Results 1 to 4 of 4

Thread: Two new Spaniards with U152 haplogroup in 23andMe

  1. #1
    Registered Users
    Posts
    250
    Sex
    Location
    Sevilla, Spain
    Ethnicity
    Italo-Celtic
    Nationality
    Spain
    Y-DNA (P)
    U152>L2>BY3485
    mtDNA (M)
    H65

    Italy Spain Andalucia

    Two new Spaniards with U152 haplogroup in 23andMe

    Hello,

    I am a member of a Facebook group of Iberia Genealogía-Genetics. There are two members who entered not too long ago. They did the test with 23andMe, and have obtained as results R-PF6570, ie, R-U152.

    I have read that for 23andMe, the position rs2566671 if equals:

    Rs2566671 Y 5755550 --

    It belongs to the haplogroup L2.

    For now, one of them has confirmed me (rs2566671 and 5755550 --). He lives in Catalunya, the Spanish community closest to Liguria.

    The other person will shortly confirm me if you get the same result. His grandfather was from Murcia, a community where I found Rabai families from Genoa. Currently lives in Barcelona.

    The question is. How is the company 23andMe to advance with the paternal line? What advice can you give me so that you can advance in this paternal line? I am very interested in the likelihood that these two people will descend from Ligures. Are 23andMe and YFULL compatible? Do you recommend me to look at other positions of your raw data?

    Thanks

    Regards
    Last edited by Ravai; 03-20-2017 at 08:05 AM.
    Paternal: R1b-U152+ L2+ BY4245+ BY3485+ BY3478+ , Giovanni Domenicus Rabai, b. 1609, Savona, Italy
    Maternal: Haplogroup H65, María García Martínez, b. 1746, Cuenca, Spain

    Manuel David Rabaez 1974, Manuel Rabaez 1948, Manuel Rabaez 1912, Antonio Rabay 1868, Antonio Rabay 1833, Manuel Rabay 1791, Manuel Rabay 1764, Pedro Rabai 1727, Pedro Joseph Rabai 1691, Giovanni Battista Rabai 1647, Jo. Domenicus Rabai 1609, Pietrus Rabai (work in progress...)

  2. The Following User Says Thank You to Ravai For This Useful Post:

     Kwheaton (03-20-2017)

  3. #2
    Registered Users
    Posts
    250
    Sex
    Location
    Sevilla, Spain
    Ethnicity
    Italo-Celtic
    Nationality
    Spain
    Y-DNA (P)
    U152>L2>BY3485
    mtDNA (M)
    H65

    Italy Spain Andalucia
    I already have the result of the other person (ancestors of Murcia):

    rs2566671 Y 5755550 T

    As indicated by ArmandoR1b in this thread

    "If they have a no call for rs2566671 then they can. If they have T at rs2566671 they are positive for L2. If they have C then they are negative for L2."

    Looks like it's L2.



    Regards
    Paternal: R1b-U152+ L2+ BY4245+ BY3485+ BY3478+ , Giovanni Domenicus Rabai, b. 1609, Savona, Italy
    Maternal: Haplogroup H65, María García Martínez, b. 1746, Cuenca, Spain

    Manuel David Rabaez 1974, Manuel Rabaez 1948, Manuel Rabaez 1912, Antonio Rabay 1868, Antonio Rabay 1833, Manuel Rabay 1791, Manuel Rabay 1764, Pedro Rabai 1727, Pedro Joseph Rabai 1691, Giovanni Battista Rabai 1647, Jo. Domenicus Rabai 1609, Pietrus Rabai (work in progress...)

  4. #3
    Registered Users
    Posts
    2,465
    Sex

    Hello Ravai. ¿Que tal?

    That is correct. rs2566671 Y 5755550 T means positive for L2. You can see the ancestral allele (negative) of C and the derived allele (positive) of T by putting L2 in the search box at http://ybrowse.org/gb2/gbrowse/chrY/? then clicking on the L2 in the graph. You'll see a screen with the following info -

    Code:
    L2 Details
    Name: 	L2
    Type: 	snp
    Source: 	point
    Position: 	ChrY:5755550..5755550 (+ strand)
    Length: 	1
    allele_anc: 	C
    allele_der: 	T
    comment: 	aka S139
    count_derived: 	1041
    count_tested: 	4195
    isogg_haplogroup: 	R1b1a1a2a1a2b1
    load_id: 	L2
    mutation: 	C to T
    primer_f: 	L2_F GTCTTCTCAATCCAGGGAGATG
    primer_r: 	L2_R GCTCACATCTCATAGAGGATCAG
    ref: 	Thomas Krahn (FTDNA)
    ycc_haplogroup: 	R1b1a2a1a1b3c
    primary_id: 	216064
    gbrowse_dbid: 	chrY:database
    	
    
    >L2 class=Sequence position=ChrY:5755550..5755550 (+ strand)
    T
    Rs2566671 Y 5755550 -- means no call for L2 so that person from Catalunya needs to be tested for L2 to determine if he is positive for negative for L2.

    YFull does not use the results from 23andme. YFull only used BAM files from NGS (Like BigY or YElite) and I assume WGS (like YSEQ WGS or FGC WGS).

    If you want to know if they have a recent common ancestor and from about which century then they need an NGS or WGS test. If they get the $59 YDNA12 with FTDNA by ordering it through the U152 project page at https://www.familytreedna.com/group-...Group=R1b-U152 then they can get the BigY test. FTDNA has been providing results within about 5 weeks. The BigY test is $575.

    The Yseq WGS test is $899 but it includes some features that are not available with BigY including Full mtDNA sequencing and up to 10 novel mutations be verified with your sample by Sanger sequencing. So the price of the test is comparable to FTDNA Y-DNA12 + Full mtDNA + BigY.

  5. The Following 4 Users Say Thank You to ArmandoR1b For This Useful Post:

     MitchellSince1893 (03-20-2017),  palamede (03-29-2017),  Ravai (03-21-2017),  Underworld (03-20-2017)

  6. #4
    Registered Users
    Posts
    33
    Sex
    Location
    WV
    Ethnicity
    Eng./Irish/German/French
    Nationality
    USA
    Y-DNA (P)
    R-S42, CTS7197
    mtDNA (M)
    J2b1a

    United States of America United Kingdom Ireland Germany France
    Here is a quick tool if you want to extract Y SNPs from 23andme data:

    http://www.y-str.org/2014/04/23andme-to-ysnps.html

    The output is a text file that can then be searched for SNPs that are found to be either negative or positive. I was able to find I was L2 before having any Y DNA testing done.

Similar Threads

  1. R1b/U152/L2 Haplogroup
    By St. Pierre in forum L2
    Replies: 13
    Last Post: 01-07-2020, 05:17 PM
  2. 23andme new designation for U152 and L2
    By MitchellSince1893 in forum R1b-U152
    Replies: 6
    Last Post: 07-08-2017, 05:15 AM
  3. New version of U152 Haplogroup Panel coming soon
    By MitchellSince1893 in forum YSEQ
    Replies: 10
    Last Post: 03-29-2017, 04:06 PM
  4. 23andme y-dna haplgroup read accuracy: U152 vs L2
    By MitchellSince1893 in forum 23andMe
    Replies: 11
    Last Post: 06-11-2016, 04:05 AM
  5. Age estimates for haplogroup U152
    By rokousa in forum R1b-U152
    Replies: 0
    Last Post: 07-31-2014, 10:18 AM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •