What is ZZ11 and what do we do with it?

[TigerMW]

Alex Williamson discovered and documented ZZ11 in the Big Tree. It is in the MRCA of both DF27 and U152 and ZZ11 is a descendant of P312.

http://ytree.net/DisplayTree.php?blockID=2&star=false

http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

Unfortunately ZZ11_1 22286799-C-G sits in the DYZ19 region.

ISOGG describes ZZ SNPs in this way,
"ZZ = Alex Williamson. Mutations in palindromic regions. Each ZZ prefix represents two possible SNP locations."

We don't have a location for ZZ11_2 documented in YBrowse. Can ZZ11_2's position-anc-der be derived or predicted?

Most testing institutions don't really like this kind of SNP. It is a risky SNP, no doubt. If I thought I was ZZ11* (DF27- U152-) it would be especially risky or if I thought was P312* the same would be the case. It might have been wiped out.

Given all of that, I don't know that ZZ11 does much terms of making formal, conservative trees but that does not eliminate its importance in the phylogeny. It pretty much proves DF27 and U152 are more closely related to each other than to L21, DF19, DF99 or L238, right?

I don't think ZZ11 should be included in a SNP testing approach based on traversing the tree, but I could be wrong.

SNP Packs are not tree traversing, they "all in one" fell swoops. I don't know if FTDNA would accept ZZ11 but we could try to get it in something. The likely places would be the R1b-M343 Backbone or the R1b-P312 Packs. What do you think of trying to get this placed in a pack?

[swid]

It doesn't show up when you expand out the ZZ11 branch on its own Big Tree page, but Alex does also list Z38841 as a second mutation on that block on the main page itself; unfortunately, it's equally "risky" as it's really an STR.

[razyn]

OK, there are 15 results for P312 SNP packs that I can see in the DF27 project. One is U152 and shouldn't be in it, but I can see his result, so I checked.

And what I see is, the test "worked" for 12 of the 15, including the U152 guy: ZZ11*, in which the asterisk means "no-call or heterozygous result." And a heterozygous result there is the call that one should expect, in a sample positive for this elusive SNP.

So, the pack is testing for it, and mostly returning what looks like the right call for these guys. There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it. But the P312 pack is in its earliest days, so maybe that's just "noise." Anyway, I'm pleased that the effort is being made.

[lgmayka]

There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it.

The "mystery" is that it is very prone to back-mutation. Both members of R-Y18894 are entirely ancestral (396C and 392C) at 22286799.

The practical danger is that naive customers might actually take the ZZ11 level seriously: A customer might test ZZ11- and assume that he is also DF27- U152- , which is not a safe conclusion.

[TigerMW]

It doesn't show up when you expand out the ZZ11 branch on its own Big Tree page, but Alex does also list Z38841 as a second mutation on that block on the main page itself; unfortunately, it's equally "risky" as it's really an STR.

I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?

[TigerMW]

The "mystery" is that it is very prone to back-mutation. Both members of R-Y18894 are entirely ancestral (396C and 392C) at 22286799.

Can you put some kind of probability or range around the words "very prone"? That's hard to use in decision-making. There is an SNP in U152 that was rejected by ISOGG as it sits in an X DNA similar region but the X DNA related mutation is thought to have happened 300 to 400 thousand years ago. That's not too bad for our purposes.

I really do not know the answer but is the location really prone to back mutation or is the issue that some testing systems (maybe all today) have a hard time sequencing the DYZ19 region?

The practical danger is that naive customers might actually take the ZZ11 level seriously: A customer might test ZZ11- and assume that he is also DF27- U152- , which is not a safe conclusion.

Agreed. I'm not sure if this can nor ever should make the haplotree, but it's definitely worthwhile to know from ancient research point of view that U152 and DF27 are closely related.

[TigerMW]

OK, there are 15 results for P312 SNP packs that I can see in the DF27 project. One is U152 and shouldn't be in it, but I can see his result, so I checked.

And what I see is, the test "worked" for 12 of the 15, including the U152 guy: ZZ11*, in which the asterisk means "no-call or heterozygous result." And a heterozygous result there is the call that one should expect, in a sample positive for this elusive SNP.

So, the pack is testing for it, and mostly returning what looks like the right call for these guys. There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it. But the P312 pack is in its earliest days, so maybe that's just "noise." Anyway, I'm pleased that the effort is being made.

I think you are saying the test results were "no calls" for 42481, 52129 and 114395. That's different than an ancestral call. I'm a little concerned about testing and consulting institutions in terms of our assumptions on ancestral values and ambiguous calls. Ambiguity implies we can't be sure. An interpretation is just an interpretation. Different types of testing systems might shed light on ambiguities.

However, this the kind of bad news I was expecting on experimental SNPs. I just checked. ZZ11 is no longer in the R1b-P312 SNP Pack list. Remember, I said that FTDNA was scrubbing their SNP list in the first quarter of this year. ZZ11 may be a casualty. Rather than struggle through these interpretations in difficult regions, some things will be thrown out the door.

[swid]

I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?

You'll get text with information if you hover over Z38841 on the main page: "Change from 10 copies of GAATG to 9 copies at position 13840815."; it's also listed on the mutations page: 13840815-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT G-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG

[razyn]

I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?

YFull search says 17673197, C to T

[TigerMW]

You'll get text with information if you hover over Z38841 on the main page: "Change from 10 copies of GAATG to 9 copies at position 13840815."; it's also listed on the mutations page: 13840815-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT G-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG

There are several rs mutations in YBrowse in this area.

http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

Z38841 itself was apparently not considered for YBrowse.