Page 11 of 12 FirstFirst ... 9101112 LastLast
Results 101 to 110 of 120

Thread: Graeco-Bactrians, Indo-Greeks, Seleucids et. al.

  1. #101
    Registered Users
    Posts
    799
    Sex
    Y-DNA (P)
    J-M241
    mtDNA (P)
    M5a2a

    Quote Originally Posted by parasar View Post
    For this paper all M780 were also L657. So all Roma are M780+ and L657+
    Worldwide there are a few M780 that are negative for L657.

    Unfortunately that M576 is a typo in the paper for L657.
    Quote Originally Posted by parasar View Post
    I6561 sample in Sredny Stog II Alexandria is M417 Y26.
    I6561 Alexandria Ukraine 4045-3974 BC M459 M198 M417
    R1a-Z645: Z650 +, Z651 +
    R1a-Z93: Z2479 +
    R1a-Z94: Z95 +
    R1a-Y3: Y26 +, Y2-
    The Reich team now thinks that this dating may be incorrect as the date does not match the dna.
    https://anthrogenica.com/showthread....l=1#post739439
    EDIT: The page at the link has now been removed.
    "I6561 I6561 Mos70, Skeleton 5, 88 knees up tooth 2018 MathiesonNature2018 Pinhasi, Ron Context: Layer date based on 6 20-28 cM IBD individuals with Srubnaya/Alakul/Kazakhstan_MLBA individuals from 3900-3400 [based on these genetic results we ignore the direct date of 4153-3970 calBCE (5215±20 BP, PSUAMS-2832) from same site calibrated as 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020)] 5600 144 3900-3400 BCE Ukraine_MBA Alexandria Ukraine 49.54067778 37.69799444 1240K 1 1.422231 738261 .. M n/a (no relatives detected) R1a1a1 438 H2a1a"

    .

    Study only mentions them being M780, have authors issued clarification statements on typo ?

    These ones under HM82 could be considered Roma

    https://www.yfull.com/tree/H-PH124/
    https://www.yfull.com/tree/H-Z12533*/
    https://www.yfull.com/tree/H-Y17916/

    While under L657, there is none

    https://www.yfull.com/tree/R-L657/


    Is this an assumption or a fact Roma are indeed L657? How can It be checked if someone needs to verify that.


    The Pannonian Steppe[1] is a variety of grassland ecosystems[2] found in the Pannonian Basin. It is an exclave of the Great Eurasian Steppe, found in modern-day Austria, Bulgaria, Hungary, Romania, Serbia and Slovakia.[3]
    Isn't not far from Ukraine where Y3 was found, had presence of Y3 extended to Pannonian steppe as well ?

    What is being found in Roma in Ukraine ?

    https://en.wikipedia.org/wiki/Romani_people_in_Ukraine
    Last edited by discreetmaverick; 07-29-2021 at 10:27 PM. Reason: Added Info

  2. #102
    Gold Class Member
    Posts
    8,479

    Quote Originally Posted by discreetmaverick View Post
    Study only mentions them being M780, have authors issued clarification statements on typo ?

    ...


    Is this an assumption or a fact Roma are indeed L657? How can It be checked if someone needs to verify that.


    ...


    Fact. All their M780 are L657.
    Both M780 and L657 were typed.
    M780 C to T 386 130 21610995 HpaII GAAGATCCAAAACCTAAGAGAAC GCTCAATGAGGAAGGCGATC
    L657 S347 G to A 399 93 14159864 Hpy166II TGCTGGGATACAAGCATGAGC CAGAAATCACCCGTCTTCTGC

    In this sample they did not have any sample to resolve a branch between M780 and L657.



    "The four subhaplogroups of Z93 (branches 9-M582, 10-M560, 12-Z2125, and 17-M780, L657) constitute a multifurcation unresolved by 10 Mb of sequencing"

  3. #103
    Registered Users
    Posts
    799
    Sex
    Y-DNA (P)
    J-M241
    mtDNA (P)
    M5a2a

    Quote Originally Posted by parasar View Post

    "The four subhaplogroups of Z93 (branches 9-M582, 10-M560, 12-Z2125, and 17-M780, L657) constitute a multifurcation unresolved by 10 Mb of sequencing"
    I did went through the tree, but Roma branch is not mentioned in the tree, so wasn't sure if they will be mentioned as other ones with R1a-M780. L-657 or a earlier branching leaf or node with only M780

  4. #104
    Gold Class Member
    Posts
    8,479

    Quote Originally Posted by discreetmaverick View Post
    I did went through the tree, but Roma branch is not mentioned in the tree, so wasn't sure if they will be mentioned as other ones with R1a-M780. L-657 or a earlier branching leaf or node with only M780
    There is no Roma branch, the ones mentioned on the tree are just the 13 samples (13 whole R1 Y-chromosome sequences: 8 novel, 2 previously published,4 and 3 from the 1000 Genomes Project.) fully sequenced for 9.99 Mb.
    The other samples were not fully sequenced but only checked for the relevant SNPs including M780 and L657.

  5. The Following User Says Thank You to parasar For This Useful Post:

     discreetmaverick (07-30-2021)

  6. #105
    Registered Users
    Posts
    470
    Location
    USA
    Y-DNA (P)
    H-Z4417
    mtDNA (M)
    M3d

    Quote Originally Posted by discreetmaverick View Post
    Except H and R2a why is L1a1/L1a2/SA J2b2 and other south asian haplogroups completely missing in Roma population, were they found in any other studies ?
    I don't think they are missing in the overall West Asian Domari type people, of which Roma are a severely bottlenecked European branch. The bottleneck caused Roma to lose many branches of a haplogroup or entire haplogroups, while also creating strong founder effects w.r.t. a few clades.

  7. The Following User Says Thank You to thejkhan For This Useful Post:

     parasar (07-31-2021)

  8. #106
    Registered Users
    Posts
    799
    Sex
    Y-DNA (P)
    J-M241
    mtDNA (P)
    M5a2a

    Quote Originally Posted by Shujauddin View Post
    So this certifies what i said " that the greeks never made it to eastern india i.e. Pataluputra. After the battle of Hydaspes, he decided to return to west.
    Surprisingly, As per Craterus contemporary of Alexander, Alexander himself reached Ganges,

    Craterus was one of the favourite companions of Alexander. He commisoned him leading a division of the army via land route65 and join him in Carmania.66 Soon after Alexander’s death he lost his life in a battle with Eumenes. He is quoted by Strabo for a letter attributed to him and adressed to his mother, Aristopatra. In this letter he stated that Alexander reached the Ganges, and he, too saw that river.
    https://core.ac.uk/download/pdf/200973948.pdf

  9. #107
    Registered Users
    Posts
    62
    Sex

    Quote Originally Posted by discreetmaverick View Post
    Surprisingly, As per Craterus contemporary of Alexander, Alexander himself reached Ganges,



    https://core.ac.uk/download/pdf/200973948.pdf
    interesting to see different versions of history we have. Nothing conclusive but just different versions.

  10. The Following User Says Thank You to Shujauddin For This Useful Post:

     discreetmaverick (07-30-2021)

  11. #108
    Gold Class Member
    Posts
    502
    Sex
    Location
    UK
    Ethnicity
    Punjabi (Jatt)
    Y-DNA (P)
    R2b (R-Y136220)
    mtDNA (M)
    M3a1

    Quote Originally Posted by discreetmaverick View Post
    Surprisingly, As per Craterus contemporary of Alexander, Alexander himself reached Ganges,

    Craterus was one of the favourite companions of Alexander. He commisoned him leading a division of the army via land route65 and join him in Carmania.66 Soon after Alexander’s death he lost his life in a battle with Eumenes. He is quoted by Strabo for a letter attributed to him and adressed to his mother, Aristopatra. In this letter he stated that Alexander reached the Ganges, and he, too saw that river.
    https://core.ac.uk/download/pdf/200973948.pdf
    In this letter he stated that Alexander reached the Ganges, and he, too saw that river. It is not for this false
    information
    but for the uncredibility of data given by Craterus is the reason for Strabo’s
    rejection of this communication. This exaggeration, that is Alexander reaching as far
    as the Ganges
    -

    if it existed, the false letter of Craterus. Alexander and his army has never seen the Ganges. In fact they came to know about it only after
    crossing the Indus and its tributaries. Even their informants may have not seen that river personally but they had all the reasons for exaggerations which certainly proved an effective means in discouraging Alexander’s army threatening both with the river and the big empire alongside. Untill Megasthenes’ Indica there was not a trustworthy description of the Ganges and even after him much remained for speculation out of which Strabo could not escape

  12. The Following 4 Users Say Thank You to laltota For This Useful Post:

     AlluGobi (07-31-2021),  J-Live (07-30-2021),  parasar (07-31-2021),  Rahuls77 (08-01-2021)

  13. #109
    Registered Users
    Posts
    799
    Sex
    Y-DNA (P)
    J-M241
    mtDNA (P)
    M5a2a

    Quote Originally Posted by laltota View Post
    In this letter he stated that Alexander reached the Ganges, and he, too saw that river. It is not for this false
    information
    but for the uncredibility of data given by Craterus is the reason for Strabo’s
    rejection of this communication. This exaggeration, that is Alexander reaching as far
    as the Ganges
    -

    if it existed, the false letter of Craterus. Alexander and his army has never seen the Ganges. In fact they came to know about it only after
    crossing the Indus and its tributaries. Even their informants may have not seen that river personally but they had all the reasons for exaggerations which certainly proved an effective means in discouraging Alexander’s army threatening both with the river and the big empire alongside. Untill Megasthenes’ Indica there was not a trustworthy description of the Ganges and even after him much remained for speculation out of which Strabo could not escape
    I did read that , but it is again Author and Strabo interpretation/assumption, Strabo was not contemporary. Quoting from the original source.

    Strabo[n 1] (/ˈstreɪboʊ/; Greek: Στράβων Strábōn; 64 or 63 BC – c. 24 AD) was a Greek geographer, philosopher, and historian who lived in Asia Minor during the transitional period of the Roman Republic into the Roman Empire.
    This is mentioned by Diodorus Siculus of 1st Century BC as well,

    Diodorus Siculus (/ˌdaɪəˈdɔːrəs ˈsɪkjʊləs/; Koinē Greek: Διόδωρος Σικελιώτης Diodoros Sikeliotes; fl. 1st century BC) or Diodorus of Sicily was an ancient Greek historian. He is known for writing the monumental universal history Bibliotheca historica, in forty books, fifteen of which survive intact,[1] between 60 and 30 BC.
    https://en.wikipedia.org/wiki/Diodorus_Siculus


    This river [Ganges], which is thirty stades in width, flows from north to south and empties into the ocean, forming the boundary towards the east of the tribe of the Gandaridae, which possesses the greatest number of elephants and the largest in size. Consequently no foreign king has ever subdued this country, all alien nations being fearful of both the multitude and the strength of the beasts. In fact even Alexander of Macedon, although he had subdued all Asia, refrained from making war upon the Gandaridae alone of all peoples; for when he had arrived at the Ganges river with his entire army, after his conquest of the rest of the Indians, upon learning that the Gandaridae had four thousand elephants equipped for war he gave up his campaign against them.
    https://en.wikipedia.org/wiki/Gangaridai

    Diodorus Siculus, Bibliotheca historica 2.37.2-3. Translated by Charles Henry Oldfather.[7]
    Last edited by discreetmaverick; 07-30-2021 at 11:24 PM.

  14. #110
    Registered Users
    Posts
    799
    Sex
    Y-DNA (P)
    J-M241
    mtDNA (P)
    M5a2a

    Quote Originally Posted by discreetmaverick View Post


    This is mentioned by Diodorus Siculus of 1st Century BC as well,



    https://en.wikipedia.org/wiki/Diodorus_Siculus




    https://en.wikipedia.org/wiki/Gangaridai

    Diodorus Siculus, Bibliotheca historica 2.37.2-3. Translated by Charles Henry Oldfather.[7]
    The earliest surviving description of Gangaridai appears in Bibliotheca historica of the 1st century BCE writer Diodorus Siculus. This account is based on a now-lost work, probably the writings of either Megasthenes or Hieronymus of Cardia.[5]
    Hieronymus of Cardia (Greek: Ἱερώνυμος ὁ Καρδιανός, 354?–250 BC) was a Greek general and historian from Cardia in Thrace, and a contemporary of Alexander the Great (356–323 BC).
    https://en.wikipedia.org/wiki/Hieronymus_of_Cardia

    So, two of the contemporaries have been claimed to have mentioned this,

    However,

    In Book 17 of Bibliotheca historica, Diodorus once again describes the "Gandaridae", and states that Alexander had to retreat after his soldiers refused to take an expedition against the Gandaridae. The book (17.91.1) also mentions that a nephew of Porus fled to the land of the Gandaridae,[7] although C. Bradford Welles translates the name of this land as "Gandara".[9]
    https://en.wikipedia.org/wiki/Gangaridai#Diodorus

    Gandaridae/Gangaridai - Ganga,

    Wonder if a river was identified or called from rivers that flow in Gandhara as Ganga?

    For instance, many rivers are called with Ganga, Kishenganga(Neelum), dakshinganga(Godavari), Wainganga, Painganga.

    Also, like Kashi - Kashgar,

    The Kashgar (or Kaxgar, in its upper course Kyzylsuu, Uighur: قەشقەر دەرياسى, romanized: Qeshqer deryasi) is a river in the Xinjiang province of the People's Republic of China. It has its sources in the eastern parts of the Pamir Mountains, notably the Alay Valley, in the border area between China and Kyrgyzstan, and then flows eastwards, through the Erkeshtam pass passing through the city of Kashgar, which gets its name from the river.
    https://en.wikipedia.org/wiki/Kashgar

Page 11 of 12 FirstFirst ... 9101112 LastLast

Similar Threads

  1. Greeks are 1/4 of the Slavs?
    By Cracow in forum Autosomal (auDNA)
    Replies: 152
    Last Post: 06-03-2021, 01:17 PM
  2. Are Pontic Greeks just hellenized Laz?
    By bunalim in forum General
    Replies: 18
    Last Post: 09-11-2020, 09:05 PM
  3. are Kalash Indo Aryan or Proto Indo Aryan?
    By akash in forum Southern
    Replies: 0
    Last Post: 07-26-2020, 06:08 PM
  4. Replies: 129
    Last Post: 09-25-2018, 01:10 PM
  5. Greeks with Slavic Ancestry and Without
    By firemonkey in forum Autosomal (auDNA)
    Replies: 1
    Last Post: 08-15-2015, 07:55 AM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •