Page 1 of 4 123 ... LastLast
Results 1 to 10 of 38

Thread: FTDNA is now offering a R1b - Z49 SNP Pack

  1. #1
    Registered Users
    Posts
    4,413
    Sex
    Location
    Tierra de Ayllon
    Y-DNA (P)
    U152>L2>Z49>Z142>
    mtDNA (M)
    H1bt
    Y-DNA (M)
    I2a2a1b2a1b1>Y4925
    mtDNA (P)
    H37

    England Scotland Wales Germany Ireland Sweden Finns

    FTDNA is now offering a R1b - Z49 SNP Pack

    R1b - Z49 SNP Pack

    Includes the following SNPs on the haplotree:
    U152, L2, Z49, Z150, S42, CTS7970, CTS8125, CTS11381, Z51, L562, Z57, Z148, Z149, Z52, CTS11232, CTS278, Z367, PF6658, Y4355, S8183, Z193, Z68, S22778, Y16862, Y17181, Y17179, Y17180, Y17176, Y4356, Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610, Y4353, Y4354, S12993, FGC31475, BY3626, FGC20775, FGC20778, FGC20779, FGC20781, FGC20780, FGC20782, FGC20786, Y16875, Y16876, Y16877, Y16878, Y17272, Y17273, Y17274, Z142, S18325, FGC22942, FGC22963, FGC22969, FGC22968, Z12222, Z26720, CTS9490, BY3624, A8451, A8453, A8454, A8455, BY3612, BY1210, BY3617, BY1350, BY1375, FGC37040, FGC37041, FGC37043, FGC37046, FGC37047, FGC37048, FGC37049, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, L553, BY3616, L654, BY1542, A6296, A6297, A6298, A6300, A6301, A6302, CTS7197, S1491, S1480, BY3623, BY3625, Z147, Z53, BY3613, BY3614, BY3615, BY3618, BY3620, BY3621, BY3622, ZP67, Y18894, Y18895, Y18896, Y18897, BZ28, Y18899, S20376, BY5702, BY1701, FGC22938, FGC22941, FGC22952, FGC22956, Y17276, Y17277, Y17278, Y17279, Y17280, BY5699, BY5704, BY5703, BY5698, BY5700, BY5694, BY5692, BY5693, BY5695, BY5696, BY5697, BY5701, BY5722, BY5723, BY5724, BY5725

    Includes the following SNPs that are NOT on the haplotree:
    S8172, Z18331, A8433, A8434, A8438, A8439, A8440, Z29988, Z29989, A8442, Z29990, A8443, CTS4962, S20782, BY5721, BY1349
    Y DNA line continued: Z142>Z12222>FGC12378>FGC12401>FGC12384
    35% English, 26% Scot/Ulster Scot, 14% Welsh, 14% German, 5% Ireland, 3% Nordic, 2% French/Dutch, 1% India
    Hidden Content

  2. The Following 4 Users Say Thank You to MitchellSince1893 For This Useful Post:

     gotten (06-24-2016),  R.Rocca (06-24-2016),  TigerMW (06-24-2016),  Walkman (06-24-2016)

  3. #2
    Registered Users
    Posts
    180
    Sex
    Location
    Reston, VA, USA
    Ethnicity
    Anglo-Norman Irish
    Nationality
    USA
    Y-DNA (P)
    R1b-Z49>S8183
    mtDNA (M)
    U4c1a

    Ireland Germany England Scotland Wales
    Our surname project really lucked out. This SNP Pack contains a number of markers that, to date, are exclusive to our family line, to wit: Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610 and BY 5698. They give us the potential to confirm genealogical relationships within the past 300-500 years. I'm hoping that some of the members who have been reluctant to do deeper testing will take advantage of this opportunity, and have contacted about a dozen of them to encourage them to order the SNP Pack.

  4. The Following 2 Users Say Thank You to jbarry6899 For This Useful Post:

     MitchellSince1893 (06-24-2016),  Walkman (06-24-2016)

  5. #3
    Registered Users
    Posts
    4,413
    Sex
    Location
    Tierra de Ayllon
    Y-DNA (P)
    U152>L2>Z49>Z142>
    mtDNA (M)
    H1bt
    Y-DNA (M)
    I2a2a1b2a1b1>Y4925
    mtDNA (P)
    H37

    England Scotland Wales Germany Ireland Sweden Finns
    Quote Originally Posted by jbarry6899 View Post
    Our surname project really lucked out. This SNP Pack contains a number of markers that, to date, are exclusive to our family line, to wit: Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610 and BY 5698. They give us the potential to confirm genealogical relationships within the past 300-500 years. I'm hoping that some of the members who have been reluctant to do deeper testing will take advantage of this opportunity, and have contacted about a dozen of them to encourage them to order the SNP Pack.
    Hopefully there will be an opportunity for an update to the Z49 pack.

    Last week, with the release of a close matches' FGC results, approximately 17 of my formerly private BigY SNPs became terminal SNPs, forming a new branch below R-FGC12401.
    Y DNA line continued: Z142>Z12222>FGC12378>FGC12401>FGC12384
    35% English, 26% Scot/Ulster Scot, 14% Welsh, 14% German, 5% Ireland, 3% Nordic, 2% French/Dutch, 1% India
    Hidden Content

  6. The Following User Says Thank You to MitchellSince1893 For This Useful Post:

     Walkman (06-24-2016)

  7. #4
    Registered Users
    Posts
    581
    Sex
    Y-DNA (P)
    R-U152>>Z142>>S23458
    mtDNA (M)
    I4a

    Hi all,
    I am rather frustrated with all these new BY#### and Y#### numbers. I haven't found a way to determine their position numbers (except to wait for ISOGG to eventually provide that information; which could be a very long wait). I am now in BY5692, but have no idea which position number that corresponds to. And on the YFull tree, never could figure out the position number for Y19124.
    ------------------Ken

    -----------------------------------------------------------------------------------------------------------------------------------------------------------------

    Quote Originally Posted by MitchellSince1893 View Post
    R1b - Z49 SNP Pack

    Includes the following SNPs on the haplotree:
    U152, L2, Z49, Z150, S42, CTS7970, CTS8125, CTS11381, Z51, L562, Z57, Z148, Z149, Z52, CTS11232, CTS278, Z367, PF6658, Y4355, S8183, Z193, Z68, S22778, Y16862, Y17181, Y17179, Y17180, Y17176, Y4356, Y11179, Y11180, Y11181, Y11182, Y11183, Y11184, Y11185, Y11186, Y13610, Y4353, Y4354, S12993, FGC31475, BY3626, FGC20775, FGC20778, FGC20779, FGC20781, FGC20780, FGC20782, FGC20786, Y16875, Y16876, Y16877, Y16878, Y17272, Y17273, Y17274, Z142, S18325, FGC22942, FGC22963, FGC22969, FGC22968, Z12222, Z26720, CTS9490, BY3624, A8451, A8453, A8454, A8455, BY3612, BY1210, BY3617, BY1350, BY1375, FGC37040, FGC37041, FGC37043, FGC37046, FGC37047, FGC37048, FGC37049, FGC12378, FGC12379, FGC12380, FGC12381, FGC12382, FGC12383, FGC12401, FGC12402, FGC12404, L553, BY3616, L654, BY1542, A6296, A6297, A6298, A6300, A6301, A6302, CTS7197, S1491, S1480, BY3623, BY3625, Z147, Z53, BY3613, BY3614, BY3615, BY3618, BY3620, BY3621, BY3622, ZP67, Y18894, Y18895, Y18896, Y18897, BZ28, Y18899, S20376, BY5702, BY1701, FGC22938, FGC22941, FGC22952, FGC22956, Y17276, Y17277, Y17278, Y17279, Y17280, BY5699, BY5704, BY5703, BY5698, BY5700, BY5694, BY5692, BY5693, BY5695, BY5696, BY5697, BY5701, BY5722, BY5723, BY5724, BY5725

    Includes the following SNPs that are NOT on the haplotree:
    S8172, Z18331, A8433, A8434, A8438, A8439, A8440, Z29988, Z29989, A8442, Z29990, A8443, CTS4962, S20782, BY5721, BY1349

  8. The Following User Says Thank You to kinman For This Useful Post:

     kw5368 (06-25-2016)

  9. #5
    Gold Class Member
    Posts
    2,718
    Sex

    Quote Originally Posted by kinman View Post
    And on the YFull tree, never could figure out the position number for Y19124.
    1) Go to the YFull SNP search page
    2) Enter Y19124, and click the search button
    3) Click on the R-Y19124 hyperlink
    4) Click on the word "info" to bring up a popup window
    5) Select the "SNPs" tab
    6) Click on the magnifying glass next to Y19124

    You will see:
    ---
    SNP details
    ChrY position: 2960016 (+strand)
    Reference sequence (100bp): GTGAGGCAGGAGAATCGCTTGAACCCAGGAGGTGGAGGTTACAGTGAGCT
    G
    AGACAGCACCGTTGCAGCTTGGGCGACAGAGCAAGACTCGGTCTTCAAAA
    (2959965-2960066)
    ---

  10. The Following 4 Users Say Thank You to lgmayka For This Useful Post:

     kinman (06-25-2016),  kw5368 (06-25-2016),  Walkman (06-26-2016),  wombatofthenorth (06-26-2016)

  11. #6
    Registered Users
    Posts
    581
    Sex
    Y-DNA (P)
    R-U152>>Z142>>S23458
    mtDNA (M)
    I4a

    Thanks Igmayka,
    That helps me a lot to know how to do that. But I am very surprised that 2960016 does not appear on Williamson's Big Tree: http://ytree.net/DisplayTree.php?blockID=1224 . I guess that means that Williamson missed that one, or YFull made a mistake.
    --------------Ken

  12. #7
    Registered Users
    Posts
    4,413
    Sex
    Location
    Tierra de Ayllon
    Y-DNA (P)
    U152>L2>Z49>Z142>
    mtDNA (M)
    H1bt
    Y-DNA (M)
    I2a2a1b2a1b1>Y4925
    mtDNA (P)
    H37

    England Scotland Wales Germany Ireland Sweden Finns
    Not sure if this is the reason for the difference, but Big tree analysis and subsequent results are primarily based on analysis of .bed and .vcf files.

    While Ytree is based on analysis of the .bam file. So it may not be that something was missed but rather what they are analyzing and/or criteria for what is acceptable.

    Your best bet is to contact Alex Williamson and ask about this specific situation.
    Y DNA line continued: Z142>Z12222>FGC12378>FGC12401>FGC12384
    35% English, 26% Scot/Ulster Scot, 14% Welsh, 14% German, 5% Ireland, 3% Nordic, 2% French/Dutch, 1% India
    Hidden Content

  13. The Following 3 Users Say Thank You to MitchellSince1893 For This Useful Post:

     delegz (06-25-2016),  kinman (06-25-2016),  Walkman (06-26-2016)

  14. #8
    Registered Users
    Posts
    33
    Sex
    Location
    WV
    Ethnicity
    Eng./Irish/German/French
    Nationality
    USA
    Y-DNA (P)
    R-S42, CTS7197
    mtDNA (M)
    J2b1a

    United States of America United Kingdom Ireland Germany France
    This new pack doesn't help me. I already know that I am positive for S42 and CTS7197 so I'm still stuck for a while I guess. I hope that it will bring more matches to my little group of close matches though. Neither of these SNPs come up at Yfull.com. I guess the group is too small. I fit in somewhere below R-S7402, but I'm not sure where. I do wish that they would get a standardized naming of SNPs.

    Ken

  15. The Following 2 Users Say Thank You to kw5368 For This Useful Post:

     kinman (06-25-2016),  MitchellSince1893 (06-25-2016)

  16. #9
    Registered Users
    Posts
    4,413
    Sex
    Location
    Tierra de Ayllon
    Y-DNA (P)
    U152>L2>Z49>Z142>
    mtDNA (M)
    H1bt
    Y-DNA (M)
    I2a2a1b2a1b1>Y4925
    mtDNA (P)
    H37

    England Scotland Wales Germany Ireland Sweden Finns
    Quote Originally Posted by kw5368 View Post
    This new pack doesn't help me. I already know that I am positive for S42 and CTS7197 so I'm still stuck for a while I guess. I hope that it will bring more matches to my little group of close matches though. Neither of these SNPs come up at Yfull.com. I guess the group is too small. I fit in somewhere below R-S7402, but I'm not sure where. I do wish that they would get a standardized naming of SNPs.

    Ken
    A way ahead is to ask those that end up R-S7402 and have the smallest genetic distance with your STR markers to order a few $17.50 private SNPs of yours from YSEQ.net. If they come back positive you could encourage them to order BigY or FGC Y Elite to discover even more shared SNPs.

    This approach worked for over the last year...at least 16 formerly private SNPS forming a new branch.
    Last edited by MitchellSince1893; 06-26-2016 at 03:47 PM.
    Y DNA line continued: Z142>Z12222>FGC12378>FGC12401>FGC12384
    35% English, 26% Scot/Ulster Scot, 14% Welsh, 14% German, 5% Ireland, 3% Nordic, 2% French/Dutch, 1% India
    Hidden Content

  17. The Following 2 Users Say Thank You to MitchellSince1893 For This Useful Post:

     kinman (06-26-2016),  kw5368 (06-26-2016)

  18. #10
    Registered Users
    Posts
    4,413
    Sex
    Y-DNA (P)
    R1b
    mtDNA (M)
    H

    Quote Originally Posted by MitchellSince1893 View Post
    Hopefully there will be an opportunity for an update to the Z49 pack.

    Last week, with the release of a close matches' FGC results, approximately 17 of my formerly private BigY SNPs became terminal SNPs, forming a new branch below R-FGC12401.
    A request was submitted to add at least one SNP for this new branch below FGC12401.

    From the formal list of SNPs on the Advanced Orders web site, the coverage of the Z49 tree looks like this. This is my opinion. I have not seen FTDNA's haplotree on this.

    ^ L2/S139 05755550-C-T
    ^ ^ Z367/S255 09810794-T-C
    ^ ^ Z49 28462237-G-T
    _ _ Z68/S485 21058323-C-T
    ^ ^ ^ BY3613 07911232-G-A
    _ _ _ BY3614 08351220-T-A
    _ _ _ BY3615 09875990-G-A
    _ _ _ BY3618 18426210-C-A
    _ _ _ BY3620 18931192-C-G
    _ _ _ BY3621 18945200-C-A
    _ _ _ BY3622 18954214-A-T
    ^ ^ ^ S8183 02665967-G-T
    ^ ^ ^ ^ S22778 21260728-T-C
    ^ ^ ^ ^ ^ S20782 18188853-G-A
    ^ ^ ^ ^ ^ Y16862 17354634-G-A
    _ _ _ _ _ Y17181 19282874-G-A
    _ _ _ _ _ Y17179 14892862-C-T
    _ _ _ _ _ Y17180 16350552-G-A
    ^ ^ ^ ^ ^ ^ Y17176 08425530-G-A
    ^ ^ ^ ^ Y4356/FGC31474 23883529-C-T
    ^ ^ ^ ^ ^ Y11179/FGC36705 02807605-A-G
    _ _ _ _ _ Y11180 16463430-C-G
    _ _ _ _ _ Y11181/FGC36720 16699687-C-T
    _ _ _ _ _ Y11182/FGC36722 17412298-G-T
    _ _ _ _ _ Y11183/FGC36714 14414832-G-A
    _ _ _ _ _ Y11184/FGC36719 16243192-A-T
    _ _ _ _ _ Y11185/FGC36723 17509523-G-A
    _ _ _ _ _ Y11186/FGC36725 18617554-T-G
    ^ ^ ^ ^ ^ ^ ^ Y13610/FGC36710 07823757-G-T
    _ _ _ _ _ _ _ BY5701/FGC36710 20732566-T-A
    ^ ^ ^ ^ ^ ^ ^ ^ BY5697 15582095-G-A
    ^ ^ ^ ^ ^ Y4353/FGC20796 17760314-T-C
    ^ ^ ^ ^ ^ ^ BY3626/FGC20812 06762871-CAAAT-C
    _ _ _ _ _ _ FGC31475 13218678-C-T
    _ _ _ _ _ _ S12993/S12993 10025720-C-T
    _ _ _ _ _ _ Y4354/FGC20774 08356636-T-C
    ^ ^ ^ ^ ^ ^ ^ S8172 23595215-A-G
    ^ ^ ^ ^ ^ ^ ^ Y4355/FGC20777 06707665-A-G
    ^ ^ ^ ^ ^ ^ ^ ^ FGC20775/Y14088 02842598-T-C
    _ _ _ _ _ _ _ _ FGC20778/Y14135 06804217-T-G
    _ _ _ _ _ _ _ _ FGC20779/Y14089 07315755-T-G
    _ _ _ _ _ _ _ _ FGC20781/Y14137 07611397-C-G
    _ _ _ _ _ _ _ _ FGC20780/Y14136 07523890-C-A
    _ _ _ _ _ _ _ _ FGC20782/Y14138 08854928-C-T
    _ _ _ _ _ _ _ _ FGC20786/Y14090 14079163-T-G
    ^ ^ ^ ^ ^ ^ ^ ^ Y17276 07804169-A-G
    _ _ _ _ _ _ _ _ Y17277 08300943-G-C
    _ _ _ _ _ _ _ _ Y17278 08455264-G-C
    _ _ _ _ _ _ _ _ Y17279 16249348-C-T
    _ _ _ _ _ _ _ _ Y17280 23842484-C-T
    ^ ^ ^ ^ ^ ^ ^ ^ ^ Y16875 08502847-G-A
    _ _ _ _ _ _ _ _ _ Y16876 14116113-A-T
    _ _ _ _ _ _ _ _ _ Y16877 15151876-C-T
    _ _ _ _ _ _ _ _ _ Y16878 22867750-T-C
    _ _ _ _ _ _ _ _ _ Y17272 21970374-T-C
    _ _ _ _ _ _ _ _ _ Y17273 02888065-C-T
    _ _ _ _ _ _ _ _ _ Y17274 07637297-T-C
    ^ ^ ^ ^ ^ ^ ^ ^ Z18331 22444300-T-G
    ^ ^ ^ Y18894 17673197-C-T
    _ _ _ Y18895 14206391-T-C
    _ _ _ Y18896 17045258-C-T
    _ _ _ Y18897 17278611-T-C
    _ _ _ Y18899 06935417-C-T
    _ _ _ BZ28/Y18898 18642795-G-A
    ^ ^ ^ Z142/S211 16787539-A-G
    ^ ^ ^ ^ FGC22963 19066987-C-T
    _ _ _ _ FGC22969 22146356-C-T
    ^ ^ ^ ^ ^ ZP67/FGC22940 09102995-G-A
    _ _ _ _ _ FGC22968 22141669-G-C
    ^ ^ ^ ^ ^ ^ FGC22942 09798767-C-T
    _ _ _ _ _ _ S18325 16445533-T-G
    ^ ^ ^ ^ ^ ^ ^ FGC22952/Z28496 15945084-C-T
    _ _ _ _ _ _ _ FGC22956 16589450-G-C
    ^ ^ ^ ^ ^ ^ ^ ^ FGC22938 07546898-C-A
    _ _ _ _ _ _ _ _ FGC22941 09395783-G-A
    ^ ^ ^ ^ ^ ^ ^ BY5692 06859970-C-G
    _ _ _ _ _ _ _ BY5693 07160122-G-A
    _ _ _ _ _ _ _ BY5695 07915917-T-A
    _ _ _ _ _ _ _ BY5696 08793207-A-G
    ^ ^ ^ ^ ^ ^ ^ ^ BY5694 07269016-C-A
    _ _ _ _ _ _ _ _ BY5700 18761287-A-G
    ^ ^ ^ ^ ^ BY5699 18084613-T-A
    _ _ _ _ _ BY5704 26495417-A-T
    ^ ^ ^ ^ ^ ^ BY5722 07862582-G-A
    _ _ _ _ _ _ BY5723 07902781-A-G
    _ _ _ _ _ _ BY5724 07976811-A-G
    _ _ _ _ _ _ BY5725 08312085-A-G
    ^ ^ ^ ^ Z12222/S7402 08413680-A-G
    _ _ _ _ Z150/S257 03989476-T-C
    _ _ _ _ Z26720/S7402 22867545-A-T
    ^ ^ ^ ^ ^ CTS9490/M1146 18928795-C-A
    _ _ _ _ _ BY3624/A8812 24447090-A-G
    ^ ^ ^ ^ ^ ^ CTS7970/S7404 17771915-C-T
    ^ ^ ^ ^ ^ ^ ^ A8451 14066378-T-C
    _ _ _ _ _ _ _ A8454/S7409 19531938-C-T
    _ _ _ _ _ _ _ A8453/BY1438 18563403-G-T
    _ _ _ _ _ _ _ A8455/BY1805 21985235-T-C
    ^ ^ ^ ^ ^ ^ ^ ^ BY1350/A8804 17571024-T-A
    _ _ _ _ _ _ _ _ BY1375/A8805 17908123-C-T
    _ _ _ _ _ _ _ _ BY3612/A8801 07169408-C-T
    _ _ _ _ _ _ _ _ BY3617/A8803 15915461-A-G
    _ _ _ _ _ _ _ _ BY3624/A8812 24447090-A-G
    _ _ _ _ _ _ _ _ BY1210 15819689-T-C
    ^ ^ ^ ^ ^ ^ ^ CTS8125 17843894-G-A
    ^ ^ ^ ^ ^ ^ ^ ^ CTS11381 23088814-A-G
    ^ ^ ^ ^ ^ ^ FGC37040/Y17092 09893096-A-C
    _ _ _ _ _ _ FGC37041/Y17091 06628883-T-C
    _ _ _ _ _ _ FGC37043/Y17094 07766998-A-T
    _ _ _ _ _ _ FGC37046/Y17080 07106812-T-G
    _ _ _ _ _ _ FGC37047/Y17082 07771702-A-G
    _ _ _ _ _ _ FGC37048/Y17095 08676248-G-T
    _ _ _ _ _ _ FGC37049/Y17084 08808671-A-T
    ^ ^ ^ ^ ^ FGC12378/Y10987 21690021-G-T
    _ _ _ _ _ FGC12379/Y3142 07224581-G-C
    _ _ _ _ _ FGC12380/Y3143 06833853-C-T
    _ _ _ _ _ FGC12381/Y3140 09852155-C-T
    _ _ _ _ _ FGC12382/Y3144 06754788-G-C
    ^ ^ ^ ^ ^ ^ FGC12383/Y3141 07733015-T-G
    ^ ^ ^ ^ ^ ^ ^ FGC12401/Y10984 19436291-G-A
    _ _ _ _ _ _ _ FGC12402/Y10985 21290212-A-G
    _ _ _ _ _ _ _ FGC12404/Y10986 22771081-G-A
    ^ ^ ^ ^ ^ ^ ^ ^ BY5698/Y19291 16387379-A-G
    ^ ^ ^ ^ ^ ^ ^ S20376 17909529-G-T
    _ _ _ _ _ _ _ BY5702 22440780-A-T
    ^ ^ ^ ^ ^ L553 14577522-C-T
    _ _ _ _ _ BY3616 14834642-T-G
    ^ ^ ^ ^ ^ L654 02888600-T-C
    _ _ _ _ _ BY1542 19477303-G-C
    _ _ _ _ _ BY1701 20815008-C-T
    ^ ^ ^ ^ ^ ^ S42 21706472-T-C
    _ _ _ _ _ _ A6296 07220271-G-A
    _ _ _ _ _ _ A6297 07589975-G-A
    _ _ _ _ _ _ A6298 08289208-A-C
    _ _ _ _ _ _ A6300 16855836-T-A
    _ _ _ _ _ _ A6301 17251991-G-A
    _ _ _ _ _ _ A6302 19160449-C-G
    ^ ^ ^ ^ ^ ^ ^ CTS7197 17342637-G-A
    ^ ^ ^ ^ ^ ^ BY5703 23503477-A-G
    ^ ^ ^ ^ Z51/S369 15662576-A-G
    _ _ _ _ L562/S213/Z50 09790893-G-A
    ^ ^ ^ ^ ^ Z57/S1468 02650701-G-A
    ^ ^ ^ ^ ^ ^ S1491 17861407-G-C
    ^ ^ ^ ^ ^ ^ ^ S1480 16472013-G-T
    _ _ _ _ _ _ _ BY3623/YP4766 19089111-C-T
    _ _ _ _ _ _ _ BY3625 28711762-G-A
    ^ ^ ^ ^ ^ ^ ^ ^ A8433 06925867-T-C
    _ _ _ _ _ _ _ _ A8434 07570972-G-A
    _ _ _ _ _ _ _ _ A8438 15107679-T-C
    _ _ _ _ _ _ _ _ A8439 17578459-C-T
    _ _ _ _ _ _ _ _ A8440 18595622-T-C
    ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Z29988 23154451-G-C
    ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Z29989 02797205-G-A
    _ _ _ _ _ _ _ _ _ _ A8442 08397340-G-T
    _ _ _ _ _ _ _ _ _ _ Z29990 15754236-G-A
    _ _ _ _ _ _ _ _ _ _ A8443 09885704-G-A
    ^ ^ ^ ^ ^ ^ ^ ^ BY1349/A8446 17569474-G-A
    _ _ _ _ _ _ _ _ BY5721 07569474-G-A
    ^ ^ ^ ^ ^ ^ Z147 16512405-C-G
    _ _ _ _ _ _ Z148/S489 16742300-A-T
    ^ ^ ^ ^ ^ ^ ^ Z52 06893107-G-A
    _ _ _ _ _ _ _ Z53/S214 08893906-C-A
    _ _ _ _ _ _ _ Z149/S490 09052518-T-C
    ^ ^ ^ ^ ^ ^ ^ ^ CTS11232 23025429-C-T
    ^ ^ ^ ^ ^ ^ ^ ^ CTS278 02866994-G-C
    _ _ _ _ _ _ _ _ CTS4962 15927028-T-G

  19. The Following User Says Thank You to TigerMW For This Useful Post:

     kinman (07-01-2016)

Page 1 of 4 123 ... LastLast

Similar Threads

  1. FTDNA SNP Pack
    By Just_Doc in forum R1a General
    Replies: 19
    Last Post: 04-30-2018, 03:18 PM
  2. Replies: 0
    Last Post: 12-22-2016, 07:52 PM
  3. Replies: 16
    Last Post: 06-22-2016, 09:57 PM
  4. Replies: 1
    Last Post: 12-02-2015, 08:06 PM
  5. Replies: 31
    Last Post: 10-22-2014, 06:52 PM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •