico etc
There is much more but I am off to bed
R.Rocca
05-04-2013, 02:11 PM
Hi Richard,
We did not think so either until we started looking into it about 8 years ago.
You need to know your history to go through the information to sort it out and you certainly cannot have any anti-semeatic feelings or you miss the critical information.
We have many academics including a couple of Vice Chancellors in the family who have taken a keen interest and contributed to the research. That is also how we have come across so much of the Russian information
Having Sephardic roots is nothing to be ashamed of a significant number of the most famous people in the world have Separdic roots
A lot of people who have Sephardic roots are unaware of their past as they changed religion to stop from being killed by the inquisition and to disappear into the communities of the countries they went to. Only about 5% of those with Sephardic roots still call themselves Sephardic. Ultimately we will find L2 is much more people who have Sephardic rootsthan any testing has has revealed to date.
There are significant differences in the two Jewish groups with the Sephardic being far older and based in The Iberian peninsular a 1000 years before Rome conquered Spain. Their only problem in Spain was they were used by the Arabs as their teachers and administrators.
Sephardic means Spanish Jew but few of them remained in Spain. As I mentioned they became the traders of Europe and when they were tossed out of Spain and Portugal in the 1500's they went to many countries England, France, Holland, Italy, Turkey , Morocco, South America, Mexico.
Most then went underground and changed names and religions
Some became Hugenaught (s) You would be surprised at the number of famous historic people who have Sephardic roots.
Some helped HenryV111 to set up the church of England. Others founded some of the worlds great Universities.
Collumbus was Sephardic and took a few ship loads of his compatriots to the new world. The inquisition spent a lot of time tracking them down in Mexico etc
There is much more but I am off to bed
1. Disassociating the spread of one of western European's largest Y-DNA lineage which arose somewhere in central or Western Europe and is found almost entirely in Indo-European speaking areas is not being anti-Semite nor anti-Sephardi, it is being a realist. Saying anything to the contrary is irresponsible and hints at the wishful thinking of trying to associate one's lineage with an exotic origin.
2. Why would we strain ourselves with "ultimately finding Sephardi" that are L2 when none have been found to date? Again, with non-paternal events anything is possible, but let's not make broad and illogical assumptions based on the .00000000001% probability.
harryandliz1
05-04-2013, 10:55 PM
Hi Richard,
End of Conversation
1 The family did not set out to do anything of what you are referring to.
2. There are several papers that show some L2 people as being Jewish or are you selective as to who's papers you read or where they come from.
3 We are not Jewish and do not wish to be, but have an open mind, as all academics should have, and set out to prove a null hypothesis. To date all evidence of L2 points in the directions I have indicated. This was not our null hypothesis.
4 Your hostile reactions does indicate anti-semitic thinking. As such you will not be impartial in your reasoning.
5 Therefor you are not capable of a logical discussion.
6 We do not wast our time trying to have discussions with people who are not impartial.
7. I will give answers, to the best of my ability, and hold discussions with those people who do not have an agenda or are who may be frightened of the truth that will be found, as painful as it may be.
It is obvious that a reasoned discussion with you is impossible and will lead no where.
I am sorry that this is the case as you do seem to have a lot to contribute in the area of DNA research.
When you decide to be impartial I will be only to happy to continue at some future date
R.Rocca
05-05-2013, 01:32 AM
Hi Richard,
End of Conversation
1 The family did not set out to do anything of what you are referring to.
2. There are several papers that show some L2 people as being Jewish or are you selective as to who's papers you read or where they come from.
3 We are not Jewish and do not wish to be, but have an open mind, as all academics should have, and set out to prove a null hypothesis. To date all evidence of L2 points in the directions I have indicated. This was not our null hypothesis.
4 Your hostile reactions does indicate anti-semitic thinking. As such you will not be impartial in your reasoning.
5 Therefor you are not capable of a logical discussion.
6 We do not wast our time trying to have discussions with people who are not impartial.
7. I will give answers, to the best of my ability, and hold discussions with those people who do not have an agenda or are who may be frightened of the truth that will be found, as painful as it may be.
It is obvious that a reasoned discussion with you is impossible and will lead no where.
I am sorry that this is the case as you do seem to have a lot to contribute in the area of DNA research.
When you decide to be impartial I will be only to happy to continue at some future date
End of conversation.
3. None of the academic data points to the evidence you indicated. If you have some academic data to the contrary, please do share.
4. Trust me, my reaction would be the same if you tried to associated L2 with Chinese or Native American or from the planet Mars. Anti-anything is not in my DNA, so stop making such disgusting and slanderous accusations.
Slanderous comments and/or strawman arguments have no place on this forum and are considered "inflammatory" in line with Rule 3.10 (http://www.anthrogenica.com/faq.php).
Future posts containing the above in this thread will be removed. Please remain on topic without resorting to accusations of discriminatory behaviour.
GailT
05-05-2013, 04:48 AM
Harry and Liz - I'm not sure that this was your intent, but you seem to be suggesting that R-L2 is primarily or largely of Sephardic origin, and this is most certainly not the case. While it's likely that some L2 men married into or had children in Sephardic communities, L2 is not likely to be common in those communities.
Please don't assume that someone is anti-Semitic because they interpret the data differently than do you. I think Richard's analysis of the data seems accurate, but all of us here are interested in any new data that becomes available.
Pigmon
05-05-2013, 02:09 PM
Greetings HarryandLiz and all my L-2+ cousins!
Hopefully everyone is understanding of the prior posts and I for one do not think any malcontent was intended. If it was we can forgive and continue with the discussion.
I am L-2+ Z49+ and Z142+ and I was wondering if anyone else had run across information such as this:
"Thanks for sharing the information.
I would be interested in what information you have on the Pigmans from Prussia. The information I have on the Pigman name is purely word of mouth. I have been told it was the family name in the old country (Volynya, Ukrania) and changed upon entry to the US at Ellis Island in 1899. However, I have had no success with passenger records through the National Archives or on Ellis Island trying to find an entry.
The story behind our Pigman name is that it was changed upon entry to Ellis Island to Schwartz/Swartz. The person checking Frank Pigman in at Ellis Island told him that Pigman was not a good name for a Jew so Frank should take his name--it was either Schwartz or Swartz. Frank was born in 1877 and have five brothers and one sister. Two of his brothers, Joseph and Benny, also came to the US. Per the 1910 census Benny came in at a different time than Frank, don't know about Joseph."
The above was from a fellow Pigman/Pigmon researcher from 2003 and while is not proof of anything it does indicate that at least one branch of the Pigman family was Jewish from Ukraine.
Do you have any such references from your family?
Curtis Pigman/Pigmon (French Pigmon/Pimond and πυγμη-fist-ancient Greek)
harryandliz1
05-06-2013, 12:36 AM
I was replying to nfvee when I said
If what I suspect is true, many L2 were Sephardic traders who spread all over Europe
I did not say all only "many"
Like any religion it is a state of mind not genetic but it does flow in families.
One does not have to be a practising Sephardic to have Sephardic roots.
This is a problem with DNA testing the people say what religion they are or they think ancestors were, while their names indicate there is a high probability of their ancestors being Sephardic. People doing DNA research are not well grounded in either History or Human Geography or naming traditions so their interpretation tends to be superficial rather than analysing in depth using all the available tools.
History and Human Geography is still well in front of what DNA is indicating because they had to do analyse in depth
My associates and I are academics who started our research before DNA testing came into being for ancestry.
Since my retirement 8 years ago I have been able to concentrate on my specialties of ancient European history and Human Geography for my families benefit.
Well before DNA we were researching Sephardic Jews and how their ancestors arrived in Spain.
We knew that had been sent from Spain in the 1500 and those that remained had to become Catholic
We knew many had gone to France Italy Turkey and the Americas.
We also knew that many of those who became Catholic continued their old religion but underground.
Many who went to France became Huguenot (Calvinists) In Germany they became Lutheran and if you read the book "Jewish Scotland" you will be surprised to find how underground and above ground Jewish Scotland was because Scotland did not discriminate against Jews.
There are several listings of common Sephardic Surnames if you use them you will find an enormous number of Sephardic Jewish names in historic Scotland.As well as in Italy, Germany and Holland.
In more modern times say late 1500's on, the Inquisition moved from Spain to Italy To Mexico and to Holland. In all of these countries Sephardics changed names and religion. When Mary Queen of Scott's was burning people Those in Scotland also changed names and religion. Many later becoming Presbyterian because of it being Calvinistic.
Why were Sephardics drawn to Calvinism - Because they had most of the same beliefs and only used the old Testament.
There are many old papers (in the last 70 years or so) that cover their spread throughout the countries of Europe.
We are not talking about what happened yesterday. To be informed you have to look at what has happened in the last 3000 years and in depth before you start to give opinions from DNA tests which have data associated with it given by people often guessing what their family in Europe were doing 200 plus years ago
It was only after DNA testing began to have a big enough sample base that it has started to become a tool
HOWEVER - the data from DNA testing from the "popular sites" is strongly biased towards families of migrants who went to the USA because this is where the large majority of samples are coming from. If this data is removed because of this significant bias and we look at the data from pure academic testing the sample sizes and sampling bias may still be too low to be giving results that will not be changed as more data and better/More thorough/different tests become available.
Do not be too eager to embrace this new tool of DNA testing as the definitive answer. Nor to be too eager to use information such as religion or where their ancestors come from without checking in depth.
As has been found by sociologists, people have their own agenda or more often than not do not know much about their ancestors religion or name changes or even what countries they moved between. Particularly from those people living within the USA because there is a huge information gap when it comes to their ancestors across the Atlantic as it seems that once they trace their ancestors to when they arrived in the USA they have little interest in going across the Atlantic. Those that do have information of their European ancestors more often do not go back before 1800 and that date in historical terms is yesterday
This is becoming a history lecture and may not be of interest to many so I will stop here and at a later date talk about peoples haste to form erroneous conclusions and have perceived bias because. While their knowledge of a new tool may be immense they lack understanding of that new field of studies limitations. Thinking that the results they are seeing are correct when to others it is obvious their understanding of the results is limited by their inexperience of analysis at depth using historical data. This is why we have Professors to guide new players into thinking in depth and not jumping to quickly to conclusions.
R.Rocca
05-06-2013, 01:01 AM
harryandliz1, you still have not produced any proof of your association of L2 with "many" Sephardi. By the way, how much is "many" in your mind, several hundred? We are all here to learn, so please enlighten us with the extensive research you have done. If you fail to back up your claims with data, most will be hard pressed to accept them, no matter how many paragraphs you write.
By the way, I find it interesting that someone from Australia would belittle the genealogical aptitude of Americans.
harryandliz1
05-06-2013, 01:50 AM
Hi Pigmon,
You are not alone in this name change.
After DNA testing became reasonably stabilized we began testing and then going back to the records we had from civil and church records in Europe, we began contacting people who seemed to be related and had similar surnames and having their DNA tested.
The results from this testing were on the whole negative even when there were church records that said the should be positive. We then did a wide DNA test within the known family of today which all correlated as being the same DNA.
What was the problem???
Well for a start one in five to one in three children born of any woman do not have the same father (go and look up the papers it came from DNA testing of families and also animals) Take this back over several generations and the aberrations are enormous. We are still totally surprised at the reliance that people are putting into DNA testing as an accurate tool to answer their family history
As a tool, at best, it is potentially inaccurate in this use for more than a couple of generations
However it certainly has its uses. Taken collectively it is showing a lot of what was speculated about in Human Geography 30 or so years ago to be reasonably accurate.
In the early days we then started contacting people who were early L2's and asking about their history. A number of them were either Jewish or knew that their family had a Jewish past. It was not a large sample but the high proportion and the smattering of Sephardic surnames started us down the track of thinking that it may be one of the reasons why we were finding L2 scattered as wide as it is. Also the lack of finding common surnames tended to indicate significant name changes or not a big enough sample.
Lately what we are seeing with the large number of sub-clades under L2 appearing. Is what we expected to find when the present population was focused upon. It is not so much sub-clades as specific family groups which is what sub-clades are when taken to their final conclusion.
It is our opinion that focusing on this small sample, which many people have done because they cannot afford to do testing themselves, and with respect to the limitations of the sampling of that group we are gaining knowledge of the interactions of the people within that group and NOT the population as a whole.
I am not putting down the research that the people focusing on this group has done. There efforts are to be applauded and in doing so are training themselves and others to be the forefront of understanding the knowledge this tool will ultimately produce.
My caution is NOT TO take the results found from that sample to be all encompassing. Growth will only come when the people leading this research start to analyse it in respect to earlier research in a number of related fields and much older fields (in terms of man hours put into them).
My wish is that more money was available for a much bigger study to be carried out so these newly trained people can really get to grips with the core haplogroups tracing them down their historical path and with what will be an enormous number of small haplogroups ultimately down to the family group level.
Enough for now I have other things to do
harryandliz1
05-06-2013, 02:11 AM
Firstly, I have written all my life so that people can have a wider understanding and perspective behind modern research.
Secondly, I have not seen much data presented on this site that would want me of my associates to give away years of research to what appears to be an amateur group at best. So you will just have to put up with my comments similarly to what I have had to do with your comments.
Thirdly, My comments will be honest and to the best of my ability correct you will just have to accept that.
Fourthly, I did not set out to belittle the genealogical aptitude of Americans. You personally are doing a good enough job of that alone, by your attitude as shown in your note that I am answering.
Finally I have answered your questions in other questions put to me. I thought I may help by putting some sort of senior academic thought into this site however your attitude and continual attacks is such that you do not deserve mine or any others respect or assistance
emmental
05-06-2013, 04:13 AM
Can we please get off the subject of religion and discuss genetics? This thread is titled "R1b- L2", not "Famous People Who Some People Believe Were Secretly Sephardic." H&L, you said yourself, "Religion is a state of mind and not genetic." My Mom used to tell me, "God has no grandchildren." So can we please leave this out of genetic forums?
harryandliz1
05-06-2013, 11:16 AM
I am not talking about religion that is a shallow assumption of yours
I am talking about the limitations and potential errors of the tools and databases that are being used
I am also giving enough information that may!! help one of two people understand those limitations and by so doing allow them correct the errors in the data you are using that is being created by the popular/commercial testing companies.
How certain are you that the admixture proportions you refer to are correct or are you believing data without personally testing its accuracy. Do you really understand what that admixture means and how the testing companies database was derived that came up with those results.
What do the results really tell you? All it appears to be saying is that you are typically European and from that most likely R1b - From your surname I suspect knowledgeable people could have told you that without having to go to the costs of testing
How useful are they in determining your family history?
If you were breeding animals and their papers came with that sort of information. All it would tell anyone would be that you were not dealing with a thoroughbred He He!
R.Rocca
05-06-2013, 11:54 AM
Firstly, I have written all my life so that people can have a wider understanding and perspective behind modern research.
Secondly, I have not seen much data presented on this site that would want me of my associates to give away years of research to what appears to be an amateur group at best. So you will just have to put up with my comments similarly to what I have had to do with your comments.
Thirdly, My comments will be honest and to the best of my ability correct you will just have to accept that.
Fourthly, I did not set out to belittle the genealogical aptitude of Americans. You personally are doing a good enough job of that alone, by your attitude as shown in your note that I am answering.
Finally I have answered your questions in other questions put to me. I thought I may help by putting some sort of senior academic thought into this site however your attitude and continual attacks is such that you do not deserve mine or any others respect or assistance
So you are on a thread about L2 but will not provide any of your senior academic expertise? We should just take your word on everything you say? That is not very academic if you ask me. In fact, it is the complete opposite of the academic spirit. Since we are all merely amateurs, I ask again that you provide data points.
emmental
05-06-2013, 12:38 PM
You bring up the subject of Sephardic Jews, Huguenots, Catholics, Lutherans, Calvinists and the Church of England and claim that you're not talking about religion. Then you say I referred to admixture proportions when the subject of autosomal DNA never came up. You don't argue fair (or particularly well). You state as fact that Columbus was Sephardic because of some academic study when another academic study says he is Polish, another Scottish, another Italian and another Spanish. How do we reconcile all these theories? Maybe DNA is the answer. I know for certain it isn't using surnames! My goodness, I've seen all kinds of crackpot theories about my surname. "Knowledgeable people" who claimed we were Muslim or Crusaders who fought the Muslims, or someone living on the banks of the Mosel River or in or near the village of Musselburgh, Scotland. And all of this was based on a variant spelling of the original surname. Theories are theories and DNA is a tool which can help to prove or disprove these theories. If your pet theory looks like it may not be the best way to go it may be time to take another avenue and not resort to strawman arguments and conspiracy theories about DNA testing companies
Ezana
05-06-2013, 01:30 PM
Please refrain from off-topic discussions and try to keep all discussions civil, even if you disagree vehemently with the other person.
If this distraction persists, we will be forced to close the thread and punish the involved parties appropriately.
R.Rocca
05-08-2013, 02:36 PM
The Coop et al paper, which is specific to autosomal DNA, has already been posted here:
http://www.anthrogenica.com/showthread.php?709-New-DNA-Papers&p=5912&viewfull=1#post5912
As this thread is specific to U152+L2+ please post the above to the appropriate thread.
Tom Fowler
08-23-2013, 11:26 PM
I thought I’d resurrect this thread to let you know there’s one more R-L2+ out here. And forgive me if I also ask a few questions. I’m relatively new to this and have quickly become addicted, but desperately need some education/help.
Earlier this year, I received my Geno 2.0 results: R-L2. After transferring the results to FTDNA, I found (through the Haplotree and SNPs chart) there were tests available for downstream of L2, so I decided to order the Comprehensive Genome test (investigating my mother’s roots as well). The first 37 Y-STR values have been posted, but 38-67 have been delayed until September 9 due to the fact the first test failed to yield results.
There was one thing on the 37 marker results that caught my attention: DYS455=9. One match was found (same surname; we’re 0, 0, 2 at 12, 25 and 37 respectively).
As I looked through the U152 project, I searched the rest of the listings and found the vast majority were 11. (With, if I remember correctly, some 10 and 12 values thrown in). But just the two of us with 9.
I have to ask: what, if anything, does this this indicate/mean?
Since there was a delay in the 67 marker results, I decided to look at the Geno 2.0 raw data. Mutation matches were indicated for CTS7275, CTS8127.2, M37; PF121.2 and YSC0000081.2 (All marked “Private” or “Under Investigation” on the 2013 ISOGG SNP Index.)
And, interestingly, to me at least, I also matched the mutations for S47, P121.2, 706.2 and 705.2. Is that possible? Or are they testing errors?
L12, L175, L253, L325, L561, M17, Z299, M126 are shown as “I” on the report, not ‘del.’ I’m assuming that means inconclusive? Is further testing required to determine if they’re deleted or not?
Also, there are a number of SNPs where there’s a mutation indicated (CTS11795.2c, C>A for example), but my SNP shows G,G (for example). Is G an ancestral (G>C>A)? Or “normal” for CTS11795?
And lastly, I am z49- and z367-.
And help or explanations you could give would be greatly appreciated.
harryandliz1
08-24-2013, 06:16 AM
Hi Tom,
Can I suggest you wait until you get all 67 marker results are in and see how many close matches you have.
I am certain that those who monitor this thread and know everything, such as Mr. R. Rocca and Mr. Emmental, will answer all of your questions
Meanwhile reading through my comments may give you some background as to where L2 came from Although much of my comments have been
put down by others on this site I have yet to see any of them come forth with a better explanation/background than we have found during our research.
Do not get disheartened if you get no matches as the number of people in the population that have been tested to the 67 level is very low (All people tested, at all depths is possibly less than a million out of a billion or so in Europe, Russia, middle east and the USA which is about 0.1% of the population and when you take those tested at the 67 marker level you probably have at most 150,000 which is 0.015% of the population)
A significantly larger proportion of the population needs to be tested at the 67 marker level and above and the significant skew towards those who's ancestors migrated to the USA becomes more balanced before we are likely to find reasonably close relations from those who have been tested. Also don't expect to find many distant relatives outside of 4th cousins as the compounding factors of interrelationships muddy the waters significantly as you go back. As far as all of the new sub clades being found under L2 over the last couple of years I am concerned that what is happening is refining the results we have to almost show individual family mutations but at some risk as the database that is being used to form these sub clades is a very small samole size and probably not a statistically significant a sample size to be accurate, You also have to remember that there are commercial people making money out of this testing and it is in their intrest to get as much money out of you that they can and your best intrests are not necessarily theirs
I know what I have just said will be rubbished by others on this site but that is their problem and the reason I no longer have much to do with this site.
I thought I’d resurrect this thread to let you know there’s one more R-L2+ out here. And forgive me if I also ask a few questions. I’m relatively new to this and have quickly become addicted, but desperately need some education/help.
Earlier this year, I received my Geno 2.0 results: R-L2. After transferring the results to FTDNA, I found (through the Haplotree and SNPs chart) there were tests available for downstream of L2, so I decided to order the Comprehensive Genome test (investigating my mother’s roots as well). The first 37 Y-STR values have been posted, but 38-67 have been delayed until September 9 due to the fact the first test failed to yield results.
There was one thing on the 37 marker results that caught my attention: DYS455=9. One match was found (same surname; we’re 0, 0, 2 at 12, 25 and 37 respectively).
As I looked through the U152 project, I searched the rest of the listings and found the vast majority were 11. (With, if I remember correctly, some 10 and 12 values thrown in). But just the two of us with 9.
I have to ask: what, if anything, does this this indicate/mean?
Since there was a delay in the 67 marker results, I decided to look at the Geno 2.0 raw data. Mutation matches were indicated for CTS7275, CTS8127.2, M37; PF121.2 and YSC0000081.2 (All marked “Private” or “Under Investigation” on the 2013 ISOGG SNP Index.)
And, interestingly, to me at least, I also matched the mutations for S47, P121.2, 706.2 and 705.2. Is that possible? Or are they testing errors?
L12, L175, L253, L325, L561, M17, Z299, M126 are shown as “I” on the report, not ‘del.’ I’m assuming that means inconclusive? Is further testing required to determine if they’re deleted or not?
Also, there are a number of SNPs where there’s a mutation indicated (CTS11795.2c, C>A for example), but my SNP shows G,G (for example). Is G an ancestral (G>C>A)? Or “normal” for CTS11795?
And lastly, I am z49- and z367-.
And help or explanations you could give would be greatly appreciated.
Some mutations are reported differently in Geno 2.0 raw data, you can compare your results with 43 other U152+ men in "Itai Perez' Geno 2.0 YDNA SNP comparison chart".
Join the Facebook group to follow the updates: http://www.facebook.com/Geno20YdnaSnpComparison
If you are interested and want to participate you can check the details here: http://itai.perez.free.fr/GenoCompare/
Tom Fowler
08-24-2013, 12:09 PM
Hi Tom,
Can I suggest you wait until you get all 67 marker results are in and see how many close matches you have.
I am certain that those who monitor this thread and know everything, such as Mr. R. Rocca and Mr. Emmental, will answer all of your questions
Meanwhile reading through my comments may give you some background as to where L2 came from Although much of my comments have been
put down by others on this site I have yet to see any of them come forth with a better explanation/background than we have found during our research.
Do not get disheartened if you get no matches as the number of people in the population that have been tested to the 67 level is very low (All people tested, at all depths is possibly less than a million out of a billion or so in Europe, Russia, middle east and the USA which is about 0.1% of the population and when you take those tested at the 67 marker level you probably have at most 150,000 which is 0.015% of the population)
A significantly larger proportion of the population needs to be tested at the 67 marker level and above and the significant skew towards those who's ancestors migrated to the USA becomes more balanced before we are likely to find reasonably close relations from those who have been tested. Also don't expect to find many distant relatives outside of 4th cousins as the compounding factors of interrelationships muddy the waters significantly as you go back. As far as all of the new sub clades being found under L2 over the last couple of years I am concerned that what is happening is refining the results we have to almost show individual family mutations but at some risk as the database that is being used to form these sub clades is a very small samole size and probably not a statistically significant a sample size to be accurate, You also have to remember that there are commercial people making money out of this testing and it is in their intrest to get as much money out of you that they can and your best intrests are not necessarily theirs
I know what I have just said will be rubbished by others on this site but that is their problem and the reason I no longer have much to do with this site.
Thanks for the reply.
I know the 67 marker test will answer a lot of my questions and don’t expect much in the way of matches . ( I wish there was some way to convert the Geno 2.0 data into y-STRs and not have to wait. I’m impatient. )
I’m very interested in the deep ancestry aspects of the testing. (I’m an old World History teacher, so it makes sense, I guess.)
I started this mainly because I wanted to leave my grand kids with a sense of who they really are. Not just genealogically, but who we were thousands of years ago. And I’m happy to say they’re incredibly interested in the results.
When the Geno 2.0 results came in and I told them they were 3.6% Neanderthal and 5.4% Denisovan, they thought it was the coolest thing they’d ever heard. One of them said “Wow, we’re 9% really old guys.” Off he went to the library to research Neanderthals.
When they were told they were “Italo-Celtic,” they Googled Celts until we had to force them to get off the computer.
And when we looked at the U152+ heat map together, I kind of mumbled the question: “I wonder how we got to England?” One of the grandkids replied: “That’s simple. We were Roman soldiers.” And – you guessed it – off they went to find out everything they could about Roman soldiers.
He may be right, he may be wrong. But to me, that’s not the point. The grandkids are interested in history. And who they really were (or might have been.). I feel like I’ve given them quite a unique gift.
But I am ramble. (I usually do.) My apologies.
As for the other part of your email, I really don’t know enough about this yet to have an opinion one way or the other. But I appreciate you providing yours and will take it into consideration. Thank you again.
Tom Fowler
08-24-2013, 12:13 PM
Some mutations are reported differently in Geno 2.0 raw data, you can compare your results with 43 other U152+ men in "Itai Perez' Geno 2.0 YDNA SNP comparison chart".
Join the Facebook group to follow the updates: http://www.facebook.com/Geno20YdnaSnpComparison
If you are interested and want to participate you can check the details here: http://itai.perez.free.fr/GenoCompare/
Thanks for the reply and suggestion. I’ve sent my file and have joined the Facebook page. I start comparing with the others today.
R.Rocca
08-24-2013, 01:20 PM
Thanks for the reply and suggestion. I’ve sent my file and have joined the Facebook page. I start comparing with the others today.
Tom, you can send it to me as well and I can look it over. My email address is on the U152 Project home page.
Tom Fowler
08-24-2013, 01:26 PM
Tom, you can send it to me as well and I can look it over. My email address is on the U152 Project home page.
Just sent it to you. I hope I'm not making rookie mistakes here. Thanks for taking at look at it for me.
R.Rocca
08-25-2013, 03:23 AM
Just sent it to you. I hope I'm not making rookie mistakes here. Thanks for taking at look at it for me.
Tom, I looked over your file and you are F2490+. Kit no. N113299, MDKA Michel Viaud, born 1645, is also F2490+. I'm not sure why the Geno Compare file has a no-call for F2490 because I have his raw data and it is F2490+. F2490 was originally found in a haplogroup O3 person.
Tom Fowler
08-25-2013, 01:00 PM
Thank you so much, Mr. Rocca. I truly appreciate your help.
Would you mind answering a few ‘rookie’ questions about L2490+?
I found Michel Viaud’s kit without any problem. However, I can’t find anything on L2490+. It’s not in the ISOGG SNP Index. And I couldn’t seem to find it in the 2013 U152 and Subclades Phylogenetic Tree you, Mr. Gilbert and Mr. Feher put together. (Even Googling it didn't help.)
Does it fit somewhere on these trees?
Or is it ‘private’?
And lastly, does its presence warrant more testing? (Walk through the Y, for example.)
Sorry for all the questions. I’m trying to learn.
Alessio B. Bedini
08-29-2013, 03:29 PM
Hi, my name is Alessio Bedini and for many years I deal with genealogical research. I am a moderator of the biggest forum in Italian language www.iagiforum.info and if you need some information from our users do not hesitate to ask.
I did the test 37YSTR FTDNA (Kit No: 284610), Geno 2.0 and I'm R-L2
I believe that we should first of all understand when it is lived "Adam L2"
I compared my YSTR with 78 L2 users of FTDNA project U152 and closest to me are two German at a distance of 8 steps.
Then I compared my YSTR with about 400 users YSEARCH who indicated haplogroup L2 and also the nearest are 2 Belgians, a Frenchman and a German at 8 steps. For this reason I think that my ancestors went in Italy 1200-1400 years ago, perhaps with the barbarian invasions.
Also from a comparison of my YSTR with users L2 on YSEARCH I noticed that many users are at a distance of 23-24 steps. This could mean that the "Adam L2" lived 3000-4000 years ago. If so, it would not make sense to speak of Sephardic origin of L2.
ApplegateJ1
08-29-2013, 05:35 PM
Hi Alessio B Bedini,
I am R-L2 also (FTDNA # N90964, Ysearch Z9PME, still waiting on Geno 2.0). I was very surprised that my autosomal STRs (DNATribes) had a high percentage of matches in Italy (highest in Liguria). It may have something to do with my paternal line, but very old. I also had match percentages for Cypriot Greek, Flemish, North Portugal, Switzerland and Nordrhein-Westfalen Germany.
I agree with you about L2 origin. Although I still consider myself an armature at genealogy, I believe it is a mistake to make cultural attributes exclusive to old lineages as if they were isolates. I will be just as surprised should Sephardic culture appear on my paternal lineage as I was with the Italian connection and just as accepting.
Grossvater
08-29-2013, 05:39 PM
Rank amateur that I am at all of this, I usually try to just quietly lurk and listen while the debate goes on. I have no desire to rile anyone up or to pick scabs off old wounds but this thread has gotten me thinking (scary thought) and I'm wondering if those of you who know more about the subject can shed some light for me. Here are my questions:
1. I am R1b-U152 but haven't yet tested any downstream SNPs. Since I am a rank amateur, am I understanding correctly that L2 is a downstream SNP found among folks of Y-DNA R1b-U152 lineages?
2. Am I also correct in understanding that this primarily a Alpine Celtic lineage found on both sides of the Alps in large numbers and in lessening circles out across Europe but mainly to the west?
3. That the male-line descendants of those Jewish people who were taken into captivity and sold into slavery after the Fall of Jerusalem in 70 A.D. would probably be from haplogroups J and E?
4. Am I correct in remembering that most European Jews (both Ashkenazi and Sephardic) descend from a tiny handful of women mitochondrially?
5. Have there been any studies done on the actual incidence of R1b-L2 among Sephardic Jews? If so, what is the incidence?
6. If there are large numbers of L2 folks among Sephardic Jews could this be evidence that the tiny number of Jewish women from whom most European Jews descend from hooked up quite early with Northern Italian men during the days of the Roman Empire before migrating to Spain?
7. Would this be evidence of a post fall-of-Jerusalem Italian sojourn and that these Jewish slaves did not go directly to Iberia from the Holy Land?
8. Am I reading too much into this? Is this some wild and crazy speculation and perhaps I shouldn't drive or operate heavy equipment?
Alessio B. Bedini
08-29-2013, 08:02 PM
[..]
1. Yes, L2 is a sub clade of U152
2. In my opionion, L2 could be born in present Belgium or Western Germany about 3000-4000 years ago and then spread His Descendants have both in England and in Italy.
3. Yes, I think I read something, too these haplogroup J and E
4. I do not know, but it is possible.
5. I do not think.
6. If the first L2 was born 3000-4000 years ago does not make sense to speak of Judaism in Europe
Grossvater
08-29-2013, 08:30 PM
Grazie, Signor Bedini. I did not mean to imply that I thought L2 was Sephardic, I was only speculating that if there is any significant L2 amongst the Sephardim (which I do not know), perhaps it came because a handful of Jewish woman had children with Northern Italian men in early times which brought the lineage into the Sephardim.
Alessio B. Bedini
08-29-2013, 08:32 PM
Hi Alessio B Bedini,
I am R-L2 also (FTDNA # N90964, Ysearch Z9PME, still waiting on Geno 2.0). I was very surprised that my autosomal STRs (DNATribes) had a high percentage of matches in Italy (highest in Liguria). It may have something to do with my paternal line, but very old. I also had match percentages for Cypriot Greek, Flemish, North Portugal, Switzerland and Nordrhein-Westfalen Germany.
I agree with you about L2 origin. Although I still consider myself an armature at genealogy, I believe it is a mistake to make cultural attributes exclusive to old lineages as if they were isolates. I will be just as surprised should Sephardic culture appear on my paternal lineage as I was with the Italian connection and just as accepting.
Hi, my Ysearch no. is NXW7Q
The genetic distance between you and me is 12 steps.
Perhaps our common ancestor could be 2000 years old. ;)
I think your autosomal STRs (DNATribes) had a high percentage of matches in Italy Because in Italy there are some L2 like you and not because your ancestors are Italian. "Adam L2" took great lineage including Your English ancestors and the ancestors of the italian L2 but also Greek Cypriot, Flemish, North Portugal, Switzerland and Germany Nordrhein-Westfalen. That's why your autosomal STRs (DNATribes) had a high percentage of matches in these peoples: have the same ancestors.
Alessio B. Bedini
08-29-2013, 08:41 PM
Grazie, Signor Bedini. I did not mean to imply that I thought L2 was Sephardic, I was only speculating that if there is any significant L2 amongst the Sephardim (which I do not know), perhaps it came because a handful of Jewish woman had children with Northern Italian men in early times which brought the lineage into the Sephardim.
This is possible, but like you said we should understand the actual incidence of R1b-L2 among Sephardic Jew.
I do not think have ever been made studies of this kind.
My family is R-L2 and we have the baptisms of all by the end of the fifteenth and never any sign of Judaism.
R.Rocca
08-30-2013, 01:22 AM
Grazie, Signor Bedini. I did not mean to imply that I thought L2 was Sephardic, I was only speculating that if there is any significant L2 amongst the Sephardim (which I do not know), perhaps it came because a handful of Jewish woman had children with Northern Italian men in early times which brought the lineage into the Sephardim.
It's pretty east to answer - there aren't any Sephardics in the U152 project. There is one group of L2 Ashkenazi that is obviously descended from a single man in the last 1000 years or so. As Alessio said, U152 in general is much older in Europe than the Jewish diaspora.
harryandliz1
08-30-2013, 09:21 AM
Hi,
At no time did I say that L2 had Sephardic origins
What I said was that there were indications that over the ages some L2 were Sephardic. What I did not say is the many of these were in and are still in, what is today France, many were traders and travelled extensively through Europe. Many converted to various forms of Calvanism others became Catholic. There are many L2 in France today as there are in Italy, Switzerland, Germany, Holland and Belgium.
There were Sephardic jews (Sephardic means Spanish) in Spain 4000 to 5000 years ago some of whome moved along the coast and into what is now Italy and Switzerland, some also moved into what is today France, if the Russion papers on the topic are to be believed
The founding father of L2, whatever religion he was, seems to have lived somewhere in Northern Italy if all of the work tracking down the origin of L2 is correct.
Harrry
Hi, my name is Alessio Bedini and for many years I deal with genealogical research. I am a moderator of the biggest forum in Italian language www.iagiforum.info and if you need some information from our users do not hesitate to ask.
I did the test 37YSTR FTDNA (Kit No: 284610), Geno 2.0 and I'm R-L2
I believe that we should first of all understand when it is lived "Adam L2"
I compared my YSTR with 78 L2 users of FTDNA project U152 and closest to me are two German at a distance of 8 steps.
Then I compared my YSTR with about 400 users YSEARCH who indicated haplogroup L2 and also the nearest are 2 Belgians, a Frenchman and a German at 8 steps. For this reason I think that my ancestors went in Italy 1200-1400 years ago, perhaps with the barbarian invasions.
Also from a comparison of my YSTR with users L2 on YSEARCH I noticed that many users are at a distance of 23-24 steps. This could mean that the "Adam L2" lived 3000-4000 years ago. If so, it would not make sense to speak of Sephardic origin of L2.
harryandliz1
08-30-2013, 09:51 AM
Hi Richard,
Why are you so dogmatic that there are no people of Sepharidic origin who are L2.
As I have already said
"In the early days we then started contacting people who were early L2's and asking about their history. A number of them were either Jewish or knew that their family had a Jewish past. It was not a large sample but the high proportion and the smattering of Sephardic surnames started us down the track of thinking that it may be one of the reasons why we were finding L2 scattered as wide as it is. Also the lack of finding common surnames tended to indicate significant name changes or not a big enough sample."
Some of my ancestors were Sephardic and I am L2 and I am in the U152 project.
You havn't found me or any others is because none of us is required to state our current religion or what our ancestors religion was. Until this is a requirement there is no way you can claim there are no Sephardic people in the U152 project because at least three are in there already
Sephardics have no problems changing names as the Synagogue name is the only one that matters and often have pretend to belong to other religions to prevent persecution as in Spain in the 1500's and Germany last century
It also seems that Spanish or Sephardic jews have been around for 5000 years or more and are a bit older than L2
Alessio B. Bedini
08-30-2013, 10:38 AM
According to Jewish tradition, Jewish ancestry is traced back to the Biblical patriarchs Abraham, Isaac and Jacob who lived in Canaan around the 18th century BCE http://en.wikipedia.org/wiki/Jews
There were no Jews or sefardit in Spain 3000-4000 years ago.
Boattini, A. et al (2013) Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
Link: http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0065441;jsessi onid=705B159C0EC2CF2DB62D57BAB3AFD88B
- Unlike what we saw in the Belgium study, where L2 lineages reached about 60-70% of U152 overall, in Italy it is the opposite where it only reaches 37.4%. Of their groupings of Italian regions, L2 only outnumbers U152* in the north-east. All other regions were higher in U152*. This confirms the trend seen in the FTDNA project where L2 is highest in almost all countries except for Italy.
In my opionion, this means that L2 is not originated in Italy. TMRCA L2+ could be born in present Belgium or Western Germany.
When? I compared my 37YSTR with about 400 users YSEARCH who indicated haplogroup L2 and any users are at a distance of 23-24 steps. This could mean that the TMRCA L2 lived 3000-4000 years ago.
It 'possible that some L2 is jew but in my opionion there are very few compared to all other.
You should see the sub clade of these L2 with Jewish ancestry.
If it is the same for all, mean that descend from a single person.
I'm always a bit skeptical/reserved when it comes to theories linking SNPs with ancient cultures or religions, but I'll take the theories in the earlier posts not with a grain but with a bucket load of salt.
R.Rocca
08-30-2013, 11:14 AM
Hi Richard,
Why are you so dogmatic that there are no people of Sepharidic origin who are L2.
As I have already said
"In the early days we then started contacting people who were early L2's and asking about their history. A number of them were either Jewish or knew that their family had a Jewish past. It was not a large sample but the high proportion and the smattering of Sephardic surnames started us down the track of thinking that it may be one of the reasons why we were finding L2 scattered as wide as it is. Also the lack of finding common surnames tended to indicate significant name changes or not a big enough sample."
Some of my ancestors were Sephardic and I am L2 and I am in the U152 project.
You havn't found me or any others is because none of us is required to state our current religion or what our ancestors religion was. Until this is a requirement there is no way you can claim there are no Sephardic people in the U152 project because at least three are in there already
Sephardics have no problems changing names as the Synagogue name is the only one that matters and often have pretend to belong to other religions to prevent persecution as in Spain in the 1500's and Germany last century
It also seems that Spanish or Sephardic jews have been around for 5000 years or more and are a bit older than L2
The point is that L2 makes up 25% of all males in places like La Spezia and Treviso and I can assure you it has nothing to do with Sephardics.
I keep harping on this point because you keep using words like "many". Not only is R1b the extreme minority in Sephardics, but U152 is less common still. Just because you've found a couple of Sephardi that are L2, it doesn't mean much as testers of Jewish ancestry make up a very disproportionate amount of FTDNA testers overall.
Before anyone gets any nonsensical thoughts of accusing me of any biases, I've always proudly displayed my maternal ancestor's grandfather's J1c3d-YSC234/Z2329+ haplogroup in my signature and they share their lowest known subclade with the Cohen modal haplogroup.
[Edit: I didn't realize, but the signature does not show up when responding from a mobile device, so you guys can see my maternal grandfather's J1c3d-YSC234/Z2329+ haplogroup in the posts I've replied to using a web browser.]
If "some of your ancestors were Sephardic," as you put it, I am at a loss to see why you do not have any flags representing any countries with historical Sephardi populations.
I also notice you are playing a rather obvious shell game. You claim some of your ancestors were Sephardi but never said your L2 ancestors were Sephardi, so I can only assume they were not.
What I think is rather more likely is that you are one of those British Israelite nutters that is convinced that English people are Jews, and Jews aren't Jews. In any event your accusing others here of racism here is getting very old. You were previously warned, then given a first infraction. Your second infraction follows by PM.
Hi Richard,
Why are you so dogmatic that there are no people of Sepharidic origin who are L2.
As I have already said
"In the early days we then started contacting people who were early L2's and asking about their history. A number of them were either Jewish or knew that their family had a Jewish past. It was not a large sample but the high proportion and the smattering of Sephardic surnames started us down the track of thinking that it may be one of the reasons why we were finding L2 scattered as wide as it is. Also the lack of finding common surnames tended to indicate significant name changes or not a big enough sample."
Some of my ancestors were Sephardic and I am L2 and I am in the U152 project.
You havn't found me or any others is because none of us is required to state our current religion or what our ancestors religion was. Until this is a requirement there is no way you can claim there are no Sephardic people in the U152 project because at least three are in there already
Sephardics have no problems changing names as the Synagogue name is the only one that matters and often have pretend to belong to other religions to prevent persecution as in Spain in the 1500's and Germany last century
It also seems that Spanish or Sephardic jews have been around for 5000 years or more and are a bit older than L2
Richard:
On reviewing the U152 Project I see one entirely Ashkenazi L2+ cluster (group D2), as well as scattered Ashkenazi members of group G:g and N, and possibly L and M. I do not see any Sephardi grouping at all, nor do I see even one L2+ member with a Sephardi surname. I think we can take it for granted that harryandliz1 is trolling.
Grossvater
08-30-2013, 05:02 PM
It's pretty east to answer - there aren't any Sephardics in the U152 project. There is one group of L2 Ashkenazi that is obviously descended from a single man in the last 1000 years or so. As Alessio said, U152 in general is much older in Europe than the Jewish diaspora.
Fascinating. Thank you for clarifying. It is so easy to boil all this down to raw numbers and scientific discourse and forget that there is a human story here. I certainly hope that the one L2 lineage among the Ashkenazim came as a result of a loving relationship and not from something sordid.
Alessio B. Bedini
08-30-2013, 05:08 PM
if they are descended from a single person could also be a sign of violence ...
Grossvater
08-30-2013, 05:10 PM
What I think is rather more likely is that you are one of those British Israelite nutters that is convinced that English people are Jews, and Jews aren't Jews.
I thought perhaps I could also perceive a whiff of the theories of Immanuel Velikovsky, the scent of which I have not smelled in several decades.
I thought perhaps I could also perceive a whiff of the theories of Immanuel Velikovsky, the scent of which I have not smelled in several decades.
Is he the one who said we used to be a moon of Saturn until Mercury crashed into us?
Grossvater
08-30-2013, 06:57 PM
Is he the one who said we used to be a moon of Saturn until Mercury crashed into us?
That's the guy. He had a theory that shifted Egyptian and Hebrew chronology. He had the Exodus occurring during the Egyptian Middle Kingdom. He proposed that Eighteenth Dynasty Egyptian Queen Hatshepsut was actually the Queen of Sheba who paid a visit to Israelite King Solomon in the Bible.
Stephen Jay Gould has this to say about Velikovsky:
"Velikovsky is neither crank nor charlatan—although, to state my opinion and to quote one of my colleagues, he is at least gloriously wrong... Velikovsky would rebuild the science of celestial mechanics to save the literal accuracy of ancient legends."
Alessio B. Bedini
09-02-2013, 05:17 AM
In FTDNA Project U152 there are 61 users (67 MRK) who are L2+ Z49- Z367-
Of these there are two groups that are well recognizable:
1) "Group Wheaton" (8 person - kit no. 78935 - 233832 - 204842 - 200230 - 233653 - N101982 - 200373 - 199087) who have between them a distance of 0-4 and have broken away from the main group about 2000 years ago
2) "Group Craig" (14 person - kit no. N80554 - 192176 - B3030 - 181224- 214504 - 34451- 188864 - B3040 - 140049 - 128853 - 211630 - 251689 - B3112 - 235978) who have between them a distance of 3-6 and have broken away from the main group about 1400-1500 years ago
I'm trying to find the distances between all .. is interesting
Mudgeeclarke
09-04-2013, 05:27 PM
Just joined, and I'm a DNA results novice with a capital N. I'm now showing at FTDNA as the shorthand (easy to remember) L2, and I'm curious to discover more of the historical journey of this group over the millennia. Of course, it goes without saying, I'd be delighted to discover some more current cousins !
Cheers,
Alpine Hominin
09-05-2013, 01:41 AM
I'm also R1b-L2. My Ysearch and FTDNA are in my signature.
A few direct questions I'd like to see discussed:
Where did L2 Originate?
Are there any particular groups or cultures that seem to have played a significant part in L2's spread?
Alessio B. Bedini
09-05-2013, 05:59 AM
..in the Belgium study, where L2 lineages reached about 60-70% of U152 overall, in Italy it is the opposite where it only reaches 37.4%. Of their groupings of Italian regions, L2 only outnumbers U152* in the north-east. All other regions were higher in U152*. This confirms the trend seen in the FTDNA project where L2 is highest in almost all countries except for Italy.
TMRCA L2+ could be born in present Belgium or Western Germany.
When? I compared my 37YSTR with about 400 users YSEARCH who indicated haplogroup L2 and any users are at a distance of 23-24 steps. This could mean that the TMRCA L2 lived 3000-4000 years ago.
Maybe to talk of That Particular groups or cultures seem to have played a significant part in L2's spread is excessive: 4000 years is much time.
But i believe that there might be a connection between L2 and the Franks. It 's just an idea with no foundation but I'd like someone does some study on this.
It is no coincidence that I asked about studies on the Merovingian and Carolingian http://www.anthrogenica.com/showthread.php?1293-Genetic-Research-on-Merovingians-and-Carolingians&p=13002#post13002
Biloo
09-05-2013, 07:44 PM
I'm an algerian R-L2. The paternal side of my family is originally from Algiers. According to my father's autosomal results and to my family's oral history, the paternal side of my ancestry is a mix (50-50) of turkish and berber .I've been told that my ottoman ancestry came mainly from Aegean Anatolia (Izmir), Thessaloniki and Crete. I still don't know how my R-L2 haplogroup has ended up in Algeria, and from where my direct paternal ancestor came from ?
Alessio B. Bedini
09-05-2013, 09:28 PM
It will be difficult to give answers.
After the fall of the Roman Empire in North Africa were born various barbarian kingdoms.
It's possible that your ancestor is one of these "Europeans" moved to Africa.
Alessio B. Bedini
09-06-2013, 09:16 AM
Just yesterday I found on the Internet the project on FTDNA Habsburg family
In 1985, Dr. Hoppes, Swiss citizen, made a genealogical research on his family and found an ancestor that, on two censuses in 1290 and in 1292, signed with the surname Habesburc, same handwriting with which the King Rudolf von Habesburc (later Habsburg ) has engraved his name in 1291 on the lid of his sarcophagus.
Intrigued by this thing Dr. Hoppes began to make inquiries genealogical and genetic to see if he could certify this link with the Habsburgs medieval. So five years ago was born Habsburg Family Project http://www.familytreedna.com/public/habsburgfamilyproject/ where together with Thomas Sacher, they found that more than a dozen other surnames contains close "genetic cousins" for them, and that is : Fitze, grass, Himmelsberger, Kreis, May, Mesmer, Neff, Penczer, Schiess, Schlatter, Schapbach Sittner, Tanner, and Waldburger. Their Y chromosome is type R-L2*
There aren't, unfortunately, official evidence because it had never been done testing the Y chromosome of Habsburgs medieval that still sleeping peacefully in their graves.
My surprise was to see that as well as being of the same haplotype my YDNA is only 10-11 steps from them. It 's very interesting ..
I sent him an email. I also have Swiss ancestors I? ;)
http://www.familytreedna.com/public/habsburgfamilyproject/default.aspx?section=yresults
I believe that there is a relationship between the L2* and the Franks from whose lines also derive the Habsburgs.
Kwheaton
09-13-2013, 01:20 AM
In FTDNA Project U152 there are 61 users (67 MRK) who are L2+ Z49- Z367-
Of these there are two groups that are well recognizable:
1) "Group Wheaton" (8 person - kit no. 78935 - 233832 - 204842 - 200230 - 233653 - N101982 - 200373 - 199087) who have between them a distance of 0-4 and have broken away from the main group about 2000 years ago
2) "Group Craig" (14 person - kit no. N80554 - 192176 - B3030 - 181224- 214504 - 34451- 188864 - B3040 - 140049 - 128853 - 211630 - 251689 - B3112 - 235978) who have between them a distance of 3-6 and have broken away from the main group about 1400-1500 years ago
I'm trying to find the distances between all .. is interesting
As Rich knows I have spent inordinate amounts of time trying to figure out the connection between the L2* WHEATON group which includes:
Descendants of Robert Wheaton of England(prob North Devon or North Somerset) who arrives in Salem, MA 1636
MALLENBY of Northumberland, England
RAINES of Monmouthshire, Wales
HANCOCK of North Devon, England
HOWELL of Glamorganshire, Wales
And I can trace a plausible case for them all being in a same place and time. I believe the earliest is either a HOWELL or a WHEATON with most likely origins in the Bristol Channel basin: south Glamorgan and Monmouthshire, Wales and north Devon and Somerset, England. They probably represent a band from the Salisbury Plains before that.
The next closest L2 are something like GD of 34 so my guess is that the progenitors of these early L2 groups in the UK may represent widely separated branches. It sure will be exciting if any of the L2's end up uncovering some new SNPs.
Once the beta results are in I will start twisting arms to see if I can get the funds to test a group member.
Kelly
Alessio B. Bedini
09-13-2013, 06:28 AM
Hello Kelly, I have developed many of GD group FTDNA U152 L2* at 67 mrk.
The group Weathon is at least 22-25 from all other L2*. I think your ancestor broke off from the main branch over 2000 years ago, before the Roman conquest of England.
It is doubtful, however, That they arrived in England so early. I believe TMRCA of the group L2* belonged to the people of the Franks, for a variety of Reasons long to explain, but still I have no evidence. It may well be, Therefore, That your ancestor came along with the Saxons in England.
It would be important if in any of the L2's end up some new SNPs were Discovered.
Kwheaton
09-14-2013, 11:29 PM
Hello Kelly, I have developed many of GD group FTDNA U152 L2* at 67 mrk.
The group Weathon is at least 22-25 from all other L2*. I think your ancestor broke off from the main branch over 2000 years ago, before the Roman conquest of England.
It is doubtful, however, That they arrived in England so early. I believe TMRCA of the group L2* belonged to the people of the Franks, for a variety of Reasons long to explain, but still I have no evidence. It may well be, Therefore, That your ancestor came along with the Saxons in England.
It would be important if in any of the L2's end up some new SNPs were Discovered.
Thanks Alessio,
Yes I am awaiting results before deciding what to do. With the departure of Thomas Krahn I do not know how much effort FTDNA intends into offering newly discovered SNPs.... and still remains to be seen what the Chromo test from Britains DNA will cover....
I am not invested in any particular outcome for the Wheaton L2 group just would like to know the deeper story. I have recently been combing through the Welsh projects on FTDNA and although distant it looks like some L2's there with again connections to the Bristol basin. As this was a very active trading area its difficult to know whether the route was by sea originally.
I'd be interested in your TMRCA calcs if its anything beyond that on the U152 site.
Regards,
Kelly
Alessio B. Bedini
09-15-2013, 08:15 AM
Hello Kelly, I'm doing a lot of comparisons between we all L2 + Z49-Z258-Z367-Z384-and although I have some ideas but for now, nothing for sure.
Waiting for news
Regards
Alessio
GailT
09-15-2013, 05:03 PM
There are at least four L2 samples in the Full Y queue (2 Italian, 1 German, 1 English), and perhaps others that I have not heard about, so those results should be interesting.
Mudgeeclarke
09-15-2013, 06:35 PM
I am so impressed by what I read here.
But I am such a novice at all this, and so, even though I have all my tests to Y-111, plus (supposedly) every available SNP test, plus Geno2, I'm still at a loss as to how to advance my understanding or to use this information to give some basic clues for my long long paper trail. Having a NPE at paternal great grandfather is such a pain in the behind !
All I know is that he was born in the area around Fulbourn, Cambridgeshire, UK, most likely 1831. Even though I could likely track down his mother's brothers' trees and living male descendants for tests, except for discounting some form of incestuous relationship, I am at a loss. Perhaps the two closest names at Y-67 (4 steps) are where I should be trying to get some testing arranged. But there are so many who have never tested for that region ...
Any thoughts or recommendations?
Alessio B. Bedini
09-15-2013, 08:45 PM
First of all, you must discover exactly where your great-grandfather was born.
If Fulbourn, you'll make a list of families who were in town in 1831.
Contact someone at town, an expert in genetic genealogy.
Try to understand what families of Fulbourn did the YDNA test and Exclude families that are not L2.
You should try one of the neighbors of the mother of your great-grandfather.
Start with 2-3 families and if you find the descendants can ask them to do the test.
If the place where your great-grandfather was born is small it is easier to do these things.
You must continue in this way until you find the right track ..
Mudgeeclarke
09-16-2013, 01:34 AM
Thank you for your thoughtful reply, Alessio.
I have been researching Fulbourn for some time now, often with the help of historical societies, or family history societies, or in some cases, with skilled researchers. Some of my research was started in the very early 1980s.
There are several difficulties, even though there is quite a lot of information available from time of the first census in 1841, which includes my GGF, aged 10. Although his mother had several other children after him, including his next brother also born before she married, and their baptisms and details are all recorded, the date and place for my GGF birth or baptism is still not found. So, your first item, the exact date and place of birth, is a mystery. However, because all the family of his mother can be seen quite locally in census and church records, it is very likely my GGF was born in or around Fulbourn also and in 1831. As for names in the street etc, that is easy to discover. But then the problem arises when trying to locate any who have tested DNA. My research tends to show that DNA testing is still not held in any serious regard in that area, and very very few of that general area have (or will) test. I am in several Projects, including one meant colectionto collect Cambridgeshire data, but I have not seen any L2 who at even remotely connected. I hope that with Geno2, and cheaper pricing, more will have their tests done, and published. Fulbourn is a very old village(settlement) dating back perhaps a thousand years, with some other excavations pushing the date back several hindered years more. Certainly, Normans and Saxons were there at various times. That may in fact be the way that L2 first arrived.?
Again, thank you. All advice happily received.
Kwheaton
09-16-2013, 02:40 AM
Colin,
In our Wheaton L2 group we have four other surnames---needles in haystacks bur persistence pays you just never know when...I connected with my 2nd great grandmother after searching for her for 40 years. I was looking for Elizabeth Olson she was born Asloug Elivsdotter ( his last name was Olsson). Then just recently I got a high level atDNA match who turns out was an adoptee 75 years old and I was the first blood relative other than his children he had ever spoken with...you just never know...
Thanks everyone for the info. We had high hopes for a new SNP with the WTY last year and we got one private one but only one member was positive. I know Rich and many others want desperately to break L2+ apart...so we are all anxiously awaiting the results. Thanks Gail for the comments.
Fingers crossed that news comes soon and that its worth the wait!
Mudgeeclarke
09-16-2013, 11:16 AM
Thanks for the kind reply, Kelly, and the positive comments.
I think that with your husband L2, and (you) U5a1b2, that's close enough for me at L2 and U3b2a, so I'm declaring myself a very, very, very, distant step-cousin. ;-) ;-)
Meanwhile, back to my board game "Where in the World is GGF Richard".
Colin
Kwheaton
10-03-2013, 12:03 AM
I asked Britains DNA but did not get a response if they were testing SNPS downstream of R- L2. Anyone know the answer?
TIA
Kelly
I asked Britains DNA but did not get a response if they were testing SNPS downstream of R- L2. Anyone know the answer?
TIA
Kelly
They are testing all the Geno 2.0 SNPs, L69 and 6 other new SNPs from sequences that they analysed. There may also be others originating from the recent Dutch Genome project.
Jean-Pierre
10-14-2013, 06:12 AM
I'm tested Y-Hg R-U152, L2+, L20- in the Belgian DNA-project (university of Leuven laboratory). Can R. Rocca or others answer these questions:
When did the R-U152 mutation occur according current knowledge?
When did the R-L2 mutation occur according current knowledge?
In what region did the R-L2 mutation occur according current knowledge?
Thank you.
My Ysearch-ID is YTSY2.
Kwheaton
10-14-2013, 10:52 PM
They are testing all the Geno 2.0 SNPs, L69 and 6 other new SNPs from sequences that they analysed. There may also be others originating from the recent Dutch Genome project.
Thanks Mafe!
Mudgeeclarke
10-15-2013, 10:19 AM
I'm tested L2 at Y-111 at FTDNA, and Geno 2. Paternal line stops at Great GF, non- paternal event c1831 in Cambridgeshire, UK. Y-Search is UJJRA.
Alessio B. Bedini
11-06-2013, 03:18 AM
In my personal Page Geno 2.0 I re-read what has been written for L2 and I realize how very misleading:
Branch: L2
Age: To Be Determined
Location of Origin: West Asia
From West Asia, members of this lineage have spread into Europe and back into Africa.
Today, geneticists have found it in Europe, Central Asia, West Asia, and North Africa. Its highest frequencies are in Algeria, where it is between 2 and 3 percent of the male population. It is 1 to 2 percent of male lineages in Kazakhstan. It is about 1 percent of the male population in Iraq. It is also present in Jewish Diaspora populations. It is 1 to 2 percent of the male populations of Italy, Germany, and the Netherlands.
From what is written seems to be a SNP of Algerian origin (where they say it's the strongest concentration) with a strong presence of Jews ..
But who writes them the paper?
PS
We could divide the messages that relate to "L2+ and jews" from the rest ..
George Chandler
11-06-2013, 04:38 AM
I'm not sure why you consider that misleading? If the Jewish people being tested have ancestral origins which go back to North Africa (specifically Algeria) you don't think some could be positive for L2?
Rathna
11-06-2013, 04:57 AM
@ Bedini&Chandler
This writes Roy King on "Dienekes' Anthropology blog" about the paper of Jewish scholars which has demonstrated that the wild boar of Israel from many thousands of years has an European descent, already demonstrated by Ottini et alii:
"This is an extremely important study that has implications for the study of the ethnicity of the Israelite people (and by extension) the Philistines. Interestingly, the pig variants seem to be more closely linked to European than Anatolian variants. Could this imply a Mycenaean or Italian (Sicily/Sardinia) origin of the Sea Peoples rather than Western Anatolian?"
This is important for many reasons:
1) Roy King is a genetist famous all over the world
2) He is of Jewish descent from his paternal line
3) That the Sea Peoples (above all Shklsh and Shrdn, but also Twrshsh) could have come from Italy and not from the Aegean Sea I am saying from many years.
This could shed some light also about the origin of the Jewish pool. Not all the 80% of their mtDNA and much of the Y may derive from introgressions after 70 or 135 AD.
George Chandler
11-06-2013, 05:09 AM
I saw the article regarding boar's being gentically European. I'm not sure really how you can translate that to the Jewish people or any other ethnicity within the region. Ancient people had ships and livestock..trade happened etc. So you think that the pigs could not have come from the Phoenicians or even ancient Egyptians. What does the authors ethnicity have to do with the study..maybe I'm missing something in terms of the discussion?
Rathna
11-06-2013, 05:28 AM
I saw the article regarding boar's being gentically European. I'm not sure really how you can translate that to the Jewish people or any other ethnicity within the region. Ancient people had ships and livestock..trade happened etc. So you think that the pigs could not have come from the Phoenicians or even ancient Egyptians. What does the authors ethnicity have to do with the study..maybe I'm missing something in terms of the discussion?
The link between pigs and ethnicity has been made by Roy King. Anyway who linked the European ancestry with Middle East because agriculture and many domesticated animals came from there should use the same reasoning of yours now.
Anyway that R1b1*/YCAII=18-23, R-Z2103/Z2105*, R-L51 and all the subclades, in particular R-U152, were born in Italy or at least in Western Europe I think having demonstrated beyond any doubt. And I don't speak of mtDNA K, which, beyond my theories, has now the paper of Costa et alii.Then...
George Chandler
11-06-2013, 05:47 AM
I'm not sure how that link can be made? A Phoenecian (or whom ever) ship carrying pigs for trade (or any other live stock for that matter) doesn't necessarily translate into human genetic migrations. That doesn't make any sense. As far as some people being of Jewish descent being positive for U152 or L2..what is wrong with that? It's a belief system not a genetic lineage unless someone is trying to link U152 with ancient Hebrews? I'm still missing what the arguement or point is here.
Rathna
11-06-2013, 06:04 AM
I'm not sure how that link can be made? A Phoenecian (or whom ever) ship carrying pigs for trade (or any other live stock for that matter) doesn't necessarily translate into human genetic migrations. That doesn't make any sense. As far as some people being of Jewish descent being positive for U152 or L2..what is wrong with that? It's a belief system not a genetic lineage unless someone is trying to link U152 with ancient Hebrews? I'm still missing what the arguement or point is here.
Which is the problem and which the solution?
That hg. R-U152 is European in its origin (I think from Italy, others from Central Europe) is unquestionable. This is said also by Richard Rocca, who is an expert of the haplogroup.
I think that nobody doubts that also R-L21 is European in its origin. But we have some rare Jewish subclades of them (R-L4 and R-L251), with rare mutations (I could speak also of the Jewish R1b1*, R-V88+, R-M269, G2c etc.).
The same is worth for mtDNA K1a1b1a (I am K1a1b1e and all the subclades of K1a1b1 are Italian or at least European).
How to explain this? With an introgression of Europeans in the Jewish pool. But when did this happen?
Probably some subclades may come from an ancient introgression of the Sea Peoples (or other Europeans) during the first millennium BC and not after the diaspora. This is the hypothesis, that ancient DNA could demonstrate or disprove.
Alessio B. Bedini
11-06-2013, 07:10 AM
I'm not sure why you consider that misleading? If the Jewish people being tested have ancestral origins which go back to North Africa (specifically Algeria) you don't think some could be positive for L2?
From National Geographic I expect more accuracy.
L2 is not originated from West Asia. It's ridiculous to say this.
The percentages that are massive in Europe testify European origins .
To say that the highest percentages of L2 are in Algeria is false. There are many studies that show that L2 of the highest percentages are in Belgium or in any case in Europe of the Rhine
Regarding the Jews, by what emerges from the project on FTDNA U152, there are very few people L2 and all descend from a single person. Also say that L2 is present in Jewish Diaspora populations is still false.
My impression is that these cards are often done in a sloppy way ..
Jean-Pierre
11-06-2013, 11:18 AM
From National Geographic I expect more accuracy.
L2 is not originated from West Asia. It's ridiculous to say this.
The percentages that are massive in Europe testify European origins .
To say that the highest percentages of L2 are in Algeria is false. There are many studies that show that L2 of the highest percentages are in Belgium or in any case in Europe of the Rhine
I'm trying very hard to find data about the distribution, variation and origin of R-L2.
It is true that in the Belgian (and Noord-Brabant) study out of a total of 1084 participants 69 are L2+ (including the 14 L20+ members), wich is 6,4% of the total population.
Is there anywhere a frequency map for R-L2?
Regards,
Jean-Pierre.
Alessio B. Bedini
11-06-2013, 12:12 PM
http://www.familytreedna.com/public/R1b-U152/default.aspx?section=ymap
On what basis the National Geographic states that the highest frequency of L2 are in Algeria?
R.Rocca
11-06-2013, 01:11 PM
http://www.familytreedna.com/public/R1b-U152/default.aspx?section=ymap
On what basis the National Geographic states that the highest frequency of L2 are in Algeria?
Alessio, it is obvious that they made a mistake and must have crossed the description with that of another SNP. We already know from almost every study that has tested for U152 and L2 that L2 is higher than 2% in almost every Western European country. As you know, in northern Italy (Treviso, La Spezia) there are places where it is 25% of the males and I'm sure parts of Eastern Switzerland are similar.
There is really no reason to go into length arguing something that is an obvious mistake.
palamede
11-06-2013, 03:35 PM
From National Geography and Dr Spencer Wells, it is a deplorable lack of seriousness .
Customers have the right to obtain a correct information. The problem is this information will be broadcasted through internet and the medias as coming from a serious reference and it will be difficult to remove it.
Congratulations to Alessio Bedini to insist and to put Nat Geo before its responsability.
George Chandler
11-06-2013, 03:47 PM
From National Geographic I expect more accuracy.
L2 is not originated from West Asia. It's ridiculous to say this.
The percentages that are massive in Europe testify European origins .
To say that the highest percentages of L2 are in Algeria is false. There are many studies that show that L2 of the highest percentages are in Belgium or in any case in Europe of the Rhine
Regarding the Jews, by what emerges from the project on FTDNA U152, there are very few people L2 and all descend from a single person. Also say that L2 is present in Jewish Diaspora populations is still false.
My impression is that these cards are often done in a sloppy way ..
From National Geographic I expect more accuracy.
L2 is not originated from West Asia. It's ridiculous to say this.
The percentages that are massive in Europe testify European origins .
To say that the highest percentages of L2 are in Algeria is false. There are many studies that show that L2 of the highest percentages are in Belgium or in any case in Europe of the Rhine
Regarding the Jews, by what emerges from the project on FTDNA U152, there are very few people L2 and all descend from a single person. Also say that L2 is present in Jewish Diaspora populations is still false.
My impression is that these cards are often done in a sloppy way ..
I'm not sure where on the National Georgraphic site it states that L2 is originally from West Asia. There is a difference between a point of origin and point of expansion and the percentage can sometimes have nothing to do with it depending on age. I don't recall any statement that L2 or U152 is of Jewish origin as U152 predates even the ancient Hebrews and don't think that is what they are suggesting. I think what they are saying is that people of Jewish descent from a certain area are testing positive for L2 and that can be from various reasons.
Here is an example (not U152) of a known historical figure that lived in the 2nd century AD who was from Saxe. If you gathered all the people alive descended from that single person they could all say their ethnicity was German or Germanic. Those people could also identify their ethnicity as being English, Scottish, Welsh, Norweigen, Danish, Swedish, French, Spanish, Norman, Spanish, Saxon, Anglo Saxon. So let's supposed you uncovered a grave site from over 2 thousand years ago which could be identified as being from the Celtic Atrebates tribe because of coins found in the grave and you test the ancient DNA and find they are close to the family above. Do you now identify them as Celtic? They were a mixed Celtic Germanic peoples? Let's suppose a person was or orphaned and adopted by people of Jewish ancestry in the 2nd century and many people have this genetic signature within the Jewish population..does that make it ancestrally Jewish?..no. If you find that there are a higher percentage of people from the British Isles who have this signature are they any less Germanic or Germanic Celt in origin..no.
R.Rocca
11-06-2013, 03:50 PM
From National Geography and Dr Spencer Wells, it is a deplorable lack of seriousness .
Customers have the right to obtain a correct information. The problem is this information will be broadcasted through internet and the medias as coming from a serious reference and it will be difficult to remove it.
Congratulations to Alessio Bedini to insist and to put Nat Geo before its responsability.
I completely agree. I was the first person to report Geno 2.0 results and since that time I have been attempting to get them to fix my incorrect assignment of U152 (should be L2). They said they will not do so until the next tree is published, which I insisted has nothing to do with my L2 result.
George Chandler
11-06-2013, 03:56 PM
I completely agree. I was the first person to report Geno 2.0 results and since that time I have been attempting to get them to fix my incorrect assignment of U152 (should be L2). They said they will not do so until the next tree is published, which I insisted has nothing to do with my L2 result.
Were they testing for L2 in the Geno 2.0? I'm DF13 but it only shows L21 as I don't believe they were testing for it.
Alessio B. Bedini
11-06-2013, 04:39 PM
I'm not sure where on the National Georgraphic site it states that L2 is originally from West Asia.
In the page https://genographic.nationalgeographic.com/results/yourmap?mapType=p is written
Branch: L2
Age: To Be Determined
Location of Origin: West Asia
From West Asia, members of this lineage have spread into Europe and back into Africa.
Today, geneticists have found it in Europe, Central Asia, West Asia, and North Africa. Its highest frequencies are in Algeria, where it is between 2 and 3 percent of the male population. It is 1 to 2 percent of male lineages in Kazakhstan. It is about 1 percent of the male population in Iraq. It is also present in Jewish Diaspora populations. It is 1 to 2 percent of the male populations of Italy, Germany, and the Netherlands.
This is cheat their users!
My English language sucks otherwise I would have written a long email of protest ...
George Chandler
11-06-2013, 05:35 PM
In the page https://genographic.nationalgeographic.com/results/yourmap?mapType=p is written
This is cheat their users!
My English language sucks otherwise I would have written a long email of protest ...
I wasn't able to see what you're link showed as it only brings me to the login for the Geno 2.0. When I login to my personal page it only shows the L21 map and doesn't show how they place L2. One thing to remember is that research and information in this field is developing very fast. What you "know today" is "wrong tomorrow" and I'm sure with the new FGS testing many new things will be discovered. For them to make changes to hundreds of thousands of web pages for a possible point of origin would be expensive and not practical.
I agree with you that L2 "in my opinion" probably originated in north eastern Italy. There also may be a genetic line or cluster which they have discovered from towards the Caucasses. Given that Romans ruled much of the know world for hundreds of years it's possible that an old line or cluster also ended up in Algeria as well.
Alessio B. Bedini
11-06-2013, 06:09 PM
I would have preferred none explanation instead of a wrong explanation.
If they wanted to be more serious at the beginning of the explanation they could have enter the date on which it was written claiming that this was the probability at that given time.
They have very underestimated people with whom they were dealing. We're not stupid .. ;)
haleaton
11-06-2013, 06:16 PM
I completely agree. I was the first person to report Geno 2.0 results and since that time I have been attempting to get them to fix my incorrect assignment of U152 (should be L2). They said they will not do so until the next tree is published, which I insisted has nothing to do with my L2 result.
Interesting Rich. Was that due to a bad read by the GENO 2.0 chip? Hard to tell from FTNDA as they combined with previous Sanger based Deep Clade or Single SNP in group reports. GENO 2.0 me as R-L2.
I think without using outside unpaid science volunteers, as in the FTDNA groups or private web pages, it hard for these companies to provide support on their own dime. I sometimes wonder if GENO 2.0 was more about selling magazine subscriptions.
George Chandler
11-06-2013, 06:18 PM
I would have preferred none explanation instead of a wrong explanation.
If they wanted to be more serious at the beginning of the explanation they could have enter the date on which it was written claiming that this was the probability at that given time.
They have very underestimated people with whom they were dealing. We're not stupid .. ;)
I have the same opinion as you regarding the origins of L2 but also consider the fact they have more information available to them than I do. When looking at origin maps or DNA testing for ethnic origins you can't look at it as an absolute certainty, but understand how you would rather have no explanation. You have to look at the information as evolving rapidly and not as a certainty. You can only increase you certainty in regards to ethnic lines by triangulating with DNA and backing it up with paperwork..or obtaining DNA from burial sites.
R.Rocca
11-06-2013, 06:25 PM
Interesting Rich. Was that due to a bad read by the GENO 2.0 chip? Hard to tell from FTNDA as they combined with previous Sanger based Deep Clade or Single SNP in group reports. GENO 2.0 me as R-L2.
I think without using outside unpaid science volunteers, as in the FTDNA groups or private web pages, it hard for these companies to provide support on their own dime. I sometimes wonder if GENO 2.0 was more about selling magazine subscriptions.
Nope, the Gen 2.0 raw data has me correctly derived at L2, just like my FTDNA deep clade test did, so it is just mis-classified on their site.
And to boot, I am also U152* on 23andMe because of a no-read at L2!!!
Biloo
11-06-2013, 07:08 PM
In my personal Page Geno 2.0 I re-read what has been written for L2 and I realize how very misleading:
From what is written seems to be a SNP of Algerian origin (where they say it's the strongest concentration) with a strong presence of Jews ..
But who writes them the paper?
PS
We could divide the messages that relate to "L2+ and jews" from the rest ..
I'm the only L2+among hundreds of algerians (in FTDNA and other companies) who got their Y-DNA tested. Maybe they took their data from FTDNA where about 40 to 50 algerians got tested. One of them is L2+ (me), so that would explain this 2% of haplogroup R1b-L2+ in Algeria.
The European R1b is quite rare in North Africa to be honest. I know an algerian who is R1b-P312*, a moroccan who is R1b-U106, two algerians R-U152* (from a study) and a tunisian R-SRY2627 (from a study), the rest is E1b1b, J1, J2, R1b-M269*, R1b-L23*, E1b1a, T..etc...
Kwheaton
11-10-2013, 04:00 PM
Biloo,
Are you considering the Full Genomes test?
Just wanted to let my fellow L2* and (now downstream) folks know that WHEATON group B is opting in to Full Genomes.
David J WHEATON FTDNA Kit #200230 L2+ Robert WHEATON b 1606 prob. Devon or Somerset, England.
Will keep you posted.
Kelly
Biloo
11-11-2013, 06:25 PM
Biloo,
Are you considering the Full Genomes test?
Just wanted to let my fellow L2* and (now downstream) folks know that WHEATON group B is opting in to Full Genomes.
David J WHEATON FTDNA Kit #200230 L2+ Robert WHEATON b 1606 prob. Devon or Somerset, England.
Will keep you posted.
Kelly
Yes but the price is too high for me. I've ordered the big Y test yesterday
Alessio B. Bedini
11-11-2013, 06:42 PM
Biloo if your kit is 171601 you are one of my closest YDNA
Our distance genetic is 20 steps on 67mrk
It's possibile that we are in a same clade
I'm waiting for your BIG-Y
Biloo
11-11-2013, 07:36 PM
Biloo if your kit is 171601 you are one of my closest YDNA
Our distance genetic is 20 steps on 67mrk
It's possibile that we are in a same clade
I'm waiting for your BIG-Y
Yes , 171601 is my kit number
Pigmon
11-12-2013, 02:39 PM
Are any of you guys L2, Z49 and Z142 positive?
Kwheaton
11-12-2013, 09:32 PM
Are any of you guys L2, Z49 and Z142 positive?
Rich Rocca would be the best to answer this but of those that have posted here that are testing with FG Y I don't see any. Are you in the U152 Group at FTDNA? If not this is the link to the results page.
[URL="http://www.familytreedna.com/public/R1b-U152/default.aspx?vgroup=R1b-U152&vgroup=R1b-U152§ion=ycolorized"]
Looks like there are 22 that meet your criteria but I don't know if any are testing FG Y or Big Y.
R.Rocca
11-13-2013, 12:59 AM
I'm not sure if the question was in relation to Full Genome and/or Big-Y testing, but there are two L2+ Z49+ Z142+ kits that ordered Big-Y. You can find them here:
https://docs.google.com/spreadsheet/ccc?key=0AgHBsIq9ZUahdFJ4MUdicTVKUmJvSmFsVTFOa2RPX 3c&usp=drive_web#gid=0
MitchellSince1893
11-13-2013, 03:25 AM
I'm not sure if the question was in relation to Full Genome and/or Big-Y testing, but there are two L2+ Z49+ Z142+ kits that ordered Big-Y. You can find them here:
https://docs.google.com/spreadsheet/ccc?key=0AgHBsIq9ZUahdFJ4MUdicTVKUmJvSmFsVTFOa2RPX 3c&usp=drive_web#gid=0
I didn't see anything in the spreadsheet indicating a Big-Y order...or is that indicated by the "N/A" in the "Full Genome Kit" column?
Mudgeeclarke
11-13-2013, 10:35 AM
Hello.
Yes, I am L2 (Z142+, Z49+, Z51+, Z57+ ) and have ordered the Big-Y, expecting results in maybe February and an understanding of the results much later. :-)
NPE at G GF level in or around Cambridge, Cambs UK c1831
Y-Search UJJRA
FTDNA206005
Regards,
R.Rocca
11-13-2013, 12:57 PM
I didn't see anything in the spreadsheet indicating a Big-Y order...or is that indicated by the "N/A" in the "Full Genome Kit" column?
Yes. I am working on a new spreadsheet, so the new one will have a column for the company a kit tested with.
Pigmon
11-13-2013, 02:46 PM
Greetings KWheaton, Colin Clarke, Richard Rocca, and Mitchell,
I keep working on my paternal genealogy and finding the asterisk. I find that every time I think I have found my terminal SNP it becomes more elusive! The BigY test looks exciting but a bit pricey at $495.
Michael Corleone: "Just when I thought that I was out... they pull me back in!"
Pigmon
11-13-2013, 03:35 PM
Hello.
Yes, I am L2 (Z142+, Z49+, Z51+, Z57+ ) and have ordered the Big-Y, expecting results in maybe February and an understanding of the results much later. :-)
NPE at G GF level in or around Cambridge, Cambs UK c1831
Y-Search UJJRA
FTDNA206005
Regards,
I just checked ysearch.org again and you are one of my closest matches in the R1b1a2a1a1b3c category - Western Europe.
We are a genetic distance of 20 at 71 markers compared.
We share 71.8% of the STRs.
I am U152> L2> Z49> Z142+ (L562- L594-) however, and you are:
U152> Z49> Z142> L562 / Z51> Z57. Difference at L562.
Mudgeeclarke
11-14-2013, 11:17 AM
Hello. Yes, I had seen your results previously but noted the GD and thought it a little far to get too excited. At this stage, I have withheld preparing a shipment of the family treasure to you. (And you to me, no doubt). I don't know what else we can do to find any genealogical connection, with my GGF NPE situation.
My paternal G GGF, or his own paternal line, may well have been a traveler, a sailor, or indeed a scholar visiting Cambridge in the 1600-1800 era. When you find a relative who was known to be visiting Cambridge from France or Greece, who may have started a small off-shoot (so to speak) let me know. :-)
Cheers
Pigmon
11-14-2013, 02:35 PM
Hello. Yes, I had seen your results previously but noted the GD and thought it a little far to get too excited. At this stage, I have withheld preparing a shipment of the family treasure to you. (And you to me, no doubt). I don't know what else we can do to find any genealogical connection, with my GGF NPE situation.
My paternal G GGF, or his own paternal line, may well have been a traveler, a sailor, or indeed a scholar visiting Cambridge in the 1600-1800 era. When you find a relative who was known to be visiting Cambridge from France or Greece, who may have started a small off-shoot (so to speak) let me know. :-)
Cheers
I have only a few closer than yours in this bucket. They are:
Bourbon Salins, Jura, Franche-Comte, France GD of 15 with 67 markers compared 77.6%
Perry Alsace/Elsass, France GD of 15 with 67 markers compared 77.6%
Salomon Irmstett, France GD of 17 with 67 markers compared 74.6%
Vermaete Belgium GD of 19 with 72 markers compared 73.6%
Prillaman Amriswil, Switzerland GD of 18 with 67 markers compared 73.1%
Eggmann Uttwil, Switzerland GD of 18 with 67 markers compared 73.1%
As far as possible locations of my direct ancestry, I will send you an e-mail message about my genealogical finds (around 1649) in the Old Hunstanton and Norwich areas of Norfolk, England. These are fairly close to Cambridge. These probable ancestors are listed in the non-conformist records of Hunstanton.
Mudgeeclarke
11-15-2013, 09:58 AM
Thanks for this, and also the private message received regarding the UK history. Very interesting, and perhaps more in the realm of genealogical possibilities. I need to find some volunteer 'swabees'. :-)
ApplegateJ1
12-31-2013, 04:37 AM
From Geno.2 I have Z49+, Z142/S211-, L562+, Z51/S369+ and Z197-. Is this more likely a back mutation of Z142/S211, haplotype convergence, or something else? What SNPs are FTDNA posting and where? I had read that only some positives were being posted on the haplo page and all the positives were posted to projects, but my Geon.2 SNPs are the same on both. I am not sure if I am reading the ISSOG page correctly and FTDNA is not listing them as positive for me; are the following SNPs positive?
L343 allele G
L443/L675/L199 allele A
Z43 allele A
R.Rocca
01-03-2014, 01:21 AM
From Geno.2 I have Z49+, Z142/S211-, L562+, Z51/S369+ and Z197-. Is this more likely a back mutation of Z142/S211, haplotype convergence, or something else? What SNPs are FTDNA posting and where? I had read that only some positives were being posted on the haplo page and all the positives were posted to projects, but my Geon.2 SNPs are the same on both. I am not sure if I am reading the ISSOG page correctly and FTDNA is not listing them as positive for me; are the following SNPs positive?
L343 allele G
L443/L675/L199 allele A
Z43 allele A
Are these values taken from your Geno 2.0 raw data file?
ApplegateJ1
01-03-2014, 02:19 AM
Yes, the alleles for L343, L199 & Z49 are from the Y raw data from Geno 2.
Sven Vermaete
01-24-2014, 09:20 AM
Vermaete Belgium GD of 19 with 72 markers
compared 73.6%
I dont think we are closer related then our L2 common ancestor - i am z49 negatif
Alessio B. Bedini
01-24-2014, 12:53 PM
Welcome to the forum! :)
PS
My genetic distance is 42/111 with kit no. 88594 and 49/111 with kit. no. 97936
Sven Vermaete
01-24-2014, 03:26 PM
Thank you,
Thats a big GD.
My closest match on y search is L2 modal -even on the belgium/Brabant project i have only 1 match at GD 5 - but with only 38 markers to compare and no similar surname
So no genetic cousins yet for me
Kwheaton
01-24-2014, 11:04 PM
Thank you,
Thats a big GD.
My closest match on y search is L2 modal -even on the belgium/Brabant project i have only 1 match at GD 5 - but with only 38 markers to compare and no similar surname
So no genetic cousins yet for me
Sven what is your kit number? We are quite far off the modal too. Kit 1099087 WHEATON and the FGS kit is YTM8R
Not sure when to expect results as We are Batch 6 and Batch 5 has been pushed back to March.
Welcome to L2*
Pigmon
01-25-2014, 02:27 PM
Vermaete Belgium GD of 19 with 72 markers
compared 73.6%
I dont think we are closer related then our L2 common ancestor - i am z49 negatif
Welcome to the forum Sven!
That sounds correct. I didn't know if you were Z49+ or negative before. Thanks for that!
It would be nice if ysearch and FTDNA included Z49, Z142, and L562 L552 / L553 as subclade search options!
Sven Vermaete
01-27-2014, 07:22 AM
I agree - An option to exclude matches that have tested positive for other (sub) branches. But not everyone has done all deep clade tests ... So those should be included.
tbartold
02-25-2014, 02:42 AM
Just re-introducing myself. I just found this forum this week.
As far as I can tell I'm still R-L2*, although the Geno2.0 test appears to have added Z35+ to my FTDNA profile. It has also added about a dozen novel SNPs to my profile (N81364). Is 800 years in isolation enough time to support that many novel SNPs?
Since the Geno 2.0 raw data does not appear to support that SNP, and it also has Z367-, I'm guessing that my Geno2.0 results were corrupt. My Geno 2.0 results also disagree with my WTY results on at least a couple dozen SNPs (how could that happen?).
I'm currently waiting for my BigY results. My FTDNA page says they should be online Feb 28. How likely is that?
As far as why I'm an R1b-L2 from Poland, what I know is this. My family name hasn't changed since it was created in Poland in the 1400s. It appears that the name arrived with a knight who (I like to think) deserted the Teutonic Knights in the 1300s, and was granted land because of it. The original land (a village now) still bears his name. It's not clear where he came from, but it is clear that his given name started near the Swiss Alps in the 700s. It's possible he was descended from one of those early noble families. I'd like to think that R-L2 supports that (tenuous) connection.
Mudgeeclarke
02-25-2014, 10:48 AM
Wow! I am very jealous that you have had stability in geography and family names for so long - even a village name ! Thanks for an interesting commentary.
I'm patiently (not so much) waiting for Big Y results, although truthfully, I expect no advance for my NPE mystery (roadblock) at 1831. What I need to see is a rising tide of UK residents taking the tests. Recent reports from various events do show an upswell at FTDNA in UK sign ups. The more the merrier. :)
Pigmon
03-03-2014, 02:33 PM
It looks as though you will not have to wait too much longer. The first Big Y results are soon to be revealed!
Although I didn't order the test, I am eagerly waiting the results of my R-L2 (R1b1a2a1a1b3c) (Z142+ Z49+ L2+) cousins!
Mudgeeclarke
03-04-2014, 11:03 AM
Yes, the results have started. You may have heard there were some teething problems with FTDNA and this Beta test for those like me who purchased up front and early ... (11 Nov 13 for me). They were overloaded with orders, and they also say a supplier ran out of reagent needed for the Lab. After so many broken promises on delivery times, I don't believe a word they say about delivery dates for tests. I think they operate on the principle of promise whatever, and apologize whenever. Despite that, they are the best show in town, which gives them the edge .... My results are now promised for March 31, although I notice that they didn't specifically say 2014. wink. Actually, honestly, it really is no big deal for me because I am not scientist, or even close,, so it will give the boffins a chance to analyze the first 100 results already released, and figure out how they are relevant and how to apply results. I'm not expecting any great personal eureka moments, for family history, although it would be fabulous for me if my 67 marker GD4 matches came closer to me, given my NPE status from G GF era. We'll see. This March 31, or next. :-)
tbartold
03-04-2014, 10:30 PM
So I have BigY results, and am trying to make some sense of them.
I want to look at the results offline, and sort them and such, which the s/s style of the browser does not support (I can only copy/paster 50 lines at a time, and then stitch them together, so I thought that the VCF file would be easier to use). But I don't see how the BigY results in the browser are related to the data in the VCF file.
In the Browser it lists 613 Derived SNPs (596 High, 8 Medium and 9 Unknown Confidence), and 132 Novel Variants (99 High and 33 Medium Confidence).
In the VCF file, as I understand it, the same number of results should show up when I look at all of the 'PASS' results that number of variants are non-zero (there are 25000+ results that 'PASS' with '0' variants). But in this case, I only find 325 reported. My new 13685121 (FGC4183) is clearly there as a 'PASS' with '1' variant, so that's telling me I'm FGC4183+, right? But something like 22157311 (P312) is listed as a variant '0' in my VCF file. I know I'm P312+ so how does the VCF data tell me that? Is there some way to know that a '0' variant actually means +? I should have about 420 of those.
I suppose I just don't know how to read the VCF data.
Mudgeeclarke
03-05-2014, 11:23 AM
So I have BigY results, and am trying to make some sense of them.
......
..... I suppose I just don't know how to read the VCF data.
I think the Project managers are trying to get a handle on all of this right now. Ask your project manager ... If you are not in a project, join a relevant one. These people are smart ... I'm sorry, I can't help you .... according to Geno-2, I'm 3% Neanderthal ;-). Cheers.
R.Rocca
03-05-2014, 12:55 PM
So I have BigY results, and am trying to make some sense of them.
I want to look at the results offline, and sort them and such, which the s/s style of the browser does not support (I can only copy/paster 50 lines at a time, and then stitch them together, so I thought that the VCF file would be easier to use). But I don't see how the BigY results in the browser are related to the data in the VCF file.
In the Browser it lists 613 Derived SNPs (596 High, 8 Medium and 9 Unknown Confidence), and 132 Novel Variants (99 High and 33 Medium Confidence).
In the VCF file, as I understand it, the same number of results should show up when I look at all of the 'PASS' results that number of variants are non-zero (there are 25000+ results that 'PASS' with '0' variants). But in this case, I only find 325 reported. My new 13685121 (FGC4183) is clearly there as a 'PASS' with '1' variant, so that's telling me I'm FGC4183+, right? But something like 22157311 (P312) is listed as a variant '0' in my VCF file. I know I'm P312+ so how does the VCF data tell me that? Is there some way to know that a '0' variant actually means +? I should have about 420 of those.
I suppose I just don't know how to read the VCF data.
In the case of P312, the reference value in the VCF is really the derived value of "A". So, since you are "A" like the reference sample, you are P312+.
tbartold
03-05-2014, 05:34 PM
In the case of P312, the reference value in the VCF is really the derived value of "A". So, since you are "A" like the reference sample, you are P312+.
That's good to know. Is there a list somewhere that says which reference values are really derived values in the VCF files? Is the use of derived values a standard, or would it be different in, for example, Geno 2.0, WTY and BigY? Or am I getting in over my head?
R.Rocca
03-05-2014, 05:42 PM
That's good to know. Is there a list somewhere that says which reference values are really derived values in the VCF files? Is the use of derived values a standard, or would it be different in, for example, Geno 2.0, WTY and BigY? Or am I getting in over my head?
It is quite straight forward. Just type in the name of the SNP in Thomas Krahn's browser:
http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/
Some SNPs are not yet named, so you must enter the position range of the SNP you are interested in. If you didn't know the name of P312 but knew the position, you would type in ChrY:22157311..22157311 ...note that the start and end positions are the same since the mutation only occurs in one position. Click on the "Search" button. In the results, you will see P312, PF6547 and S116 which are all just different names for the same SNP. If you click on P312, the new window will give you the reference/ancestral and alternate/derived values.
Pigmon
03-05-2014, 06:10 PM
It is quite straight forward. Just type in the name of the SNP in Thomas Krahn's browser:
http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/
Some SNPs are not yet named, so you must enter the position range of the SNP you are interested in. If you didn't know the name of P312 but knew the position, you would type in ChrY:22157311..22157311 ...note that the start and end positions are the same since the mutation only occurs in one position. Click on the "Search" button. In the results, you will see P312, PF6547 and S116 which are all just different names for the same SNP. If you click on P312, the new window will give you the reference/ancestral and alternate/derived values.
Rich,
I just tried typing in my deepest (so far) snp and here is what I got:
Z142 Details
Name: Z142
Type: snp
Source: point
Position: ChrY:16787539..16787539 (+ strand)
Length: 1
ISOGG_haplogroup: R1b1a2a1a2b1c1
YCC_haplogroup: Approx. hg: R-Z49
allele_anc: A
allele_der: G
comments: downstream of R-Z49
count_derived: 35
count_tested: 272
mutation: A to G
primer_f: Z142_F CCTTCCATCCACCAAATGTC
primer_r: Z142_R TTGTGGGTTAGTGGGTAATGG
ref: http://dna-forums.org/
primary_id: 34945
gbrowse_dbid: chrY:database
>Z142 class=Sequence position=ChrY:16787539..16787539 (+ strand)
a
I don't know what it means except for it's position on the y chromosome scale though.
Interesting!
R.Rocca
03-05-2014, 06:27 PM
Rich,
I just tried typing in my deepest (so far) snp and here is what I got:
Z142 Details
Name: Z142
Type: snp
Source: point
Position: ChrY:16787539..16787539 (+ strand)
Length: 1
ISOGG_haplogroup: R1b1a2a1a2b1c1
YCC_haplogroup: Approx. hg: R-Z49
allele_anc: A
allele_der: G
comments: downstream of R-Z49
count_derived: 35
count_tested: 272
mutation: A to G
primer_f: Z142_F CCTTCCATCCACCAAATGTC
primer_r: Z142_R TTGTGGGTTAGTGGGTAATGG
ref: http://dna-forums.org/
primary_id: 34945
gbrowse_dbid: chrY:database
>Z142 class=Sequence position=ChrY:16787539..16787539 (+ strand)
a
I don't know what it means except for it's position on the y chromosome scale though.
Interesting!
allele_anc: A <<< This is what someone who is Z142- would get
allele_der: G <<< This is what someone who is Z142+ would get
So, in your Big-Y results, you should see the value "G" as derived.
tbartold
03-07-2014, 12:48 AM
Sorry if this is obvious, but I'm trying to learn.
Where do I find those DF103 and FGC4183 ids that you've mentioned? ybrowse says they're not found.
But, for 13685121 I see this:
Name: S14469
Type: snp
Source: point
Position: ChrY:13685121..13685121 (+ strand)
Length: 1
ISOGG_haplogroup: not listed
YCC_haplogroup: not listed
allele_anc: C
allele_der: T
count_derived: 0
count_tested: 0
mutation: C to T
primer_f: TBD
primer_r: TBD
ref: Jim Wilson (2014)
primary_id: 18332
gbrowse_dbid: chrY:database
So that makes sense. I have the T mutation.
But 9020396 doesn't show anything. I think you said that was the easier one to test.
(and, BTW, where does S14469 come from?)
R.Rocca
03-07-2014, 01:04 AM
Sorry if this is obvious, but I'm trying to learn.
Where do I find those DF103 and FGC4183 ids that you've mentioned? ybrowse says they're not found.
But, for 13685121 I see this:
Name: S14469
Type: snp
Source: point
Position: ChrY:13685121..13685121 (+ strand)
Length: 1
ISOGG_haplogroup: not listed
YCC_haplogroup: not listed
allele_anc: C
allele_der: T
count_derived: 0
count_tested: 0
mutation: C to T
primer_f: TBD
primer_r: TBD
ref: Jim Wilson (2014)
primary_id: 18332
gbrowse_dbid: chrY:database
So that makes sense. I have the T mutation.
But 9020396 doesn't show anything. I think you said that was the easier one to test.
(and, BTW, where does S14469 come from?)
9020396 is really an extremely slow mutating STR, so it would not show up there. S14469 is the name given to FGC4183 by BritainsDNA.
OldPeter
03-10-2014, 03:56 PM
Hello - I am new to the Group. I have tested with FTDNA and done Y-DNA, Family finder and mtDNA. Done SNP's and at present my terminal SNP is R1b-L2. I have done a full family tree back to about 1650, with all siblings recorded. On the Y-DNA side my most distant ancestor is Willem Hendrik Boshoff born 1720. I am not sure whether he is French or Dutch. I have plenty pre-surname era matches with other surnames, so 200 to 500 years back or even further back - How long ago did the R1b-L2 group originate and in what area did it start? I surmise the group is still Celtic or am I wrong?
tbartold
03-11-2014, 02:21 AM
I expect that R1b-L2 originated thousands of years ago, way before my ancestor ever came to Poland, and way before anything I can find about his possible ancestors. I'm still working under the (hopeful) assumption that I'm descended from a Bartold who one of the founders of Reichenau Abbey in 724 (earliest mention of the name Perahtoltus), who I assume was R1b-L2 also.
Alessio B. Bedini
03-11-2014, 07:38 AM
I think L2 are of Franks origin.
This is because in the area of Lotharingia (Wallonia, Lorraine, Rhine Valley) the presence L2 is very strong.
In addition, some families L2 are probably came to Italy with the Franks.
I hope that in the future they can know more about this hypothesis ...
Armenis
03-12-2014, 12:07 PM
Hi everybody, I've decided to join the forum as I am awaiting my Big Y results. I'm of the opinion that L2 is older than we think and possibly of pre-German (Frankish), French (Frankish) and Italian (Frankish) origins, but somehow related to the Franks as Alessio stated? I believe that L2 began spreading across Europe early on and am at odds as where and when exactly it entered the Balkans.
Pigmon
03-12-2014, 01:32 PM
Hi everybody, I've decided to join the forum as I am awaiting my Big Y results. I'm of the opinion that L2 is older than we think and possibly of pre-German (Frankish), French (Frankish) and Italian (Frankish) origins, but somehow related to the Franks as Alessio stated? I believe that L2 began spreading across Europe early on and am at odds as where and when exactly it entered the Balkans.
Welcome to the forum Armenis!
Hopefully we can all learn more of our ancestry. Although I did not order the Big Y I eagerly await the results of yours and others!
Curtis
Armenis
03-12-2014, 04:00 PM
Welcome to the forum Armenis!
Hopefully we can all learn more of our ancestry. Although I did not order the Big Y I eagerly await the results of yours and others!
Curtis
Thanks Curtis, what SNP test helped you get to your Z142 terminal SNP?
I'm really grateful for all the work Richard is doing. I'm expecting L2 to gain a number of first-step subclades. My understanding of the sheer number of L2* participants (U152 subclades project) is that with the new SNPs coming in L2 will develop a broader foundation and many more first-step subclades following on from it (L2).
Does your Z142 confirm anything for you, regarding your French/Greek lineage?
I'm curious to see what my Big Y result brings to light.
Alex Armenis
MitchellSince1893
03-12-2014, 04:51 PM
Alex,
Over 3/4ths of z142+ folks in the ftdna U152 project list French or British ancestry but there are also Italian, Swiss, Hungarian, and Iberian results too.
Here is a chart I made back in November on the breakout of Z142+ from publicly available results in the Haplotype Data for R1b-P312xL21 spreadsheet located here https://groups.yahoo.com/neo/groups/R1b-P312-Project/links/all.
1614
The associated thread discussion is here http://www.anthrogenica.com/showthread.php?1092-U152-L2-Z49-Z142-quot-Country-of-Origin-quot-Percentages-for-England-and-France
Pigmon
03-12-2014, 08:52 PM
Hi Alex,
The L2(positive) and L20(negative) tests were with Genebase in 2009 and 2010.
I wanted to join the forums and couldn't so I re-tested with FTDNA as follows:
2011 67 marker STR test
2011 L196(negative)
2012 Z49(positive)
2012 Z142(positive)
2012 L562(negative)
I had help from Terry Barton with worldfamilies.net initially then I joined the U152 and Subclades Project.
Steve Gilbert is the administrator and he guided me to the possibilities along the way.
Here is the project link:
http://www.familytreedna.com/public/R1b-U152/
Curtis
Mudgeeclarke
03-13-2014, 10:00 AM
Although my deepest known paternal history (G GF) is English and merely in the early 1800s (Cambridgeshire, UK), he was NPE and being born vicinity Cambridge, it is entirely possible his father is from "further afield".
I have no preference for the country of origin of my G G GF ... but I would like some stronger pointers than I have so far .... :-)
Ravai
03-24-2014, 12:55 PM
Hello, mi Y-DNA is R-L2 too.
Best regards
Solothurn
03-24-2014, 06:08 PM
Hi L2 folks :)
An L2 contact of mine: kit E8413 from Cembra, Trentino, Italy, has ordered Z49. He ordered via Igenea, but it isn't showing on FTDNA as pending. Does anybody know if there would be a delay from Igenea to FTDNA for it to show?
Thanks
Solothurn
04-06-2014, 02:58 PM
This is still ongoing maybe a mix up at his bank!
BTW he states his ancestors came from Germany to Italy 900-1100 AD :)
Hi L2 folks :)
An L2 contact of mine: kit E8413 from Cembra, Trentino, Italy, has ordered Z49. He ordered via Igenea, but it isn't showing on FTDNA as pending. Does anybody know if there would be a delay from Igenea to FTDNA for it to show?
Thanks
Mudgeeclarke
04-07-2014, 12:47 PM
For what it's worth ...
My BigY results don't mean a whole lot to me yet, and of course, the Haplogroup/Tree is outdated at FTDNA with a promise to show a new one "soon". Perhaps ISOGG is best for now?
Anyway, just is case anyone here at R-L2 is interested, my results south of L2 are shown here : copy/paste : L2+, Z49+, Z142+, L562+, L23+, L51+, L52+, M168+, M173+, M207+, M213+, M228.2-, L3-, Z52-, Z147-, Z148-, L617-, L552-, L553-, L20-, L21-, L257-, L325-, M228.2-, L165-, L176.2-, L193-, L196-, L196-, L20-
The tree at FTDNA shows M207 with "my" arrow, and I presume I will eventually be shown in shorthand as R-M213 instead of Z49. However, I am not in any way shape or form an expert in any of this, so I will wait and see.
Meanwhile, I assume that anyone who is Z49 could do a single SNP test down my line a little - maybe M207 - and see if they also are heading in this direction. It would be a lot less expensive than Big Y. Just a thought.
I'd love to hear from anyone who has an understanding of where this places me and how it helps the science .... :-)
Mudgeeclarke
04-07-2014, 12:49 PM
For what it's worth ...
My BigY results don't mean a whole lot to me yet, and of course, the Haplogroup/Tree is outdated at FTDNA with a promise to show a new one "soon". Perhaps ISOGG is best for now?
Anyway, just is case anyone here at R-L2 is interested, my results south of L2 are shown here : copy/paste : L2+, Z49+, Z142+, L562+, L23+, L51+, L52+, M168+, M173+, M207+, M213+, M228.2-, L3-, Z52-, Z147-, Z148-, L617-, L552-, L553-, L20-, L21-, L257-, L325-, M228.2-, L165-, L176.2-, L193-, L196-, L196-, L20- (I have no idea why L20- and L196- are shown more than once).
The tree at FTDNA shows M207 with "my" arrow, and I presume I will eventually be shown in shorthand as R-M213 instead of Z49. However, I am not in any way shape or form an expert in any of this, so I will wait and see.
Meanwhile, I assume that anyone who is Z49 could do a single SNP test down my line a little - maybe M207 - and see if they also are heading in this direction. It would be a lot less expensive than Big Y. Just a thought.
I'd love to hear from anyone who has an understanding of where this places me and how it helps the science .... :-)
MitchellSince1893
04-07-2014, 03:51 PM
Have you seen Richard Rocca's new u152 tree?
http://www.anthrogenica.com/showthread.php?2375-Updated-U152-Tree&p=36351&viewfull=1#post36351
Mudgeeclarke
04-08-2014, 01:35 AM
No, but I will shortly. :-).
Thanks.
Pigmon
04-10-2014, 01:35 PM
Z12222(Z150) is being offered a-la-carte on the advanced orders menu.
I just ordered it along with L2. I tested positive for L2 previously but it was with Genebase and it will not transfer into FTDNA.
Now I have to wait.:\
OldPeter
04-22-2014, 12:43 PM
Another R1b-L2, but moved on -Now R1b- L20 or R-1b1a2a1a1b3c1 Any L20's and where do we come from and from what time era and geographical area?
Bolgeris
04-22-2014, 03:24 PM
Ciao,
If you are L20 + from that region of origin ...? Northern Italy, Benevento, Switzerland, France? There are several hypotheses, pending confirmation with BIG Y, for the origin of L20 +
Kwheaton
04-23-2014, 01:22 PM
Rich,
Do you happen to know if DF90, DF103 or DF110 have been requested from YSEQ.net or any of the others downstream of L2 for that fact. I note they are on sale through Father's Day for $25 each. Also if You have any suggestions as to who should test what in what order let us know. The WHEATON group will have a long wait and "if" I had a pretty good idea where we might end up I might encourage a couple of others in our group to do some Spot testing.
Alessio B. Bedini
04-23-2014, 02:52 PM
I look every day DF110 and FGC10543 on FTDNA and YSEQ but still not there.
The DF90 is instead only on FTDNA
I hope I get these soon ..
R.Rocca
04-24-2014, 11:51 AM
I look every day DF110 and FGC10543 on FTDNA and YSEQ but still not there.
The DF90 is instead only on FTDNA
I hope I get these soon ..
Primer details for DF110 have been submitted to FTDNA, BritainsDNA and YSEQ. Position details for FGC10543 have been sent to FTDNA and YSEQ. YSEQ has already confirmed that they will be ordering primers for FGC10543.
R.Rocca
04-24-2014, 12:21 PM
Rich,
Do you happen to know if DF90, DF103 or DF110 have been requested from YSEQ.net or any of the others downstream of L2 for that fact. I note they are on sale through Father's Day for $25 each. Also if You have any suggestions as to who should test what in what order let us know. The WHEATON group will have a long wait and "if" I had a pretty good idea where we might end up I might encourage a couple of others in our group to do some Spot testing.
Please see my response to Alessio. Also, please note that both DF90 and DF103 are already available via FTDNA, with DF103 being a likelier positive for samples of British ancestry.
Alessio B. Bedini
04-25-2014, 04:59 PM
DF110 is now available on Yseq
I would have wanted to test but they ask me to send the kit and I do not want to wait that it comes in Italy and returns in the USA.
I'll wait it is available on FTDNA
R.Rocca
04-25-2014, 05:34 PM
DF110 is now available on Yseq
I would have wanted to test but they ask me to send the kit and I do not want to wait that it comes in Italy and returns in the USA.
I'll wait it is available on FTDNA
I thought you had already tested via YSEQ? Maybe they don't realize you already have a kit there?
I think that with the problems that FTDNA is having with their new tree, it will be a while before they start offering new SNPs and they take a long time regardless. As it is, it looks like Big-Y results are at a stand-still for the past week.
FYI, I found another two SNPs that I share with the one L2+FGC10543+ Sardinian sample. The details are as follows:
Name: FGC10516
Position: 7149089
allele_anc: A
allele_der: G
Name: FGC10536
Position: 17372204
allele_anc: C
allele_der: T
I see that Thomas has already added FGC10543 to the ISOGG browser:
http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/
Alessio B. Bedini
04-25-2014, 05:47 PM
Tonight I'll try to write them asking if they still have my sample
Maybe they do not keep the kit.
haleaton
04-25-2014, 06:17 PM
I thought you had already tested via YSEQ? Maybe they don't realize you already have a kit there?
I think that with the problems that FTDNA is having with their new tree, it will be a while before they start offering new SNPs and they take a long time regardless. As it is, it looks like Big-Y results are at a stand-still for the past week.
FYI, I found another two SNPs that I share with the one L2+FGC10543+ Sardinian sample. The details are as follows:
Name: FGC10516
Position: 7149089
allele_anc: A
allele_der: G
Name: FGC10536
Position: 17372204
allele_anc: C
allele_der: T
I see that Thomas has already added FGC10543 to the ISOGG browser:
http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/
Great! Out of curiosity were they high reliability SNPs found in Full Genomes analysis matched with Dr. Francalacci's sample or vice versa and less reliable ones?
R.Rocca
04-25-2014, 07:26 PM
Great! Out of curiosity were they high reliability SNPs found in Full Genomes analysis matched with Dr. Francalacci's sample or vice versa and less reliable ones?
The three SNPs were high reliability SNPs found in my Full Genomes analysis. All three were present in a single L2* individual from the Francalacci dataset. Even though the Francalacci dataset is "low pass", these SNPs were not found in any of the other Francalacci samples (1,200) or any other dataset that I looked at.
Kwheaton
04-25-2014, 10:52 PM
Rich,
Congrats on the new shared SNPS. Looks like our replacement kit should arrive Tuesday.
"I think that with the problems that FTDNA is having with their new tree, it will be a while before they start offering new SNPs and they take a long time regardless. As it is, it looks like Big-Y results are at a stand-still for the past week."
Oh what a mess the new tree is. Makes the GENO 2.0 snafu (if you remember) seem like small potatoes. I posted on FACEBOOK that they should have beta tested this with project admins first. I have three men descended form the same common ancestor. They all used to be Haplogroup I. Now they are 2 G-P37 and 1 is F-M89. Oh DEAR! (makes me feel better about mixing up two David WHEATONs)...
Alessio B. Bedini
04-26-2014, 07:34 AM
I bought DF110 on YSEQ.
With this company if you have already sent a sample to YSEQ you have to use the coupon code IDONTNEEDAKIT to get $5 off and to tell them that they don't send you a new kit.
I hope i have my results in 5-7 days ..
R.Rocca
04-26-2014, 12:07 PM
I bought DF110 on YSEQ.
With this company if you have already sent a sample to YSEQ you have to use the coupon code IDONTNEEDAKIT to get $5 off and to tell them that they don't send you a new kit.
I hope i have my results in 5-7 days ..
Thanks. Please let me know when you get your results.
R.Rocca
04-26-2014, 07:18 PM
I thought you had already tested via YSEQ? Maybe they don't realize you already have a kit there?
I think that with the problems that FTDNA is having with their new tree, it will be a while before they start offering new SNPs and they take a long time regardless. As it is, it looks like Big-Y results are at a stand-still for the past week.
FYI, I found another two SNPs that I share with the one L2+FGC10543+ Sardinian sample. The details are as follows:
Name: FGC10516
Position: 7149089
allele_anc: A
allele_der: G
Name: FGC10536
Position: 17372204
allele_anc: C
allele_der: T
I see that Thomas has already added FGC10543 to the ISOGG browser:
http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/
All three SNPs (FGC10516, FGC10536 and FGC10543) all have the following on my order status: "Primers are designed and ordered from our supplier"
Alessio B. Bedini
04-27-2014, 08:17 AM
Since this morning you can order all three SNPs (FGC10516, FGC10536 and FGC10543) on YSEQ! ;)
http://shop.yseq.net/advanced_search_result.php?keywords=FGC10543&search_in_description=1&x=0&y=0
R.Rocca
04-28-2014, 12:57 PM
Since this morning you can order all three SNPs (FGC10516, FGC10536 and FGC10543) on YSEQ! ;)
http://shop.yseq.net/advanced_search_result.php?keywords=FGC10543&search_in_description=1&x=0&y=0
Hopefully you will test these as well :)
Can you tell me if there was an additional shipping charge to have the YSEQ kit sent to Italy, and if so, how much?
Alessio B. Bedini
04-28-2014, 03:56 PM
Honestly I wish to be DF110 and not having to test other SNPs ;)
The additional shipping charge to have the YSEQ kit sent to Italy is 5 $
Biloo
05-05-2014, 05:06 PM
I sent the bam file of my big Y data to Yfull on April 19 and still no results. Is this normal ?
Hi Rich,
Britainsdna has confirmed me to be R1b-S14469. I've emailed you my SNPs.
R.Rocca
05-05-2014, 07:42 PM
Hi Rich,
Britainsdna has confirmed me to be R1b-S14469. I've emailed you my SNPs.
That is great news. S14469 is the same SNP as Full Genomes' FGC4183, which shares the same level as DF103. So, after so many years, you have shed your star. Congratulations!
Solothurn
05-05-2014, 09:48 PM
Congratulations Elly :)
Hi Rich,
Britainsdna has confirmed me to be R1b-S14469. I've emailed you my SNPs.
MitchellSince1893
05-05-2014, 10:21 PM
I sent the bam file of my big Y data to Yfull on April 19 and still no results. Is this normal ?If you are on facebook, you could ask them your status. They have a Yfull facebook page.
Mine took about 2 weeks.
Thanks, guys! Any thoughts as to tribal affiliation in Britain? Britainsdna mentioned that my S28 signature is probably Anglo-Saxon.
MitchellSince1893
05-06-2014, 03:08 AM
Thanks, guys! Any thoughts as to tribal affiliation in Britain? Britainsdna mentioned that my S28 signature is probably Anglo-Saxon.
In Britain S28/U152 is more often identified with continental Celts, Belgae, and Romans, arriving many centuries before the Anglo Saxons. S28/U152 isn't very significant in Anglo-Saxon homelands in Denmark and Northern Germany. U106 in Britain is often identified with Anglo-Saxons.
Biloo
05-06-2014, 03:16 AM
If you are on facebook, you could ask them your status. They have a Yfull facebook page.
Mine took about 2 weeks.
I just got an email from Yfull with my password, but I can't have access to the site !
MitchellSince1893
05-06-2014, 03:36 AM
I just got an email from Yfull with my password, but I can't have access to the site !
It seems to be down...probably for maintenance. Recommend you try again in a few hours.
R.Rocca
05-06-2014, 11:39 AM
In Britain S28/U152 is more often identified with continental Celts, Belgae, and Romans, arriving many centuries before the Anglo Saxons. S28/U152 isn't very significant in Anglo-Saxon homelands in Denmark and Northern Germany. U106 in Britain is often identified with Anglo-Saxons.
I agree. I think the reason why BritainsDNA labeled FGC4183/S14469 as Ango-Saxon is because it was found in a few Genome of the Netherlands samples. But L2's appearance in the English Channel could be as old as the Bell Beaker period.
Sven Vermaete
05-06-2014, 02:34 PM
This thread about l2 is becoming very large, wouldnt it be better that a sub forum under u152 is created?
Kwheaton
05-17-2014, 09:27 PM
I think a subforum is an excellent idea :amen: and anyone with administrative capacity could move this and other L2 threads there.
thebluephoenix
06-05-2014, 04:59 PM
Hi! New user here. I didn't realize Mr. Rocca had created a new U152 tree. May I ask if this tree includes data obtained from BigY and/or other sources?
I'm listed there as Z291, FTDNA still lists me as L20, I understand from my BigY results I am two levels down from Z291...and it looks like I'll be alone for a while in my box because the other two samples listed for Z291 are from 1K Genomes Project, and the other match was separated recently because he may be at a lower level (I think). I'm not sure who is my closest match in the U152 project. Any close matches out there?
Thanks!
thebluephoenix
06-05-2014, 05:02 PM
Hi! New user here. I didn't realize Mr. Rocca had created a new U152 tree. May I ask if this tree includes data obtained from BigY and/or other sources?
I'm listed there as Z291, FTDNA still lists me as L20, I understand from my BigY results I am two levels down from Z291...and it looks like I'll be alone for a while in my box because the other two samples listed for Z291 are from 1K Genomes Project, and the other match was separated recently because he may be at a lower level (I think). I'm not sure who is my closest match in the U152 project. Any close matches out there?
Thanks!
FTDNA Kit #280359
R.Rocca
06-05-2014, 06:23 PM
Hi! New user here. I didn't realize Mr. Rocca had created a new U152 tree. May I ask if this tree includes data obtained from BigY and/or other sources?
I'm listed there as Z291, FTDNA still lists me as L20, I understand from my BigY results I am two levels down from Z291...and it looks like I'll be alone for a while in my box because the other two samples listed for Z291 are from 1K Genomes Project, and the other match was separated recently because he may be at a lower level (I think). I'm not sure who is my closest match in the U152 project. Any close matches out there?
Thanks!
FTDNA Kit #280359
Yes, the tree does include Big-Y and Full Genomes samples. Your kit shares four SNPs and one deletion with kit E8588.
thebluephoenix
06-05-2014, 09:02 PM
Thanks for the answer. I didn't know we share four SNPs. Are those below Z291? I don't understand what "deletion" means exactly. Is it safe for me to assume there was a fifth SNP match that was later found to be incorrect?
As far as matches are concerned, all I know is that the matches I find listed on Ysearch have either tested negative for Z291 or tested positive for another SNP; but they are pretty much in the general geographic area: Southwest Germany/Switzerland.
R.Rocca
06-06-2014, 01:11 AM
Thanks for the answer. I didn't know we share four SNPs. Are those below Z291? I don't understand what "deletion" means exactly. Is it safe for me to assume there was a fifth SNP match that was later found to be incorrect?
As far as matches are concerned, all I know is that the matches I find listed on Ysearch have either tested negative for Z291 or tested positive for another SNP; but they are pretty much in the general geographic area: Southwest Germany/Switzerland.
No, a deletion is basically a value on the Y-chromosome that most men have, but that has for whatever reason been deleted in some men. It is something like some men having twelve repeats for an STR value and others have less (10 or 9 or 8 etc.)
STR mathces for U152 subclades carry very little weight unless there is a very specific STR signature that includes some slow moving markers.
thebluephoenix
06-06-2014, 05:43 PM
I think I understand. Thank you again for your response and for including me on your graphic. Feel free to contact me if you think I can help (new tests and such). It's kinda lonely in my box...
joneshistorian
06-06-2014, 07:48 PM
STR matches for U152 subclades carry very little weight unless there is a very specific STR signature that includes some slow moving markers.
Richard, in some R-DF13 subclades such as R-L371 with putative Welsh origins, a limited number of Y-STR markers carry a very significant weight and have an extremely high informative value.
As most experienced Y-DNA Genetic Genealogists are familiar with, the mutational speed of a marker is just one of many Y-STR factors to look at.
Other factors include the number of markers in a Y-STR signature, the frequency distribution of marker values, comparison to modals, backward mutation type analysis, InDel analysis, surname analysis, etc.
I contend that in general, that ISOGG Listing Criteria and some experienced Genetic Genealogists "experts" are undervaluing the vastly increased precision and informative value from analyzing the maximum number of: (A) testable and quality Y-SNPs (both NGS and Sanger Seq. testable) and (B) testable Y-STRs along with Y-STR Signatures in conjunction with (C) Vetted Genealogical Records and (D) Surname and language studies and (E) Peer Reviewed Histories which may include information on Ancient DNA including various colloborating dating methods (http://humanorigins.si.edu/evidence/dating).
But in this instance, my focus is on opining on the maximum or minimum of number of Y-STRs and/or Y-STR Signatures to solve some puzzles.
Some in the Cryptologist Community (http://www.nsa.gov/about/cryptologic_heritage/center_crypt_history/almanac/) often like to arrive at their conclusions with a minimum of puzzle pieces before they "get the picture" or "can connect the dots". Others look for what's not there versus what's there (found a major terrorist that way and confirmed via familial DNA (http://en.wikipedia.org/wiki/Search_for_Osama_bin_Laden)). Some in the Genetic Genealogy Community have a very respectful opinion of early pioneers in the Cryptologist Community as well as more recent ones.
I know fullu well that Y-STRs and Y-STR Signatures are just two dimension of the multi dimensional puzzle making up every man's Y chromosome DNA heritage. I strongly contend that in most cases that more puzzle pieces (Y-STR markers) are much better than lesser puzzle pieces. Again, ... in some cases ... but not all cases.
Here's an example for a R-L371 man versus a comparison man with a GD of 1 and with a varying number of puzzle pieces (Y-STR markers) at Y4 - Y12 - Y37 - Y67 - Y111 - Y444 with at least a 90% Probability that his "most recent" common ancestor (MRCA) lived no longer than a certain number of generations ago (Y12 - Y37 - Y67 - Y111 examples from FTDNA) (https://www.familytreedna.com/learn/dna-basics/ydna/):
GD0 on 4 Markers / R-L371 Y4 YSEQ $99 Signature test (DYS448; DYS 456; DYS450; DYS650): 100% Probability of MRCA of 1 Generation ago being in the R-L371 Griffith>Jones Clan to a 100% Probability of being descendant from the R-L371 "Adam" or MACA (Most Ancient Common Ancestor for R-L371 men) who has an Inferred Ancestral Haplotype dating ~150 Generations ago ... -4500 YBP from a R-DF13 ancestor.
GD1 / FTDNA Y12 $49 Test l (http://www.worldfamilies.net/marker): 90% Probability of MRCA ~40 Generations ago
GD1 / FTDNA $169 Y37 STR test: 90% Probability of MRCA ~10 Generations ago
GD1 / FTDNA $268 Y67 STR test: 90% Probability of MRCA ~8 Generations ago
GD1 / FTDNA $359 Y111 STR test: 90% Probability of MRCA ~6 Generations ago
GD1 / FGC $99 (~10% of $995 FGC price) Y444 STR test: 100% Probability of MRCA of 1 Generation ago being in the R-L371 Griffith>Jones Clan to a 100% Probability of being descendant from the R-L371 "Adam" or MACA (Most Ancient Common Ancestor for R-L371 men) who has an Ancestral Haplotype dating ~150 Generations ago ... 4500 YBP from a R-DF13 ancestor.
So, the conjoint type of question to ask is where would you allocate a spend of $99 on: Y4 or Y444?
Well, personally I would go with Y444 from FGC ... but knowing all I needed was 4 key markers to be a member of the "present" Public Terminal Hg of R-L371 and be in the Griffith>Jones clan.
The "present" R-L371 Y-SNP Terminal Hg was discovered in 2010 and listed on ISOGG in 2011 via a FTDNA WTY study. It has a unique 3 part Y-STR signature called 17-14-10 which is nearly 99.999% predictive of being a member of the R-L371 Group AND having the R-L371 Y-SNP.
Now in 2014, with NGS testing and extensive Sanger Seq. tests of various R-L371 men, we have a total of 23 "Public" "R-L371 Group" Y-SNPs ... but not even in an "investigative pipeline" at ISOGG.
With 444+ Y-STR markers now available from NGS companies such as FGC, we have entered a new age of discovery and no longer have to depend on the old and expensive ways by using FTDNA's now antiquated Y111 premier marker service (https://www.familytreedna.com/y-dna-compare.aspx) costing $359 for 111 markers versus 444+ markers from FGC (https://www.fullgenomes.com/).
My opinion is that with only about 25% of the coverage of Y-STRs as FGC offers with NGS testing, the FTDNA premier Y111 service at $359 is no longer a good value. If FTDNA were to offer a stand alone Y444 marker service at linear pricing, they could likely offer it at a 4X price of $1436.
With scrappy FGC possibly looking to announce a $995 NGS price point that includes ~2X increased Private YSNP coverage & ~4X better YSTR coverage & mtDNA coverage ... doesn't the FTDNA BIGY test at $695 look like an increasingly poor value? (http://isogg.org/wiki/Y-DNA_SNP_testing_chart)
SUMMARY: Speaking solely of one R-DF13 subclade in particular, that is R-L371 (https://groups.yahoo.com/neo/groups/RL371/info), the "weight" / "informative value" of a Y-STR Signature to identify one or multiple Y-SNPs, Y-InDels, etc. in order to obtain accurate Phylogenetic positioning / branching on: (1) a Public - <1500 Y-Tree (be it one for ISOGG, FTDNA, etc.) OR (2) a Private / Family Y-Tree should not be based solely on one factor.
Here are the 23 "Public" Y-SNPs for the R-L371 Group which span about a 2000 year time frame estimated from 2500 YBP to 4500 YBP (R-DF13 time). 22 were discovered in 2014 and 1 in 2010.
23 2678287 YFS066592 FGC10036 C T
22 6832959 YFS066615 FGC10049 T C
21 6941994 YFS066616 FGC10050 C T
20 8367167 YFS066621 FGC10053 T C
19 9110616 YFS066624 FGC10055 G A
18 13686672 FGC14576 G A
17 13675672 FGC10057 C G
16 14012168 YFS066626 FGC10058 A G
15 14642172 YFS066627 FGC10059 T A
14 16218024 YFS066632 FGC10063 A C
13 16770076 YFS066634 FGC10064 C T
12 17515320 YFS066639 FGC10066 G T
11 17686161 YFS066641 FGC10067 C A
10 18018641 YFS066643 FGC10069 A T
9 18136175 YFS066644 FGC10070 G A
8 18656470 L371 / S300 L371 / S300 T G
7 19232461 YFS066648 FGC10072 G A
6 21757819 YFS066654 FGC10074 G T
5 21981676 YFS066655 FGC10075 C T
4 22442193 FGC10077 G T
3 22478542 YFS066658 FGC10078 C T
2 24355728 YFS066667 G T
1 28504942 YFS066672 FGC10085 C T
To those feeling Up to a challenge, particularly our R-DF13 brother cousins, I hope you can check your or other NGS .BAM, .VCF, etc files to see if you are "P" Positive for any of them and report your findings back here. So in this instance, the new ISOGG Listing Criteria of "always having to see if brother subclades" are "N" Negative for a "Public" YSNP Candidate is kinda of lame in this regards. There should be an exception for highly predictive Y-STR Signatures such as the 17-14-10 one for the R-L371 Group.
However, I doubt any of you are "P" for these 23 unless you conform to the Y3 YSTR Signature of 17-14-10 for being in the "R-L371 Group" which is pretty darn predictive of at least 23 Public YSNPs and perhaps another 35 Private & less Ancient YSNPS which will indicate branching joints.
R.Rocca
06-06-2014, 09:59 PM
Richard, in some R-DF13 subclades such as R-L371 with putative Welsh origins, a limited number of Y-STR markers carry a very significant weight and have an extremely high informative value.
As most experienced Y-DNA Genetic Genealogists are familiar with, the mutational speed of a marker is just one of many Y-STR factors to look at.
...but since DF13 has nothing to with U152, it would have made more sense to place your post in the L21 forum.
MitchellSince1893
06-07-2014, 02:16 AM
If any kit at or above my tree branch had STR 395S1a=11 I would definitely take note and encourage them to do some targeted SNP tests to see if it's a potential match. So far I've only seen one R1b-U152 with that value...my father's.
But while this is a very rare value on a slow mutating marker, there's no way of knowing at this point when the mutation occurred...it could have occurred with my father or a hundred generations ago.
These values (395S1 = 11-15) were confirmed in the FGC analysis of my father's BigY kit so they appear to be valid.
Claxon
12-05-2014, 02:34 PM
I am R-PF4363, and assume this is a family marker. So, I wondered what sub clade this might be under u-152.... nothing has been forthcoming on this for a while, but I have just checked the FtDNA site for my page, and find it is now listed, apparently, under L-2.
If this is correct, what is the knowledge for L-2 as a subclade ? Thanks
Rich C
MitchellSince1893
12-14-2014, 05:57 AM
Here is a chart of R1b>L2 I created from Richard Rocca's early December U152 tree. It only goes down 2 levels from L2, but as you can see it has really expanded over the last few months.
3211
Higher Quality version located here http://media-cache-ec0.pinimg.com/originals/25/2e/25/252e255319b74b482f1770d5db36160a.jpg
See Richard's tree for more details/levels below this. At this link in the "Essentials" section https://www.familytreedna.com/public/R1b-U152/default.aspx?section=results
Kwheaton
12-14-2014, 02:49 PM
Mitchell,
Love it, love it Love it! Lokks like Christmas Presents. With your petmission I would like to share with my L2 group.
Kelly Wheaton
MitchellSince1893
12-14-2014, 02:57 PM
Sure, just give credit to Richard Rocca as it's based on his work. I need to add that to the graphic so it's already there.
Kwheaton
12-14-2014, 03:02 PM
Sure, just give credit to Richard Rocca as it's based on his work. I need to add that to the graphic so it's already there.
Indeed I will. How would you like to be cited? And thak you!
MitchellSince1893
12-14-2014, 03:15 PM
Indeed I will. How would you like to be cited? And thak you!
I just removed the old versions and added a citation to them so you can just go to the image above and use it.
You are welcome :)
Mudgeeclarke
12-15-2014, 02:04 PM
Just saw this latest post! Nice work all. :-).
I see myself on a lonely single line L2 ... Z49 ...Z57. FTDNA 206005. I hope someone joins me soon. (Richard Clarke 1831 NPE)
I'll now go back to watching every post again. :-). Happy Festive Season to all. Colin
MitchellSince1893
01-14-2015, 03:43 AM
Updated L2 Organizational chart based on Richard Rocca's Jan 2015 Tree update.
3382
Higher Resolution version here http://media-cache-ec0.pinimg.com/originals/e2/8c/d3/e28cd3ee332475646844711fcea4f4ba.jpg
MitchellSince1893
01-14-2015, 04:32 AM
Based on his prolific progeny, that L2 fella was busy. I'm guessing he had more than one wife :)
haleaton
01-14-2015, 05:53 AM
Based on his prolific progeny, that L2 fella was busy. I'm guessing he had more than one wife :)
Actually, L2 hats off to those women who had more than ten children and raised them to adulthood--very common in Colonial New England, btw. Also, if L2 lived in a matriarchal culture with multiple female chiefs then definite hats off for being so popular...
haleaton
01-14-2015, 05:56 AM
Updated L2 Organizational chart based on Richard Rocca's Jan 2015 Tree update.
3382
Higher Resolution version here http://media-cache-ec0.pinimg.com/originals/e2/8c/d3/e28cd3ee332475646844711fcea4f4ba.jpg
I hope it is okay to reuse this properly cited to encourage others to test.
Thanks to Rich Rocca for including last column which is my Eaton match with a 6/111 Whitney cousin--probably meets the ISOGG 500 year requirement. Hope to add more data soon which may push it back farther or help quantify dates.
Hope someday to find real early match on just couple of SNPs located to one side of the Alps or the other.
MitchellSince1893
01-14-2015, 06:00 AM
I hope it is okay to reuse this properly cited to encourage others to test.
Thanks to Rich Rocca for including last column which is my Eaton match with a 6/111 Whitney cousin--probably meets the ISOGG 500 year requirement. Hope to add more data soon which may push it back farther or help quantify dates.
Hope someday to find real early match on just couple of SNPs located to one side of the Alps or the other.
It's ok with me.
Kwheaton
01-27-2015, 01:17 PM
I hope it is okay to reuse this properly cited to encourage others to test.
Thanks to Rich Rocca for including last column which is my Eaton match with a 6/111 Whitney cousin--probably meets the ISOGG 500 year requirement. Hope to add more data soon which may push it back farther or help quantify dates.
Hope someday to find real early match on just couple of SNPs located to one side of the Alps or the other.
Hal, Congrats on the match! Somehow I missed it!
MitchellSince1893
02-26-2015, 02:44 AM
Updated L2 Organizational Chart, two levels down, based on Richard Rocca's "March 2015" U152 tree
https://s-media-cache-ak0.pinimg.com/originals/c6/60/21/c66021ef7bf9b1f1d13155e9875c36b5.jpg
Higher resolution version located here https://s-media-cache-ak0.pinimg.com/originals/c6/60/21/c66021ef7bf9b1f1d13155e9875c36b5.jpg
Powered by vBulletin® Version 4.2.5 Copyright © 2021 vBulletin Solutions Inc. All rights reserved.