Page 1 of 3 123 LastLast
Results 1 to 10 of 27

Thread: What is ZZ11 and what do we do with it?

  1. #1
    Registered Users
    Posts
    4,292
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Question What is ZZ11 and what do we do with it?

    Alex Williamson discovered and documented ZZ11 in the Big Tree. It is in the MRCA of both DF27 and U152 and ZZ11 is a descendant of P312.

    http://ytree.net/DisplayTree.php?blockID=2&star=false

    http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

    Unfortunately ZZ11_1 22286799-C-G sits in the DYZ19 region.

    ISOGG describes ZZ SNPs in this way,
    "ZZ = Alex Williamson. Mutations in palindromic regions. Each ZZ prefix represents two possible SNP locations."

    We don't have a location for ZZ11_2 documented in YBrowse. Can ZZ11_2's position-anc-der be derived or predicted?

    Most testing institutions don't really like this kind of SNP. It is a risky SNP, no doubt. If I thought I was ZZ11* (DF27- U152-) it would be especially risky or if I thought was P312* the same would be the case. It might have been wiped out.

    Given all of that, I don't know that ZZ11 does much terms of making formal, conservative trees but that does not eliminate its importance in the phylogeny. It pretty much proves DF27 and U152 are more closely related to each other than to L21, DF19, DF99 or L238, right?

    I don't think ZZ11 should be included in a SNP testing approach based on traversing the tree, but I could be wrong.

    SNP Packs are not tree traversing, they "all in one" fell swoops. I don't know if FTDNA would accept ZZ11 but we could try to get it in something. The likely places would be the R1b-M343 Backbone or the R1b-P312 Packs. What do you think of trying to get this placed in a pack?

  2. The Following 2 Users Say Thank You to TigerMW For This Useful Post:

     dp (04-21-2016),  haleaton (04-21-2016)

  3. #2
    Registered Users
    Posts
    167
    Sex
    Location
    Missouri, United States
    Ethnicity
    various European
    Nationality
    American
    Y-DNA (P)
    R-BY19442
    mtDNA (M)
    H3ac

    United States of America Ireland England Czech Republic France Scotland
    It doesn't show up when you expand out the ZZ11 branch on its own Big Tree page, but Alex does also list Z38841 as a second mutation on that block on the main page itself; unfortunately, it's equally "risky" as it's really an STR.

  4. #3
    Gold Class Member
    Posts
    2,068
    Sex
    Location
    Virginia, USA
    Y-DNA (P)
    DF27, FGC15733
    mtDNA (M)
    T2f3

    OK, there are 15 results for P312 SNP packs that I can see in the DF27 project. One is U152 and shouldn't be in it, but I can see his result, so I checked.

    And what I see is, the test "worked" for 12 of the 15, including the U152 guy: ZZ11*, in which the asterisk means "no-call or heterozygous result." And a heterozygous result there is the call that one should expect, in a sample positive for this elusive SNP.

    So, the pack is testing for it, and mostly returning what looks like the right call for these guys. There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it. But the P312 pack is in its earliest days, so maybe that's just "noise." Anyway, I'm pleased that the effort is being made.

  5. #4
    Gold Class Member
    Posts
    2,718
    Sex

    Quote Originally Posted by razyn View Post
    There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it.
    The "mystery" is that it is very prone to back-mutation. Both members of R-Y18894 are entirely ancestral (396C and 392C) at 22286799.

    The practical danger is that naive customers might actually take the ZZ11 level seriously: A customer might test ZZ11- and assume that he is also DF27- U152- , which is not a safe conclusion.
    Last edited by lgmayka; 04-20-2016 at 05:22 PM.

  6. The Following User Says Thank You to lgmayka For This Useful Post:

     dp (04-21-2016)

  7. #5
    Registered Users
    Posts
    4,292
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Quote Originally Posted by swid View Post
    It doesn't show up when you expand out the ZZ11 branch on its own Big Tree page, but Alex does also list Z38841 as a second mutation on that block on the main page itself; unfortunately, it's equally "risky" as it's really an STR.
    I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?

  8. #6
    Registered Users
    Posts
    4,292
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Quote Originally Posted by lgmayka View Post
    The "mystery" is that it is very prone to back-mutation. Both members of R-Y18894 are entirely ancestral (396C and 392C) at 22286799.
    Can you put some kind of probability or range around the words "very prone"? That's hard to use in decision-making. There is an SNP in U152 that was rejected by ISOGG as it sits in an X DNA similar region but the X DNA related mutation is thought to have happened 300 to 400 thousand years ago. That's not too bad for our purposes.

    I really do not know the answer but is the location really prone to back mutation or is the issue that some testing systems (maybe all today) have a hard time sequencing the DYZ19 region?

    Quote Originally Posted by lgmayka View Post
    The practical danger is that naive customers might actually take the ZZ11 level seriously: A customer might test ZZ11- and assume that he is also DF27- U152- , which is not a safe conclusion.
    Agreed. I'm not sure if this can nor ever should make the haplotree, but it's definitely worthwhile to know from ancient research point of view that U152 and DF27 are closely related.
    Last edited by TigerMW; 04-20-2016 at 05:59 PM.

  9. The Following User Says Thank You to TigerMW For This Useful Post:

     Lugus (04-20-2016)

  10. #7
    Registered Users
    Posts
    4,292
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Quote Originally Posted by razyn View Post
    OK, there are 15 results for P312 SNP packs that I can see in the DF27 project. One is U152 and shouldn't be in it, but I can see his result, so I checked.

    And what I see is, the test "worked" for 12 of the 15, including the U152 guy: ZZ11*, in which the asterisk means "no-call or heterozygous result." And a heterozygous result there is the call that one should expect, in a sample positive for this elusive SNP.

    So, the pack is testing for it, and mostly returning what looks like the right call for these guys. There may be some mystery as to why three samples (42481, 52129 and 114395) didn't get a call for it. But the P312 pack is in its earliest days, so maybe that's just "noise." Anyway, I'm pleased that the effort is being made.
    I think you are saying the test results were "no calls" for 42481, 52129 and 114395. That's different than an ancestral call. I'm a little concerned about testing and consulting institutions in terms of our assumptions on ancestral values and ambiguous calls. Ambiguity implies we can't be sure. An interpretation is just an interpretation. Different types of testing systems might shed light on ambiguities.

    However, this the kind of bad news I was expecting on experimental SNPs. I just checked. ZZ11 is no longer in the R1b-P312 SNP Pack list. Remember, I said that FTDNA was scrubbing their SNP list in the first quarter of this year. ZZ11 may be a casualty. Rather than struggle through these interpretations in difficult regions, some things will be thrown out the door.

  11. #8
    Registered Users
    Posts
    167
    Sex
    Location
    Missouri, United States
    Ethnicity
    various European
    Nationality
    American
    Y-DNA (P)
    R-BY19442
    mtDNA (M)
    H3ac

    United States of America Ireland England Czech Republic France Scotland
    Quote Originally Posted by Mikewww View Post
    I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?
    You'll get text with information if you hover over Z38841 on the main page: "Change from 10 copies of GAATG to 9 copies at position 13840815."; it's also listed on the mutations page: 13840815-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT G-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG

  12. #9
    Gold Class Member
    Posts
    2,068
    Sex
    Location
    Virginia, USA
    Y-DNA (P)
    DF27, FGC15733
    mtDNA (M)
    T2f3

    Quote Originally Posted by Mikewww View Post
    I can't find Z38841's positionnum-anc-der details anywhere. Do you have them?
    YFull search says 17673197, C to T

  13. #10
    Registered Users
    Posts
    4,292
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Quote Originally Posted by swid View Post
    You'll get text with information if you hover over Z38841 on the main page: "Change from 10 copies of GAATG to 9 copies at position 13840815."; it's also listed on the mutations page: 13840815-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT G-CGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATG
    There are several rs mutations in YBrowse in this area.

    http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

    http://ybrowse.y-chromosome.org/gb2/...hrY%3Adatabase

    Z38841 itself was apparently not considered for YBrowse.

Page 1 of 3 123 LastLast

Similar Threads

  1. ZZ11
    By Webb in forum R1b-P312
    Replies: 7
    Last Post: 02-02-2021, 04:38 PM
  2. More Bell Beaker U152 and one ZZ11?
    By R.Rocca in forum Ancient (aDNA)
    Replies: 45
    Last Post: 11-22-2016, 09:40 PM
  3. P312 > ZZ11 > DF27 > ZZ12 > ZZ19,ZZ20,(x L195) >
    By Mike McG in forum R1b-DF27
    Replies: 3
    Last Post: 10-08-2014, 10:54 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •